ID: 948111016

View in Genome Browser
Species Human (GRCh38)
Location 2:235456024-235456046
Sequence CTTATCACTGCTGTTTCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948111016_948111020 25 Left 948111016 2:235456024-235456046 CCACGTGAAACAGCAGTGATAAG No data
Right 948111020 2:235456072-235456094 CTAGGCTATACTAATATTTAGGG No data
948111016_948111019 24 Left 948111016 2:235456024-235456046 CCACGTGAAACAGCAGTGATAAG No data
Right 948111019 2:235456071-235456093 ACTAGGCTATACTAATATTTAGG No data
948111016_948111017 7 Left 948111016 2:235456024-235456046 CCACGTGAAACAGCAGTGATAAG No data
Right 948111017 2:235456054-235456076 TAATAAACCAAAGTTTAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948111016 Original CRISPR CTTATCACTGCTGTTTCACG TGG (reversed) Intergenic
No off target data available for this crispr