ID: 948112879

View in Genome Browser
Species Human (GRCh38)
Location 2:235471210-235471232
Sequence AAGGTCCTGGTGGTGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948112879_948112893 19 Left 948112879 2:235471210-235471232 CCTGACACCACCACCAGGACCTT No data
Right 948112893 2:235471252-235471274 TGGAGCAGCATAATGAGGATGGG No data
948112879_948112883 -8 Left 948112879 2:235471210-235471232 CCTGACACCACCACCAGGACCTT No data
Right 948112883 2:235471225-235471247 AGGACCTTGCCAGCTTCCCCAGG No data
948112879_948112885 -1 Left 948112879 2:235471210-235471232 CCTGACACCACCACCAGGACCTT No data
Right 948112885 2:235471232-235471254 TGCCAGCTTCCCCAGGATCCTGG No data
948112879_948112890 14 Left 948112879 2:235471210-235471232 CCTGACACCACCACCAGGACCTT No data
Right 948112890 2:235471247-235471269 GATCCTGGAGCAGCATAATGAGG No data
948112879_948112892 18 Left 948112879 2:235471210-235471232 CCTGACACCACCACCAGGACCTT No data
Right 948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948112879 Original CRISPR AAGGTCCTGGTGGTGGTGTC AGG (reversed) Intergenic
No off target data available for this crispr