ID: 948095338

View in Genome Browser
Species Human (GRCh38)
Location 2:235328994-235329016
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948095331_948095338 1 Left 948095331 2:235328970-235328992 CCACAAATTCTTTGACTCTTCTC No data
Right 948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr