ID: 948112892

View in Genome Browser
Species Human (GRCh38)
Location 2:235471251-235471273
Sequence CTGGAGCAGCATAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948112884_948112892 -1 Left 948112884 2:235471229-235471251 CCTTGCCAGCTTCCCCAGGATCC No data
Right 948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG No data
948112880_948112892 11 Left 948112880 2:235471217-235471239 CCACCACCAGGACCTTGCCAGCT No data
Right 948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG No data
948112879_948112892 18 Left 948112879 2:235471210-235471232 CCTGACACCACCACCAGGACCTT No data
Right 948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG No data
948112881_948112892 8 Left 948112881 2:235471220-235471242 CCACCAGGACCTTGCCAGCTTCC No data
Right 948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG No data
948112886_948112892 -6 Left 948112886 2:235471234-235471256 CCAGCTTCCCCAGGATCCTGGAG No data
Right 948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG No data
948112882_948112892 5 Left 948112882 2:235471223-235471245 CCAGGACCTTGCCAGCTTCCCCA No data
Right 948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948112892 Original CRISPR CTGGAGCAGCATAATGAGGA TGG Intergenic
No off target data available for this crispr