ID: 948113165

View in Genome Browser
Species Human (GRCh38)
Location 2:235473258-235473280
Sequence ATTGACTTTGGGGTGACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948113159_948113165 -8 Left 948113159 2:235473243-235473265 CCTCTTACCTCTGCCATTGACTT No data
Right 948113165 2:235473258-235473280 ATTGACTTTGGGGTGACTTGAGG No data
948113158_948113165 -5 Left 948113158 2:235473240-235473262 CCTCCTCTTACCTCTGCCATTGA No data
Right 948113165 2:235473258-235473280 ATTGACTTTGGGGTGACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948113165 Original CRISPR ATTGACTTTGGGGTGACTTG AGG Intergenic