ID: 948112886

View in Genome Browser
Species Human (GRCh38)
Location 2:235471234-235471256
Sequence CTCCAGGATCCTGGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948112886_948112890 -10 Left 948112886 2:235471234-235471256 CCAGCTTCCCCAGGATCCTGGAG No data
Right 948112890 2:235471247-235471269 GATCCTGGAGCAGCATAATGAGG No data
948112886_948112893 -5 Left 948112886 2:235471234-235471256 CCAGCTTCCCCAGGATCCTGGAG No data
Right 948112893 2:235471252-235471274 TGGAGCAGCATAATGAGGATGGG No data
948112886_948112892 -6 Left 948112886 2:235471234-235471256 CCAGCTTCCCCAGGATCCTGGAG No data
Right 948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948112886 Original CRISPR CTCCAGGATCCTGGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr