ID: 948112884

View in Genome Browser
Species Human (GRCh38)
Location 2:235471229-235471251
Sequence GGATCCTGGGGAAGCTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948112884_948112893 0 Left 948112884 2:235471229-235471251 CCTTGCCAGCTTCCCCAGGATCC No data
Right 948112893 2:235471252-235471274 TGGAGCAGCATAATGAGGATGGG No data
948112884_948112892 -1 Left 948112884 2:235471229-235471251 CCTTGCCAGCTTCCCCAGGATCC No data
Right 948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG No data
948112884_948112890 -5 Left 948112884 2:235471229-235471251 CCTTGCCAGCTTCCCCAGGATCC No data
Right 948112890 2:235471247-235471269 GATCCTGGAGCAGCATAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948112884 Original CRISPR GGATCCTGGGGAAGCTGGCA AGG (reversed) Intergenic
No off target data available for this crispr