ID: 948102431

View in Genome Browser
Species Human (GRCh38)
Location 2:235385418-235385440
Sequence ACTGCTGCTGGACTTGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948102431_948102441 20 Left 948102431 2:235385418-235385440 CCAAGGCCAAGTCCAGCAGCAGT No data
Right 948102441 2:235385461-235385483 CAAAACAGGGAAGTCAAAGTCGG No data
948102431_948102437 -10 Left 948102431 2:235385418-235385440 CCAAGGCCAAGTCCAGCAGCAGT No data
Right 948102437 2:235385431-235385453 CAGCAGCAGTGAGCAAGGGGTGG No data
948102431_948102439 7 Left 948102431 2:235385418-235385440 CCAAGGCCAAGTCCAGCAGCAGT No data
Right 948102439 2:235385448-235385470 GGGTGGACATGTCCAAAACAGGG No data
948102431_948102438 6 Left 948102431 2:235385418-235385440 CCAAGGCCAAGTCCAGCAGCAGT No data
Right 948102438 2:235385447-235385469 GGGGTGGACATGTCCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948102431 Original CRISPR ACTGCTGCTGGACTTGGCCT TGG (reversed) Intergenic
No off target data available for this crispr