ID: 948112880

View in Genome Browser
Species Human (GRCh38)
Location 2:235471217-235471239
Sequence AGCTGGCAAGGTCCTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948112880_948112893 12 Left 948112880 2:235471217-235471239 CCACCACCAGGACCTTGCCAGCT No data
Right 948112893 2:235471252-235471274 TGGAGCAGCATAATGAGGATGGG No data
948112880_948112890 7 Left 948112880 2:235471217-235471239 CCACCACCAGGACCTTGCCAGCT No data
Right 948112890 2:235471247-235471269 GATCCTGGAGCAGCATAATGAGG No data
948112880_948112885 -8 Left 948112880 2:235471217-235471239 CCACCACCAGGACCTTGCCAGCT No data
Right 948112885 2:235471232-235471254 TGCCAGCTTCCCCAGGATCCTGG No data
948112880_948112892 11 Left 948112880 2:235471217-235471239 CCACCACCAGGACCTTGCCAGCT No data
Right 948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948112880 Original CRISPR AGCTGGCAAGGTCCTGGTGG TGG (reversed) Intergenic
No off target data available for this crispr