ID: 948116007

View in Genome Browser
Species Human (GRCh38)
Location 2:235494581-235494603
Sequence CGCCGCAGCCCCCGGGGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 681
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 626}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948116007_948116021 7 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116021 2:235494611-235494633 CTCGGCGGCCCGCGGGCCCCGGG 0: 1
1: 0
2: 5
3: 37
4: 292
948116007_948116014 -8 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116014 2:235494596-235494618 CTGCGGCGCCCCGGGCTCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 209
948116007_948116024 14 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116024 2:235494618-235494640 GCCCGCGGGCCCCGGGGCGCGGG 0: 1
1: 0
2: 5
3: 88
4: 663
948116007_948116022 8 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116022 2:235494612-235494634 TCGGCGGCCCGCGGGCCCCGGGG 0: 1
1: 0
2: 0
3: 19
4: 221
948116007_948116029 21 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116029 2:235494625-235494647 GGCCCCGGGGCGCGGGGCGGCGG 0: 1
1: 1
2: 25
3: 234
4: 1478
948116007_948116028 18 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116028 2:235494622-235494644 GCGGGCCCCGGGGCGCGGGGCGG 0: 1
1: 1
2: 23
3: 161
4: 1108
948116007_948116036 29 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116036 2:235494633-235494655 GGCGCGGGGCGGCGGCGGCGGGG 0: 1
1: 10
2: 77
3: 438
4: 2195
948116007_948116035 28 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116035 2:235494632-235494654 GGGCGCGGGGCGGCGGCGGCGGG 0: 1
1: 8
2: 62
3: 392
4: 2144
948116007_948116020 6 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116020 2:235494610-235494632 GCTCGGCGGCCCGCGGGCCCCGG 0: 1
1: 0
2: 3
3: 34
4: 293
948116007_948116015 -1 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116015 2:235494603-235494625 GCCCCGGGCTCGGCGGCCCGCGG 0: 1
1: 0
2: 2
3: 38
4: 336
948116007_948116023 13 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116023 2:235494617-235494639 GGCCCGCGGGCCCCGGGGCGCGG 0: 1
1: 0
2: 4
3: 99
4: 735
948116007_948116026 15 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116026 2:235494619-235494641 CCCGCGGGCCCCGGGGCGCGGGG 0: 1
1: 1
2: 8
3: 64
4: 573
948116007_948116034 27 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116034 2:235494631-235494653 GGGGCGCGGGGCGGCGGCGGCGG 0: 2
1: 7
2: 116
3: 837
4: 3795
948116007_948116037 30 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116037 2:235494634-235494656 GCGCGGGGCGGCGGCGGCGGGGG 0: 2
1: 32
2: 257
3: 1135
4: 4972
948116007_948116017 0 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116017 2:235494604-235494626 CCCCGGGCTCGGCGGCCCGCGGG 0: 1
1: 0
2: 3
3: 28
4: 290
948116007_948116032 24 Left 948116007 2:235494581-235494603 CCGGCTCCCCGGGGGCTGCGGCG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 948116032 2:235494628-235494650 CCCGGGGCGCGGGGCGGCGGCGG 0: 1
1: 2
2: 26
3: 250
4: 1524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948116007 Original CRISPR CGCCGCAGCCCCCGGGGAGC CGG (reversed) Exonic
900310058 1:2029278-2029300 CGCCGCTGCTCCGAGGGAGCTGG + Intronic
900368172 1:2319950-2319972 CCCCTCTGCCCCCGGGCAGCAGG + Intergenic
900397473 1:2459059-2459081 CAACCCAGCCACCGGGGAGCAGG - Intronic
900524224 1:3120617-3120639 CCCGGCAGCCCCCTGGGAGCGGG + Intronic
900580174 1:3404906-3404928 CGTCTCAGCCCCGGGGCAGCAGG + Intronic
900626733 1:3611777-3611799 CGCCCCAGACCCCGCGGGGCTGG + Intergenic
900787085 1:4655786-4655808 CGCCCCGGGCCCCGGGGAGGAGG - Intronic
901109607 1:6784845-6784867 CGCCGCTGCCGGTGGGGAGCCGG - Intergenic
901436157 1:9248546-9248568 CGCCTCTGCCCCCGAGTAGCTGG - Intronic
901489453 1:9589174-9589196 CGCCGCCGCCCCCCGAGACCGGG + Intronic
901663002 1:10810441-10810463 GGCCCCAGCCTCCGGGCAGCTGG - Intergenic
902028237 1:13400577-13400599 TGCCTCAGCCTCTGGGGAGCTGG - Intergenic
902258429 1:15206120-15206142 CACCTCGGCCCCCGAGGAGCTGG - Intronic
902720640 1:18302001-18302023 CGCCTCAGTCCCCATGGAGCTGG + Intronic
902891513 1:19447701-19447723 CACAGCAGCACCCTGGGAGCTGG + Intronic
903115695 1:21176767-21176789 CGCCGCTTCCTCCGGGGAGGGGG - Exonic
903573296 1:24322029-24322051 CGTCGGGGCCCCCGGGGAGCTGG + Intronic
903614729 1:24643487-24643509 CGCCGCAGCGCACGGGGGGGGGG - Intronic
903907192 1:26695900-26695922 CGCGGCAGCAGCCGGGGCGCCGG - Intergenic
904181297 1:28668699-28668721 GGCCGCCGCCGCCGGAGAGCTGG - Intergenic
904270151 1:29344525-29344547 CCCCGAAGCCCCAGGGGAACAGG + Intergenic
904340462 1:29830758-29830780 CCCTGCAGACCCCGGGGAGAGGG - Intergenic
904428381 1:30446319-30446341 CCCCGAAGCCCCTGGGGAACAGG - Intergenic
904742426 1:32688695-32688717 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
904822801 1:33256366-33256388 CGACGCGGCCCCCCCGGAGCCGG + Intergenic
904941613 1:34167488-34167510 CTCCACAGCCCCCAGGGAGAAGG - Intronic
905235630 1:36544551-36544573 TGCTGGAGACCCCGGGGAGCTGG + Intergenic
905390820 1:37634503-37634525 CGCCCCAGCTCCCGGGGAAGGGG + Intronic
905505519 1:38476305-38476327 AGCCCCAGCCTCCCGGGAGCAGG - Intergenic
906321506 1:44820310-44820332 CGGCGCCGCCCACGGGGTGCGGG - Intronic
906411760 1:45584437-45584459 CGCCGCTGCCCCCGGCAAGATGG - Intronic
907513039 1:54976678-54976700 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
907529723 1:55082669-55082691 CTCCTCAGCCCCCTGGTAGCTGG - Intronic
907551888 1:55311801-55311823 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
908132022 1:61083236-61083258 TGCCGCAGCGCCCGGGGAGGGGG + Intronic
910223331 1:84912051-84912073 CACCTCAGCCCCCAGGTAGCTGG + Intergenic
910771506 1:90836217-90836239 CGCCCCAGCCCCCGGCGGGGCGG + Intergenic
912246338 1:107965123-107965145 CGCGGCAGCCGCCGCCGAGCCGG - Exonic
912357358 1:109065805-109065827 TGCCTCAGCCTCCGAGGAGCTGG - Intronic
912391736 1:109307502-109307524 GCCCGCTGCCCCCGGGGAGCGGG - Intergenic
912532997 1:110339826-110339848 CGCAGCAGCTCCCGGGGTGGAGG + Exonic
912576365 1:110675326-110675348 CGCCGCGGCCCCGCGGGCGCCGG + Intergenic
912682666 1:111739101-111739123 CGCCCCGGCCCCCGGGGAGCCGG - Intronic
912820624 1:112865051-112865073 TGCCTCAGCCCCCAAGGAGCTGG + Intergenic
913518264 1:119623296-119623318 CGCCGCCGCCCCCGCGCCGCTGG + Exonic
913600508 1:120417261-120417283 TGCCTCAGCCCCCAGGTAGCTGG + Intergenic
913975039 1:143449373-143449395 CGCCGTTCCCCCCGGGGACCGGG - Intergenic
914069431 1:144274989-144275011 CGCCGTTCCCCCCGGGGACCGGG - Intergenic
914109724 1:144691365-144691387 CGCCGTTCCCCCCGGGGACCGGG + Intergenic
914192443 1:145423323-145423345 TGCCTCAGCCCCCAGGTAGCTGG - Intergenic
914197322 1:145454398-145454420 GGCTGCAGCCCCCCGGGACCCGG + Intergenic
914748441 1:150515867-150515889 CGCCCCAGCCCACGGGGAGCGGG + Intergenic
915213328 1:154325565-154325587 GGCCGAGGCCCCGGGGGAGCGGG + Intronic
915463333 1:156082211-156082233 CGCCCCAGCCCCCGGGGTGGGGG + Intergenic
916758797 1:167798430-167798452 CGCCTCAGCCTCCTGAGAGCTGG + Intergenic
917061378 1:171045113-171045135 CGCCTCAGCCTCCGAGTAGCTGG + Intronic
918174361 1:182029970-182029992 CACCACACCCCCCGGGGGGCGGG + Intergenic
920002147 1:202807673-202807695 CGCCTCCGCTCCCGGGGTGCGGG - Intronic
921089565 1:211830419-211830441 CGCGGTAGGCCCCGGGGAGGAGG - Intronic
921862852 1:220057212-220057234 TGCCTCAGCCCCCTGGTAGCTGG + Intergenic
921866614 1:220093991-220094013 CCCTGCAGCCGCCGGGGGGCGGG - Intergenic
922119093 1:222644508-222644530 CGCCGCTACCCCGGGGGACCCGG + Intronic
922753522 1:228082117-228082139 CGGAGCAGACGCCGGGGAGCTGG - Intergenic
923037026 1:230291777-230291799 CACCGCTCCCCCCAGGGAGCTGG - Intergenic
923180331 1:231511663-231511685 CACCTCAGCCCCCCAGGAGCTGG + Intergenic
923716975 1:236433423-236433445 CGCCTCAGCCCCAGAGCAGCTGG + Intronic
924808321 1:247379291-247379313 CGCCTCAGCCCCTGAGTAGCTGG + Intergenic
1062909785 10:1205164-1205186 CGAGGCAGCCCCCGGGCAGCAGG - Intronic
1063389777 10:5641686-5641708 CGCGGAAGCCCACAGGGAGCCGG + Intronic
1064376837 10:14804304-14804326 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1065048449 10:21765728-21765750 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1066105008 10:32148689-32148711 TGCCTCAGCCCCCTGGTAGCTGG + Intergenic
1066429273 10:35336660-35336682 CGCCGCAGCCGCCGGGGAAGCGG + Intronic
1067078748 10:43202486-43202508 GGCCTCTGCCCCCGGGGAGAGGG + Intronic
1067416401 10:46106396-46106418 CGCCGCGGCCCCCAGGGCCCAGG + Intergenic
1067436533 10:46282874-46282896 CGCCGCGGCCCCCCTGGCGCAGG + Intergenic
1067694123 10:48523411-48523433 GGCCCCAGCCCCCGGGAGGCCGG + Intronic
1067837294 10:49649557-49649579 CACCGCAGCCTCCGGGGGGCGGG - Exonic
1068673862 10:59750184-59750206 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1069377920 10:67812737-67812759 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1069709263 10:70478632-70478654 AGCCGCAGCCCCCGGGCGGGAGG - Intergenic
1069942539 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG + Intronic
1070008438 10:72449045-72449067 TGCCTCAGCCTCCAGGGAGCTGG + Intronic
1070175716 10:73967509-73967531 TGCCTCAGCCTCCGAGGAGCTGG - Intergenic
1070516108 10:77208373-77208395 CGCCTCAGCCTCCAAGGAGCCGG - Intronic
1071572364 10:86704691-86704713 CGCCTCAGCCCCCAAGTAGCTGG + Intronic
1071695446 10:87864151-87864173 CGCCGCACCCCCCGTGGCCCGGG + Exonic
1073457148 10:103644470-103644492 CACCTCAGCCCCCGAGTAGCTGG - Intronic
1073543012 10:104327772-104327794 CGCAGCAACCCCGGGGGAGGGGG + Intronic
1074585386 10:114763499-114763521 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1074843071 10:117374657-117374679 CGCCGCCTGCCCCGAGGAGCTGG - Exonic
1075554188 10:123417968-123417990 TGCCTCAGCCTCCTGGGAGCTGG + Intergenic
1075796482 10:125123673-125123695 CCCCGGGGCCCCTGGGGAGCCGG - Intronic
1076898881 10:133327313-133327335 GGCCGCAGCCTCAGGGGAGTCGG + Intronic
1077289422 11:1782050-1782072 CCCCCCAGGCCCCAGGGAGCAGG + Intergenic
1077600232 11:3569551-3569573 GGCTGCAGCCCCCGCTGAGCTGG - Intergenic
1078164470 11:8870792-8870814 CGCCGCAGGCGCAGAGGAGCGGG - Intronic
1078316047 11:10294076-10294098 CGCCGCCGCGCTCGGGAAGCGGG + Exonic
1079126237 11:17720328-17720350 CGCCGCGGCCCGGGGGCAGCGGG - Exonic
1080012436 11:27472368-27472390 CCCCGCCGCCCCCGGGCAGCCGG + Exonic
1080621191 11:33988502-33988524 CCCCCCACCCCCCGGGTAGCTGG + Intergenic
1081700922 11:45152179-45152201 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1081874459 11:46399186-46399208 CGCCTCAGCCTCCGAGTAGCTGG + Intronic
1082023285 11:47552784-47552806 CGCGACAGGACCCGGGGAGCCGG + Intronic
1083419004 11:62543080-62543102 CGCTCCAGCCCCCGGGGGACCGG + Intronic
1083572739 11:63768877-63768899 CCCCCCAGCCCCCCGCGAGCTGG - Intergenic
1083596258 11:63919426-63919448 CCCCGCAGCCCCGGGGCGGCAGG - Intergenic
1083618194 11:64036480-64036502 CGCTGCACCCCCCAGGGAGGGGG + Intronic
1084284299 11:68121501-68121523 CGCCGCAGCCAATGGGGAGGCGG - Intergenic
1084474421 11:69380757-69380779 CCCTGCAGCCGCCGGGAAGCTGG - Intergenic
1085016348 11:73176725-73176747 TGCAGCATCCCCCCGGGAGCCGG + Intergenic
1085165691 11:74397960-74397982 CTCTGCAGCCCGCGGGGCGCTGG + Intronic
1085902695 11:80721001-80721023 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1086679821 11:89656975-89656997 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1087318623 11:96633806-96633828 TGCCTCAGCCCCCGGGTAGCTGG - Intergenic
1088138982 11:106592730-106592752 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1088189990 11:107217667-107217689 TGCCGCAGCTCCCGAGCAGCTGG - Intergenic
1088655950 11:112000019-112000041 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1089289620 11:117429769-117429791 GGCCTCTTCCCCCGGGGAGCTGG + Intronic
1090202256 11:124865354-124865376 TGCCGGAGTCCCCTGGGAGCTGG - Intergenic
1090403772 11:126465405-126465427 TGCTGCAGCCCCGGGGGTGCTGG + Intronic
1090675119 11:128985131-128985153 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1091259786 11:134224971-134224993 CGCCGCTGCCGCCGGGCAGTGGG - Exonic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1091689027 12:2583265-2583287 CGCCGCGGCCCCAGGGCAGCCGG - Intronic
1091735574 12:2918652-2918674 CGCCTCAGCCTCCGAGTAGCTGG + Intronic
1093165216 12:15797255-15797277 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1094625898 12:32123761-32123783 TGGCTCAGCCCCCGGGTAGCTGG - Intronic
1095890427 12:47230554-47230576 CGCCTCAGCCTCCGAGTAGCTGG + Intronic
1096024756 12:48350954-48350976 CGCCGCAGAGCCCCGGAAGCGGG - Intronic
1096079991 12:48826883-48826905 TGCCGCAGCCCTGGGGGAGTGGG - Intronic
1096365797 12:51027223-51027245 CACCTCAGCCCCCGAGTAGCTGG - Intronic
1096375121 12:51102609-51102631 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1097267751 12:57755608-57755630 AGCCGCAACCCCGGGGGGGCCGG + Exonic
1098286940 12:68916772-68916794 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1098545315 12:71705403-71705425 CGCCTCAGCCCCCAAGTAGCTGG + Intergenic
1098779827 12:74672632-74672654 CCCCCCATCCCCCGAGGAGCTGG - Intergenic
1098882945 12:75935260-75935282 TGCCTCAGCCCCCCGGTAGCTGG - Intergenic
1101965436 12:109279185-109279207 AGCCGCAGCCTCCGGGGGACAGG - Exonic
1102036159 12:109771589-109771611 CACCCCAGCCCCTGGGGAGCAGG + Intergenic
1102475834 12:113187641-113187663 CACCTCAGCCTCCCGGGAGCTGG - Intronic
1102518474 12:113465296-113465318 GGCCGCGGCCCGCGGCGAGCCGG + Intronic
1102519842 12:113471502-113471524 GGCCGAAGCCGCCGGGGCGCGGG - Exonic
1103509926 12:121467265-121467287 CGCCGCCGCCCGCCCGGAGCAGG + Intronic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1103856348 12:123973173-123973195 CGGGGAAGCCCCGGGGGAGCGGG - Exonic
1103934124 12:124466339-124466361 GGCTGCAGCCCCCAGGGCGCGGG + Intronic
1103983033 12:124749115-124749137 CGCCTCAGCCCCCAAGTAGCTGG + Intergenic
1104026749 12:125033025-125033047 CGCTGCAGCCCCAGAGCAGCTGG + Intergenic
1104373921 12:128247529-128247551 CGCCGGAGCCCACGGGGGTCGGG - Intergenic
1104379213 12:128292014-128292036 CCCCGCAGCCCTAGGGGAGGAGG - Intronic
1104677309 12:130720345-130720367 CACCTCAGCCCCCGAGTAGCTGG - Intergenic
1105215637 13:18283024-18283046 CACAGCAGCCCCCAGGGACCAGG + Intergenic
1105583630 13:21723916-21723938 AGGCACAGCCCCCGGGGAGGAGG - Intergenic
1105732194 13:23228982-23229004 AGCCTCAGCCCCCGAGTAGCTGG + Intronic
1106710574 13:32327331-32327353 TGCCTCAGCCCCCAGGTAGCTGG - Intronic
1107069993 13:36258740-36258762 CAGAGCAGCCCCCGGGGTGCTGG - Intronic
1108556475 13:51598243-51598265 TGCCCCAGCCCCCGAGTAGCTGG - Intronic
1108676114 13:52739248-52739270 CGCGGTAGCCCCCAGGGAGTGGG + Intronic
1109872121 13:68345690-68345712 TGCCTCAGCCCCTGGGGAGCTGG - Intergenic
1110119485 13:71865404-71865426 CTCCGCAGGGCTCGGGGAGCGGG - Intronic
1110205631 13:72909606-72909628 TGCCTCAGCCTCCGGGTAGCTGG + Intronic
1110321599 13:74166204-74166226 CACCTCAGCCCCCGAGTAGCTGG + Intergenic
1110921707 13:81095886-81095908 CGCCTCAGCCTCCGAGTAGCTGG - Intergenic
1112216322 13:97434322-97434344 CGCGGCGGCCCCCTGGGCGCCGG - Exonic
1112589101 13:100747707-100747729 CGCAGCAGCCCCGGCAGAGCAGG - Intergenic
1112652699 13:101416276-101416298 CGCCGCAGCCTCCCGGGCACCGG + Intronic
1113201225 13:107868339-107868361 CTCCGCAGCCGCGGGCGAGCTGG + Intergenic
1114383728 14:22235311-22235333 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1114557643 14:23571122-23571144 CGCTGCAGCCTCCGAGGAGTGGG + Exonic
1114626332 14:24132446-24132468 CGCCGCAGCTGCCTGGCAGCCGG + Exonic
1114626994 14:24136432-24136454 CGCCGCCCTCCCCGGGGCGCAGG - Intronic
1115628193 14:35216421-35216443 CGCCTCAGCCCCCAAGTAGCTGG + Intronic
1115644360 14:35357594-35357616 CACCTCAGCCCCCGAGTAGCTGG + Intergenic
1115683147 14:35764657-35764679 CGCCTCAGCCCCCAGATAGCTGG + Intronic
1116186798 14:41608299-41608321 CGGCTCCGCGCCCGGGGAGCGGG - Exonic
1117545901 14:56794723-56794745 GGCCGCCGCCCCCCGGAAGCGGG - Intergenic
1118404982 14:65413405-65413427 TGGCGCAGCCCCGGGGGCGCGGG + Intronic
1118422454 14:65621936-65621958 TGCCCCAGCCTCCGGGTAGCTGG + Intronic
1118748345 14:68789889-68789911 CGCCGCTGCCACCGGGCTGCTGG - Exonic
1118796702 14:69151756-69151778 CGCCGCGGCCCGCGGGGCCCGGG + Intronic
1118871208 14:69743963-69743985 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1119303959 14:73592118-73592140 CGCCGACGCCCGCGGCGAGCTGG + Exonic
1119816305 14:77571393-77571415 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1119871650 14:78022960-78022982 CACCTCAGCCCCCGAGTAGCTGG - Intergenic
1120307998 14:82795117-82795139 CTCCGCAGCCCCCAAGTAGCTGG + Intergenic
1120993455 14:90397831-90397853 CGCCGCGCCCCCCGGGAAGAAGG - Intronic
1121482733 14:94291244-94291266 AGCTGCAGCTCCCGGGTAGCAGG + Intronic
1121729090 14:96173903-96173925 CGCTGCAGGCCCAGGGGAGCTGG + Intergenic
1122010226 14:98740454-98740476 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1122273157 14:100577463-100577485 AGCTGCAGCCCCAGGGGAGAAGG - Intronic
1122349849 14:101082792-101082814 CCCCACAGTCCCCGTGGAGCTGG - Intergenic
1122604327 14:102938265-102938287 CCCCGCAGCCCTGGGGGAGGTGG - Intronic
1122629885 14:103102819-103102841 CTCCGCAGGCCTTGGGGAGCCGG + Intronic
1122739918 14:103866328-103866350 CCCCGCAGCCCCCGCCCAGCTGG - Intergenic
1123062424 14:105600339-105600361 CGCCGGAGTGGCCGGGGAGCCGG - Intergenic
1123474716 15:20581699-20581721 CTCCGCAGCCACCGGGGATGGGG + Intergenic
1123643295 15:22418658-22418680 CTCCGCAGCCACCGGGGATGGGG - Intergenic
1123680757 15:22761725-22761747 TGCCTCAGCCTCCGAGGAGCTGG - Intergenic
1124272498 15:28295511-28295533 TGCCTCAGCCCCCAAGGAGCTGG + Intronic
1124332965 15:28836183-28836205 TGCCTCAGCCTCCGAGGAGCTGG - Intergenic
1125752079 15:42036226-42036248 CGCCGCGGCCCCCAGGGCGGTGG - Intronic
1125832631 15:42727685-42727707 CTCCGCTCCCCCCGGGCAGCAGG + Exonic
1125879315 15:43179147-43179169 CGCCTCAGCCCCCAAGTAGCTGG - Intronic
1127753740 15:62069466-62069488 CGCCTCAGCCCCAGAGTAGCTGG - Exonic
1127754805 15:62081686-62081708 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1127953605 15:63833874-63833896 CGCCGCAGCCTCTGCGGAGCCGG - Exonic
1128098437 15:64977471-64977493 CACCTCAGCCCCCCGGTAGCTGG + Intronic
1128164528 15:65451809-65451831 CACCTCAGCCCCCGAGTAGCTGG - Intronic
1128697718 15:69781073-69781095 GCCCCAAGCCCCCGGGGAGCAGG + Intergenic
1129162231 15:73753189-73753211 CGCCGCGGCGCTTGGGGAGCGGG - Intergenic
1130152952 15:81324945-81324967 CCCCGCAGCTCCAGGGCAGCTGG - Intergenic
1131171929 15:90184965-90184987 CGGCGCAGCCCCTGGGGACCCGG - Intronic
1131487159 15:92830841-92830863 TGCCTCAGCCTCCGGGTAGCTGG + Intergenic
1131769515 15:95719634-95719656 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1132204297 15:99976003-99976025 CACAGCAGCCCCCTGGGAACCGG + Intronic
1132234767 15:100210984-100211006 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1132653145 16:1030625-1030647 CGCAGCGGCCGCCAGGGAGCGGG - Intergenic
1132665341 16:1078909-1078931 AGAGGCAGCCCCCGGGGAGGAGG - Exonic
1132757583 16:1493577-1493599 CGCTGCAGTCACCCGGGAGCCGG + Exonic
1132817089 16:1835138-1835160 CGCCTCAGCCACCGAGTAGCTGG - Intronic
1132822961 16:1886044-1886066 TGCCTCAGCCTCCGGGTAGCTGG - Intergenic
1133135828 16:3711123-3711145 CGCCGCAGCCCCCAAAGTGCTGG + Intronic
1134152187 16:11813641-11813663 AGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1134536493 16:15030695-15030717 CACCTCAGCCCCCGAGGAGTTGG + Intronic
1134618833 16:15672316-15672338 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1135045672 16:19153172-19153194 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1135321760 16:21502163-21502185 CGCCGGGGCCCCCGAGGAGGAGG + Intergenic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136289237 16:29261654-29261676 GGACGCAGCCCGTGGGGAGCTGG + Intergenic
1136546470 16:30957796-30957818 GGCCGCATCCCCCGGAGAGTCGG - Exonic
1137278979 16:46958828-46958850 CACCTCAGCCCCCAAGGAGCTGG - Intronic
1137843335 16:51661858-51661880 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1138451960 16:57098396-57098418 ACAGGCAGCCCCCGGGGAGCAGG - Intronic
1139408035 16:66735214-66735236 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1139459427 16:67110033-67110055 TGCCGCTGCCGCCGGGGAGGAGG + Exonic
1139499000 16:67345198-67345220 CGCCTCAGCCCCTGAGTAGCTGG - Intronic
1139859575 16:70010092-70010114 CACCTCAGCCCCCGAGGAGTTGG - Intergenic
1140519902 16:75572046-75572068 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1140926597 16:79589922-79589944 CGCGGCAGTGCCCAGGGAGCCGG - Intronic
1141184795 16:81779486-81779508 GGACGCAGCGCCCTGGGAGCCGG - Intronic
1141235573 16:82212667-82212689 CGCCTCAGCCTCCGGGTAGCTGG - Intergenic
1141352592 16:83311957-83311979 TGCCGCAGCCTCCCGAGAGCTGG - Intronic
1141682690 16:85553629-85553651 CGCCGCAGCCACCGAGCTGCTGG + Intergenic
1142067871 16:88073075-88073097 CTCAGCAGTGCCCGGGGAGCAGG - Intronic
1142094972 16:88234611-88234633 GGACGCAGCCCGTGGGGAGCTGG + Intergenic
1142240014 16:88940806-88940828 CGCCGCAGCCCCCGCAGGTCAGG + Intronic
1142565431 17:837090-837112 CACCTCAGCCTCCGAGGAGCTGG + Intronic
1142691959 17:1612076-1612098 CGCCTCAGCCTCCGAGTAGCTGG + Intronic
1143007511 17:3846358-3846380 CGCCGCCGCCCCCTGGTGGCGGG + Intergenic
1143354578 17:6316910-6316932 CGCCTCAGCCTCCGAGTAGCTGG + Intergenic
1143372244 17:6447621-6447643 AGCCGCAGACCCCTGGGAGAAGG + Exonic
1143576147 17:7794433-7794455 TGCCGCAGCCCCCTGGGATCTGG - Intronic
1143622758 17:8090338-8090360 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1145905401 17:28513651-28513673 CGCCTCAGCCCTCGGGCAGGGGG + Intronic
1145933972 17:28704391-28704413 AGCAGCAGCTCCCGGGGCGCGGG - Exonic
1146073595 17:29707037-29707059 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1146332335 17:31937416-31937438 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1147393347 17:40122867-40122889 CGGGGCGGCCCCCGGGCAGCAGG + Intronic
1147572344 17:41579155-41579177 CCCCCCAGCCCCTGGGGATCAGG + Intergenic
1147636021 17:41964755-41964777 TGCCTCAGCCTCCGGGTAGCTGG + Intronic
1147909562 17:43847365-43847387 CTCCTCAGCCCTAGGGGAGCGGG + Intronic
1147976920 17:44253176-44253198 GGCTGCAGCCCCTGGGGTGCTGG + Exonic
1148183044 17:45620513-45620535 GGCCGCGGGGCCCGGGGAGCGGG + Intergenic
1148264652 17:46215924-46215946 TGCCTCAGCCTCCGGGTAGCTGG - Intronic
1148265809 17:46225178-46225200 GGCCGCGGGGCCCGGGGAGCGGG - Intronic
1148408979 17:47447916-47447938 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1148491034 17:48024125-48024147 CGCCTCAGCCCCCGGAAAGCTGG + Intergenic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1149112172 17:53046816-53046838 CTCCTCAGCCCCAGGGAAGCTGG - Intergenic
1149637491 17:58182732-58182754 TGCCTCAGCCCCCAGGTAGCTGG + Intergenic
1149658880 17:58324379-58324401 CACCGCCGCCCCCGGGTAGCTGG + Intronic
1149678499 17:58487738-58487760 CGCCGCCGCCCGCGGGGCCCCGG - Exonic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1151344412 17:73492844-73492866 CACGGCAGCCCCCAGGAAGCAGG + Intronic
1152009018 17:77699421-77699443 CTCAGTATCCCCCGGGGAGCAGG - Intergenic
1152111305 17:78359169-78359191 CTCCGCAGCCCCCCGGGATGCGG - Exonic
1152449138 17:80365394-80365416 CGTGCCAGCCTCCGGGGAGCTGG - Intronic
1152456777 17:80421482-80421504 AGCAGCAGCCCCCTGGGACCCGG - Intronic
1152601390 17:81264009-81264031 CGCCGCAGTCCCCGAGGACAGGG + Intronic
1152708890 17:81860402-81860424 CGCCGACGCCCCCGAGGAGGAGG - Exonic
1152759052 17:82098752-82098774 CGTCGCTGCCCGCGCGGAGCTGG + Intergenic
1152840982 17:82568070-82568092 CCCTCCAGCCCCCGGGGAGCGGG + Exonic
1152880625 17:82812656-82812678 TGCCGCAGCCCCCAAGTAGCTGG + Intronic
1154072320 18:11163854-11163876 CGCCGCGGGCCCAGCGGAGCAGG + Intergenic
1154188984 18:12212125-12212147 TGCCTCAGCCCCCTGGTAGCTGG - Intergenic
1155229479 18:23758555-23758577 AGCCTCAGCCCCCAGGGAGAGGG - Intronic
1155375324 18:25151000-25151022 CGCCTCAGCCCCCGAGTAGCTGG + Intronic
1155375881 18:25157082-25157104 CACCTCAGCCCCCGGGTAGCTGG - Intronic
1155570334 18:27185328-27185350 CGCCGCAGCCCCAGCCGGGCCGG - Intergenic
1156246262 18:35302204-35302226 CACCTCAGCCCCCGAGTAGCTGG - Intergenic
1157260929 18:46174687-46174709 TGCCGCAGTCCCCGGGCTGCGGG + Intronic
1157278023 18:46326046-46326068 AGCCGCAGCCGCCTTGGAGCTGG + Intergenic
1157279149 18:46334377-46334399 CGCCGCAGGCACCGGGGCGGGGG + Intronic
1159016341 18:63104347-63104369 CTCCGCAGCTGTCGGGGAGCAGG + Intergenic
1159160393 18:64637179-64637201 TGCCTCAGCCCCAGAGGAGCTGG + Intergenic
1160024938 18:75209245-75209267 CGGCGCAGCCCCCGCGAACCCGG + Exonic
1160495003 18:79368100-79368122 CGCCGTGGCCCCGGGTGAGCTGG + Intronic
1160786706 19:903470-903492 CACCGCAGCCACCGGGCACCCGG + Intronic
1160810384 19:1010632-1010654 TGCCGCGGCCACCAGGGAGCTGG + Exonic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1160918891 19:1510630-1510652 CGGCGCTGCCTCCGGTGAGCGGG - Exonic
1160967626 19:1753567-1753589 GCGCGCAGCCACCGGGGAGCGGG + Exonic
1160970229 19:1764677-1764699 CCCTGCACCCCTCGGGGAGCTGG - Intronic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161072688 19:2270501-2270523 CGCGGGGGCCGCCGGGGAGCTGG + Intronic
1161222037 19:3122317-3122339 GAGCGCCGCCCCCGGGGAGCGGG + Exonic
1161240886 19:3223187-3223209 CACCGCAGCCTCCGAGTAGCTGG + Intergenic
1161559876 19:4967015-4967037 CGCCTCAGCCCCCGAATAGCTGG + Intergenic
1161569194 19:5021030-5021052 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1161703248 19:5805944-5805966 CGCCGCCGCCGCCGGGGACACGG + Intergenic
1162144442 19:8605250-8605272 CGGCGCTGCCTCCGGGGAGGAGG + Exonic
1162929881 19:13952561-13952583 GGCGGCGGCCCCGGGGGAGCCGG + Exonic
1163011882 19:14431806-14431828 CGCCTCAGCCTCCTGGTAGCTGG + Intergenic
1163389100 19:17019235-17019257 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1163536526 19:17880011-17880033 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1163553209 19:17977453-17977475 CACCTCAGCCCCCAGGTAGCTGG + Intronic
1163606961 19:18280938-18280960 CTCCGCGCCCCCCGGCGAGCTGG - Exonic
1163662838 19:18588939-18588961 CGGCGCAGACCCAGGGGCGCGGG + Intronic
1163666489 19:18606274-18606296 CCCCCCAGCCCCCGGGGGCCTGG + Intronic
1163689715 19:18731919-18731941 TGCAGGAGCCCCCGGGGTGCAGG - Intronic
1164498673 19:28793558-28793580 CTCCGCGGCCCCCGAGAAGCTGG + Intergenic
1164690643 19:30208515-30208537 CTCTGCTGGCCCCGGGGAGCTGG + Intergenic
1165533258 19:36421685-36421707 CGCCGACGCCCGCGGCGAGCTGG + Intergenic
1165572937 19:36790999-36791021 CGCCTCAGCCTCCGGGTAGCTGG - Intergenic
1165639091 19:37368989-37369011 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1166317880 19:41998885-41998907 CCCCGCCGGCCCCCGGGAGCTGG - Exonic
1166765777 19:45251561-45251583 CGCCCCTGCCCCCCGGGACCCGG + Exonic
1166974339 19:46595673-46595695 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1167059880 19:47137609-47137631 CGCCTCAGCCCCCAAGTAGCTGG + Intronic
1167071899 19:47226681-47226703 CGCCAGAGCCCCCGGGGCGCTGG + Exonic
1167110414 19:47457384-47457406 CGCCGAGGCCCCAGGTGAGCTGG - Exonic
1167229159 19:48270940-48270962 CGCCTCAGCCTCCGAGTAGCTGG - Intronic
1167331207 19:48857440-48857462 CCCCGCGGCCCCCTGGGACCCGG - Exonic
1167942961 19:52962460-52962482 CCCCGCAGCCCCAGGGTGGCCGG - Intronic
1168073069 19:53963337-53963359 CGCCGCCGCCCCCGCGGTGGGGG - Exonic
1168251892 19:55146452-55146474 CTCCCCAGCCCCCGAAGAGCCGG - Exonic
1168379912 19:55911343-55911365 CACCGCAGCCCCCCAGTAGCTGG + Intronic
1168594500 19:57664444-57664466 CCCCGCAGCACCCGGGGCGGGGG + Intergenic
926190056 2:10721632-10721654 AGCCGCTGCCTCCCGGGAGCCGG + Exonic
926659715 2:15451163-15451185 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
927210937 2:20638627-20638649 CCCTGCAGCCCCTGGGGATCTGG + Exonic
927215824 2:20667350-20667372 CGCCGCCGCCCCCTGGGCTCCGG - Exonic
927702385 2:25276631-25276653 CCCCGCAGCCTCCGGGGCGCTGG - Intronic
927898819 2:26804089-26804111 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
927909588 2:26887432-26887454 CCCCGCAGGCCCAGGGGAGCTGG + Intronic
930142171 2:47963924-47963946 CGCCTCAGCCCCCGAATAGCTGG + Intergenic
930815500 2:55593042-55593064 AGCCTCAGCCTCCTGGGAGCTGG - Intronic
931241777 2:60460793-60460815 CTCCACACCGCCCGGGGAGCTGG - Exonic
932495724 2:72144899-72144921 CGCCGCCACCACCGGGGATCTGG - Intronic
932593730 2:73081585-73081607 GGCCGGAGCCCAGGGGGAGCAGG + Intronic
933791726 2:85888765-85888787 CGCCGCAGCCCCCAGCCCGCGGG + Intronic
934714855 2:96537519-96537541 CGCCGCAGCCCCACAGGAGAGGG + Intronic
934964228 2:98705826-98705848 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
935031786 2:99329851-99329873 TGCCTCAGCCCCCGAGGAGCTGG - Intronic
935245519 2:101215862-101215884 TGCCTCAGCCTCTGGGGAGCTGG - Intronic
935349627 2:102142486-102142508 CGCCGCAGCCCTGGAGGAGCCGG + Intronic
935535365 2:104287023-104287045 GGCCGCAGCTCCTGTGGAGCAGG - Intergenic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
936228363 2:110678576-110678598 AGCCGCAGCACCCGGGAGGCAGG + Intergenic
936550753 2:113437668-113437690 AGCCACACCCCCCGGGGAGGTGG - Intergenic
936608402 2:113979313-113979335 GGTCACCGCCCCCGGGGAGCCGG + Intergenic
936931958 2:117799120-117799142 TGCCTCAGCCCCCGAGTAGCCGG + Intergenic
937928859 2:127189200-127189222 CACCCCAGCTCCCTGGGAGCTGG - Intronic
939914837 2:148026519-148026541 CGCCTCAGCCTCCGAGTAGCTGG - Intronic
939923634 2:148147354-148147376 TGCCTCAGCCCCCGAGAAGCTGG + Intronic
940639922 2:156334317-156334339 CTCCCCAGCCGCCGGCGAGCTGG - Intronic
940640760 2:156342379-156342401 TGCCGCAGCCGCCGGGGGCCGGG - Intergenic
940883256 2:158968340-158968362 AGGCGCAGCCCCGGGGGACCCGG + Intergenic
941508388 2:166375985-166376007 CGCAGCTGCCCTCGGGGAGGCGG - Exonic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942680439 2:178472732-178472754 TGCCTCAGCCTCCGAGGAGCTGG - Intronic
942767979 2:179479723-179479745 TGCCTCAGCCTCCGAGGAGCTGG - Intronic
944237419 2:197453148-197453170 TCCCGCAGCCCCCGGGGGGGTGG + Intergenic
944245398 2:197525230-197525252 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
944273007 2:197804641-197804663 CGCCGCAGTCCGCGGGCAGGTGG + Intergenic
944636998 2:201684103-201684125 CACCTCAGCCCCCGAGTAGCTGG - Intronic
944845889 2:203667277-203667299 CGCCTCAGCCCCCGAGTAGCTGG - Intergenic
945119657 2:206444051-206444073 CGCAGCAGCCCCCCAGGCGCGGG - Exonic
945457903 2:210070342-210070364 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
945839802 2:214873988-214874010 AGCCTCAGCCCCCGAGTAGCTGG + Intergenic
946154506 2:217798454-217798476 CACCTCAGCCCCCAAGGAGCTGG - Intergenic
946358793 2:219206735-219206757 CGGCGCAGTCTCCGGGCAGCCGG - Intronic
947773887 2:232692572-232692594 CGCCTCAGCCCCCAAGTAGCTGG + Intergenic
948116007 2:235494581-235494603 CGCCGCAGCCCCCGGGGAGCCGG - Exonic
948457741 2:238114651-238114673 CCCAGCAGCCCCCGGGGAAGGGG + Intronic
948633153 2:239315014-239315036 CGACGAAGCCTCCGGGTAGCAGG - Intronic
949014563 2:241702153-241702175 TGCCGCAGCCCCCCGCGCGCCGG + Intronic
1168927406 20:1594087-1594109 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1168972020 20:1937650-1937672 CGCCCCAGCCCTCCGGGAACTGG - Exonic
1169493478 20:6091047-6091069 TGCCTCAGCCTCCGGGTAGCTGG - Intronic
1170150387 20:13221391-13221413 CCCCGCAGCCCCCTGCCAGCAGG + Intergenic
1170578647 20:17682076-17682098 CTTCGCAGCCGCCGCGGAGCCGG + Exonic
1171077572 20:22144343-22144365 CACCTCAGCCCCCGGGTAGTTGG + Intergenic
1171959843 20:31485698-31485720 CGCCCCAGCCCCGGGGGACGCGG + Intergenic
1172083252 20:32358753-32358775 TGCCGCCGCCGCCGGGGAGAAGG + Exonic
1172618665 20:36306295-36306317 CCCCGCCGCTCTCGGGGAGCCGG + Intergenic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1172839934 20:37896756-37896778 CGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1172937724 20:38632374-38632396 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1174386736 20:50191773-50191795 CGGCGCGGCCCCCGCGTAGCAGG - Exonic
1174569684 20:51492676-51492698 CGCTCCAGCCCTTGGGGAGCAGG + Intronic
1174658620 20:52191903-52191925 CCCCAACGCCCCCGGGGAGCTGG + Exonic
1178922591 21:36748123-36748145 CGCCGCAGCCCCGGGAGGCCGGG - Exonic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1178992690 21:37367854-37367876 GGCCGCGGCCTCCCGGGAGCCGG + Intronic
1179222492 21:39421214-39421236 TGCCTCAGCCCCTGGGTAGCTGG + Intronic
1179480283 21:41672481-41672503 ATCCGCAGGCCCCCGGGAGCTGG - Intergenic
1179626927 21:42654038-42654060 CGCCCCTTTCCCCGGGGAGCCGG - Intronic
1179657877 21:42856516-42856538 CGCCTCAGCCTCCGAGTAGCTGG + Intronic
1180109853 21:45642829-45642851 GGCCGCAGCGCCCGGCGGGCAGG - Intergenic
1180132573 21:45835876-45835898 CACGGCAGCCCCAGGGGAACAGG + Intronic
1180159396 21:45992377-45992399 TGACGGTGCCCCCGGGGAGCGGG + Exonic
1180685164 22:17660531-17660553 TGCCTCAGCCTCCGAGGAGCTGG + Intronic
1180834182 22:18921630-18921652 CGCCGCAGCCCCCAAAGTGCTGG - Intronic
1180929885 22:19582269-19582291 TGCCTCAGCCCCCGAGTAGCGGG - Intergenic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1181001882 22:19991644-19991666 CCCCAGAGCCCCAGGGGAGCAGG + Intronic
1181498963 22:23304998-23305020 TGCCTCAGCCCCTGAGGAGCTGG - Intronic
1181941764 22:26483490-26483512 GGGCGCAGCCCCCGGGGCGCAGG + Intronic
1182292808 22:29294489-29294511 CGCCTCAGCCTCCGAGTAGCTGG - Intronic
1182470279 22:30544165-30544187 CGCCCCAGCCCTCCGGGAACTGG - Intronic
1183243556 22:36676087-36676109 CGCCCCACCCCTCGTGGAGCAGG + Intronic
1183578217 22:38706023-38706045 CCTGGCCGCCCCCGGGGAGCTGG - Exonic
1184035112 22:41914535-41914557 CGCGGGAGCCCCCGAGGCGCAGG - Exonic
1184035319 22:41915207-41915229 GGCAGCAGGCCCCGCGGAGCCGG + Intergenic
1184101790 22:42344662-42344684 AGCCACAGCCCCCGTGGAGGTGG + Intergenic
1184171225 22:42760954-42760976 CACCTCAGCCCCAGGGGTGCGGG - Intergenic
1184258015 22:43298020-43298042 GGCCTCAGCCCCCTGGGACCAGG - Intronic
1184457846 22:44621629-44621651 CGCCCCAGTCTCCGGGGAGGAGG + Intergenic
1184465838 22:44668628-44668650 CGCCGCAGCCCCCAGGGACTCGG - Intronic
1184674276 22:46032075-46032097 CGGCCCAGCCCCGGGGGAGGAGG + Intergenic
1184759651 22:46537295-46537317 CGCCAGGGCCCCCGGGGAGGCGG - Intergenic
1184812496 22:46845939-46845961 CGCAGGAGCAGCCGGGGAGCTGG + Intronic
1185055135 22:48575473-48575495 CGCCGCCTCCCCCGAGGAGCCGG + Intronic
1185313821 22:50170427-50170449 CGCCGCCGCCCCCGGGGTCAGGG - Intergenic
1185384618 22:50526127-50526149 CCCCGCAGGCACCGTGGAGCTGG - Exonic
1185413373 22:50697394-50697416 CGCCGCCGACCCCCGGGAGGGGG - Intergenic
1203284270 22_KI270734v1_random:146928-146950 CGCCGCAGCCCCCAAAGTGCTGG - Intergenic
949559399 3:5188017-5188039 GGCTGCAGCCGCCGGGGACCGGG + Exonic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950316395 3:12004941-12004963 CGCCGCCGCCCTCGGGGGTCGGG + Intronic
950529817 3:13546773-13546795 CGCCTCAGTGCCCAGGGAGCTGG + Intergenic
952595042 3:35006952-35006974 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
953071127 3:39521061-39521083 TGCCTCAGCTCCCGAGGAGCTGG + Intronic
953631890 3:44625130-44625152 AGCGGGAGCCCCCGGTGAGCGGG + Intronic
954228447 3:49198632-49198654 CGCCTCAGCCTCCGAGTAGCTGG + Intronic
955300607 3:57775166-57775188 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
955687790 3:61562948-61562970 CGCCCCAGCCCCCAGAGAGAGGG - Intronic
956093649 3:65693835-65693857 TGCCTCAGCCCCCGAGCAGCTGG + Intronic
956468645 3:69542631-69542653 CGCCCCAGCCCCCGGAGAGGCGG - Intergenic
957071060 3:75568202-75568224 GGCTGCAGCCCCCGCTGAGCTGG - Intergenic
957564318 3:81865210-81865232 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
958798830 3:98733237-98733259 CGCCGCAGCCACCGCCGAGAGGG + Intronic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
960577175 3:119240919-119240941 CGCCCCAGCCGCCCGGGAGGCGG + Intronic
960743085 3:120856284-120856306 TGCAGCAGCCCCCGCGGAGGAGG + Intergenic
960848022 3:122022321-122022343 GGCCGCAGTCCCCCGGGAGGCGG - Intergenic
960971549 3:123143487-123143509 CCTGGCAGCCCCAGGGGAGCCGG - Intronic
961283055 3:125778522-125778544 GGCTGCAGCCCCCGCTGAGCTGG + Intergenic
961450286 3:126999501-126999523 CGCCCCAGCCGCCGGGAGGCAGG - Intronic
961680101 3:128594224-128594246 CGCTGCAGCACACGGGGAGCTGG + Intergenic
961941278 3:130639576-130639598 CACCTCAGCCCCCTGGTAGCTGG - Intronic
962677660 3:137768587-137768609 CTCCGCAGCCCTCGGGGCGACGG - Intergenic
963107639 3:141660325-141660347 CGCCGCAGTCTCCAGGGCGCCGG + Intergenic
963184658 3:142400801-142400823 TGCCTCAGCCTCCGGGTAGCTGG - Intronic
963706798 3:148698106-148698128 TGACGCAGCGCCCGGGGCGCGGG + Exonic
963800661 3:149672895-149672917 CGCCTCAGCCTCTGAGGAGCTGG + Intronic
966732553 3:183162858-183162880 CGGCGCAGCCGCCGGGGCCCGGG + Exonic
966787837 3:183636450-183636472 TGCGGCCGTCCCCGGGGAGCCGG + Intronic
966807422 3:183818163-183818185 AGCAGCAGCCCCTGGGGAGTCGG - Intronic
968213478 3:196868311-196868333 CGTCGCAGGCACCGGGAAGCTGG + Intronic
968225541 3:196969870-196969892 CGCCGCAGCTCGCGGGGACCTGG - Intergenic
968625074 4:1623343-1623365 CACCGCAGCCCCGGGAGAGGAGG + Intronic
968964372 4:3762098-3762120 AGCCGCAGCCCCGGAAGAGCTGG + Intergenic
968965115 4:3765823-3765845 GGCCGCGGGCCCTGGGGAGCTGG - Intergenic
969014659 4:4095900-4095922 GGCTGCAGCCCCCGCTGAGCTGG - Intergenic
970333149 4:15004223-15004245 CGCCGCAGCAGCCGCAGAGCCGG + Exonic
971458997 4:26873882-26873904 AGCCGCAGACCCCTGGGAGAAGG - Intronic
971906995 4:32739061-32739083 CGCCTCAGCCTCCGAGTAGCTGG + Intergenic
971928678 4:33049035-33049057 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
973201017 4:47502354-47502376 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
974108655 4:57500412-57500434 TGCCTCAGCCTCCGGGTAGCTGG + Intergenic
974406350 4:61476339-61476361 TGCCTCAGCCCCCAGGTAGCTGG + Intronic
976167907 4:82274874-82274896 GGTGGCAGCCCCCAGGGAGCCGG + Intergenic
978159288 4:105526924-105526946 AGCCGCAGACCCCTGGGAGAAGG - Intergenic
979524576 4:121703651-121703673 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
979674778 4:123398682-123398704 AGCCGCGGCCCCCAGGGGGCAGG - Intronic
979823399 4:125202412-125202434 TGCCTCAGCCTCCGGGTAGCTGG - Intergenic
980476593 4:133325923-133325945 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
982843811 4:160224413-160224435 CACCGCAGTCTCTGGGGAGCAGG + Intergenic
983649662 4:170026064-170026086 CGCCGCAGGGTCCGGGCAGCGGG - Intronic
983940272 4:173529507-173529529 CGCCGCGCCCCATGGGGAGCCGG - Exonic
984255770 4:177388320-177388342 CACCTCAGCCCCTGGGTAGCTGG + Intergenic
984709901 4:182876251-182876273 CACCGCAGATCCCAGGGAGCTGG + Intergenic
984888763 4:184473584-184473606 CGGCCCAGCCCCCAGGAAGCAGG + Intronic
985657098 5:1137839-1137861 TGCGCCAGGCCCCGGGGAGCTGG - Intergenic
986074412 5:4319851-4319873 CGGAGCAGACCCCGGGGACCAGG - Intergenic
986391750 5:7293696-7293718 TGCCTCAGCCTCCGAGGAGCTGG - Intergenic
989379267 5:40797895-40797917 CGCCGCAGCCCCGCGGCGGCTGG + Intronic
989620862 5:43383065-43383087 CGCCTCAGCCCCCGAAGTGCTGG + Intronic
990716551 5:58643933-58643955 TGCCTCAGCCCCCGAGGAGCTGG + Intronic
992534789 5:77688922-77688944 TGCCTCAGCCTCCGGGTAGCTGG + Intergenic
992734874 5:79708818-79708840 TGCCTCAGCCTCCGAGGAGCTGG - Intronic
992819374 5:80480804-80480826 CACCTCAGCCCCCGTGAAGCTGG - Intergenic
994679275 5:102865619-102865641 CGGCGCAGCCCCTGTAGAGCCGG - Intronic
995221591 5:109654616-109654638 AGCAGCAGGCCCCGGGGAGGTGG - Intergenic
995382435 5:111549821-111549843 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
995531445 5:113095631-113095653 CACCTCAGCCCCCGAGTAGCTGG + Intronic
995853988 5:116574140-116574162 CGCCCCACCTCCCGGGCAGCTGG - Intronic
996562639 5:124847181-124847203 CACCTCAGCCCCCGAGTAGCTGG - Intergenic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997131401 5:131279952-131279974 CACCTCAGCCCCCAAGGAGCTGG - Intronic
997512972 5:134465936-134465958 CTCCGCGGCCCCCTCGGAGCAGG - Intergenic
998173341 5:139885318-139885340 CACCACAGGGCCCGGGGAGCAGG + Intronic
998407682 5:141883216-141883238 CTGGGCAGCCCCCGGGGACCCGG + Intergenic
999129486 5:149271941-149271963 CGGCCCGGTCCCCGGGGAGCGGG - Exonic
1000108934 5:158088638-158088660 CACCTCAGCCCCCGAGTAGCTGG + Intergenic
1001025233 5:168218643-168218665 GGCTGCATCCCCCGGAGAGCAGG + Exonic
1001700918 5:173705925-173705947 AGCAGCAGCCCCATGGGAGCAGG - Intergenic
1003013542 6:2449410-2449432 CGCCGCAGCCCACCTGGAACAGG + Intergenic
1003139151 6:3456741-3456763 GGCCGCAGCGCCCGGGGCGCGGG - Intronic
1003552007 6:7108404-7108426 CGCCGCAGCGCCCCGCCAGCAGG + Intronic
1003624149 6:7727257-7727279 AGCCGCAGCCCCCGGCGCTCCGG + Exonic
1004212845 6:13669701-13669723 CACCTCAGCCCCCGAGTAGCTGG + Intronic
1004614904 6:17280894-17280916 CGCGGCAGCACCTGGGGCGCCGG - Intergenic
1005516515 6:26559625-26559647 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1006504688 6:34481158-34481180 TGCCTCAGCCCCCCGAGAGCTGG + Intronic
1006535614 6:34696656-34696678 CGCCGCCGGGCCCGGGGACCTGG + Exonic
1006912618 6:37573299-37573321 CGCCTCAGCCCCCAAGTAGCTGG + Intergenic
1006972357 6:38059760-38059782 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1007032372 6:38639911-38639933 CGCCGCAGCAGCCGGGGCGGCGG - Exonic
1007169108 6:39850033-39850055 AGCCCCAGCCCCAGGGGACCTGG + Intronic
1007573750 6:42911568-42911590 CGCCTGAGCCCCGCGGGAGCCGG + Intergenic
1007581127 6:42960790-42960812 GGCCGCCACCCCCAGGGAGCGGG - Exonic
1007605990 6:43118420-43118442 CGCCTCAGCCCCCAAGTAGCTGG - Intronic
1008932508 6:56955053-56955075 CGCGGCAGCCTGCGGGGGGCGGG + Intergenic
1010203995 6:73307179-73307201 CGCCTCAGCCTCCTGGGTGCTGG - Intronic
1010430378 6:75771114-75771136 CGCCTCAGCCCCCAAGTAGCTGG + Intronic
1011590403 6:88965697-88965719 CACCTCAGCCCCCAAGGAGCTGG + Intergenic
1011668620 6:89660297-89660319 CGCCTCAGCTCCTGAGGAGCTGG + Intronic
1011745497 6:90403901-90403923 GTCTGCAGCCTCCGGGGAGCTGG - Intergenic
1012646586 6:101691410-101691432 CGCCTCAGCCTCCGAGTAGCTGG + Intronic
1013033963 6:106362082-106362104 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1013793619 6:113860201-113860223 GGGCGCGGCCTCCGGGGAGCAGG + Exonic
1014610640 6:123540631-123540653 CGCCTCAGCCTCCGAGTAGCTGG + Intronic
1015492124 6:133838106-133838128 GGATTCAGCCCCCGGGGAGCAGG - Intergenic
1015625872 6:135181001-135181023 CGCCGCCGCGACCCGGGAGCGGG + Intergenic
1015690279 6:135914604-135914626 CGCCTCAGCCTCCCGAGAGCTGG + Intronic
1016923196 6:149317023-149317045 CGCCGCAGCGCCCCGGGGTCCGG + Intronic
1017108783 6:150913113-150913135 TGCCCCAGCCCCCAGGTAGCTGG + Intronic
1017672070 6:156778045-156778067 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1018400489 6:163415135-163415157 CGCCGCCGCCGCCGGAGAGGAGG - Exonic
1019323282 7:425166-425188 AGCGGCCGCCCCTGGGGAGCGGG - Intergenic
1019378576 7:709779-709801 CACCTCAGCCCCTGGGTAGCTGG + Intronic
1019385832 7:755615-755637 CACCTCAGCCTCCCGGGAGCTGG - Intronic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1019479373 7:1259615-1259637 CACGGGAGCCCACGGGGAGCCGG + Intergenic
1019486925 7:1293641-1293663 CCCCGCAGCCCCCAGGGTCCGGG - Intergenic
1019562637 7:1666086-1666108 CGCCGCCGCGCTCGGGGAACCGG + Intergenic
1019732667 7:2636546-2636568 CACGGAGGCCCCCGGGGAGCTGG + Intronic
1019960318 7:4454160-4454182 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1020046540 7:5045212-5045234 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1020204648 7:6105203-6105225 CGCCGCAGCCCCCAGAGCGGCGG - Intronic
1020418283 7:7969689-7969711 GGCCGCAGCCCCGGCCGAGCAGG + Exonic
1021132174 7:16924519-16924541 TGCCTCAGCCCCCTGGTAGCTGG + Intergenic
1021998521 7:26202230-26202252 CGCCGCAGCCTCGGGACAGCCGG - Intronic
1022088151 7:27088448-27088470 CCCCGCAGCCCCAGCAGAGCCGG + Intergenic
1022097095 7:27147916-27147938 CGCCGCGGTCCCCGGGGAGCGGG - Intronic
1023856864 7:44189381-44189403 CGCCTGAGCCCCAGGGAAGCAGG - Intronic
1023888138 7:44375211-44375233 CTCCACAGGGCCCGGGGAGCAGG - Intergenic
1024224513 7:47315349-47315371 CGGGGCAGCCCCCCGGGACCGGG + Intronic
1024255436 7:47537114-47537136 CCCTGCCGCCCGCGGGGAGCCGG + Intronic
1025734150 7:64132158-64132180 TGCCTCAGCCCCTGAGGAGCTGG + Intronic
1026009378 7:66625004-66625026 CACCTCAGCCCCCAGGTAGCTGG - Intergenic
1026129347 7:67607272-67607294 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1026851964 7:73729960-73729982 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1026898627 7:74025020-74025042 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1027138256 7:75639352-75639374 CGCCCGAGCCCCCGGGGACCGGG + Intronic
1027165044 7:75828309-75828331 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1027760851 7:82277314-82277336 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1028789375 7:94835624-94835646 TGCCTCAGCCCCCGAGGAGCTGG - Intergenic
1029042989 7:97597303-97597325 TGCCTCAGCCTCCGGGAAGCTGG + Intergenic
1029569992 7:101363006-101363028 CGCAGCAGCCCGCGGGGACCCGG - Exonic
1029675424 7:102065193-102065215 CACCTCAGCCTCCGAGGAGCTGG + Intronic
1032173005 7:129601371-129601393 CGCCTCAGCCTCCTGGTAGCTGG + Intergenic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1033320311 7:140333178-140333200 CGCCTCAGCTCCCAAGGAGCTGG - Intronic
1033425735 7:141242653-141242675 TGCCTCAGCTCCCGGGCAGCTGG + Intronic
1034741836 7:153481540-153481562 TGCCTCAGCCTCCGGAGAGCTGG - Intergenic
1035335832 7:158126523-158126545 CACACCAGCCCCCGGAGAGCGGG + Intronic
1035335858 7:158126610-158126632 CACACCAGCCCCCGGAGAGCGGG + Intronic
1035335884 7:158126697-158126719 CACACCAGCCCCCGGAGAGCGGG + Intronic
1035411816 7:158650158-158650180 TGCCTCAGCCCCCGAGCAGCTGG + Intronic
1035729552 8:1844526-1844548 CACCGCAGACCCCCGGCAGCAGG - Intronic
1035747908 8:1974537-1974559 CGCCGCTGCGCCCGGGGTGCGGG + Intronic
1037506013 8:19530105-19530127 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1037762391 8:21750557-21750579 CGCGGCAGCCCCGGTGGTGCTGG - Intronic
1038796400 8:30714323-30714345 CTCCTCAGCCCCCGAGTAGCTGG + Intronic
1038828467 8:31032901-31032923 CGCTGCGGCGCCGGGGGAGCCGG - Exonic
1039471569 8:37816476-37816498 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1039921213 8:41895913-41895935 GGCTGCAGGCTCCGGGGAGCGGG - Intronic
1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG + Intergenic
1040550148 8:48431306-48431328 CGCCGCTCCTCACGGGGAGCCGG + Intergenic
1041446377 8:57955362-57955384 TGCCTCAGCCCCCGAAGAGCTGG + Intergenic
1042532559 8:69831144-69831166 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1042533295 8:69835185-69835207 CGCTGAAGCCCCGAGGGAGCCGG + Intergenic
1042582163 8:70291959-70291981 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1043075593 8:75695084-75695106 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1043391646 8:79797634-79797656 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1045777583 8:105824000-105824022 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1047078728 8:121435691-121435713 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1047618886 8:126586308-126586330 CACCTCAGCCCCCGAGTAGCTGG - Intergenic
1047998403 8:130357961-130357983 CGCCGCTGCCGCCGCGCAGCTGG - Intronic
1049460717 8:142726523-142726545 CGCCGGAGGCCCTGGGGCGCAGG - Intergenic
1049585391 8:143430482-143430504 GACCGCCGCCCGCGGGGAGCAGG - Intergenic
1049633270 8:143671285-143671307 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1049686295 8:143940543-143940565 CGCCCCGGACCCCAGGGAGCCGG - Intronic
1049762195 8:144336647-144336669 CGCCGCCGCCCCCGGGGGCATGG - Intergenic
1049766874 8:144358997-144359019 CGCTGCGGCCCCAGGGGAGGAGG - Exonic
1049902181 9:179148-179170 AGCCACACCCCCCGGGGAGGTGG + Intergenic
1052888819 9:33676944-33676966 CGCCGCACCCCCCGTGGCCCGGG - Intergenic
1053357648 9:37460320-37460342 TGCCTCAGCCCCCGAGTAGCTGG - Intronic
1053435746 9:38073045-38073067 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1053745211 9:41189437-41189459 AGCCACACCCCCCGGGGAGGTGG + Intronic
1054482061 9:65675776-65675798 AGCCACACCCCCCGGGGAGGTGG - Intronic
1054683136 9:68241831-68241853 AGCCACACCCCCCGGGGAGGTGG - Exonic
1054731323 9:68705215-68705237 CGCGGCAGCCGCCGCGCAGCCGG + Intergenic
1055087636 9:72330223-72330245 TGCCTCAGCCCCCTGGTAGCTGG - Intergenic
1055308205 9:74952245-74952267 CGCCACCGCCCCCCGGGAGCCGG + Exonic
1055315254 9:75028184-75028206 CCCCGCAGCCCTCGGGCAGCCGG + Exonic
1056682805 9:88733882-88733904 CGCGGCTGTCCCAGGGGAGCAGG + Intergenic
1057024595 9:91725451-91725473 CGGGGCAGCCCCAGGGCAGCTGG - Intronic
1057076583 9:92141339-92141361 CGGCGCAGCCCGCCGGGACCGGG + Intergenic
1057349899 9:94287477-94287499 TGCCTCAGCCCCCGGTTAGCTGG + Intronic
1057432322 9:95005242-95005264 CGCCGGCGCCACCGGGGCGCAGG - Intronic
1057684712 9:97221823-97221845 CTCCGCAGCCACCGGGGATGGGG + Intergenic
1058885954 9:109321057-109321079 CGGCGCAGCCCCGAGGGAGGAGG - Intergenic
1059234493 9:112750683-112750705 CGCCGCGGCCGCCCGGGAGGGGG - Intergenic
1060482137 9:124022835-124022857 CAGCGCTGCCCACGGGGAGCGGG + Intronic
1061023651 9:128033455-128033477 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1061289363 9:129642000-129642022 CGCCGCGGGCCCCGCGCAGCAGG + Exonic
1061540738 9:131276925-131276947 CGCCGCGGCCGCCGAGGACCTGG + Intergenic
1061562565 9:131415420-131415442 AGCCCCAGCCCCAGGGGAGCGGG - Intronic
1061828441 9:133275546-133275568 CCCCGCCTCCCCGGGGGAGCAGG - Intergenic
1062028777 9:134352627-134352649 CCCTGCAGCTCCCGGGGTGCTGG + Intronic
1062526216 9:136978985-136979007 CGCCGCAGTTCCTGGGGCGCTGG + Exonic
1062537625 9:137027882-137027904 CGCTGCGGCCTCCGGGGAGGTGG - Exonic
1062696361 9:137878027-137878049 GGCTGCAGCCCCCCGGGACCCGG - Exonic
1202781339 9_KI270718v1_random:221-243 AGCCACACCCCCCGGGGAGGTGG + Intergenic
1185573431 X:1152209-1152231 CTCCGCAGACCCCCAGGAGCTGG + Intergenic
1185877617 X:3713286-3713308 GGCCGGAGCGCTCGGGGAGCCGG + Exonic
1185894169 X:3843515-3843537 GGCCGGAGCGCTCGGGGAGCCGG + Exonic
1185899288 X:3881939-3881961 GGCCGGAGCGCTCGGGGAGCCGG + Intergenic
1185904405 X:3920368-3920390 GGCCGGAGCGCTCGGGGAGCCGG + Intergenic
1187212769 X:17246201-17246223 CGCCCCACCCCCCAGGTAGCTGG - Intergenic
1187281305 X:17860509-17860531 CCCCGCATCCCCCCCGGAGCCGG - Intronic
1187464404 X:19515013-19515035 CGCCCCAGCCTCCGGGCCGCCGG + Exonic
1187477342 X:19623568-19623590 CGCCTCAGCCTCCGAGTAGCTGG - Intronic
1188768878 X:34129393-34129415 CACCTCAGCCCCCAGGTAGCTGG + Intergenic
1189289855 X:39877387-39877409 CGCCTCAGCCTCCTGGTAGCTGG + Intergenic
1189465167 X:41272906-41272928 CGCCTCAGCCTCCGAGTAGCTGG - Intergenic
1189565218 X:42234836-42234858 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1189823586 X:44894727-44894749 TGCCTCAGCCCCCGAGTAGCTGG + Intronic
1189823615 X:44894879-44894901 CGCCTCAGCCCCCGAGTAGCTGG + Intronic
1190008041 X:46758886-46758908 CGCCGCCGCCCCAGAGGAGGAGG + Exonic
1193134635 X:77956909-77956931 CACCTCAGCCCCCAGGTAGCTGG + Intronic
1193141735 X:78034855-78034877 TGCCTCAGCCCCCAGGAAGCTGG + Intronic
1194127753 X:90040989-90041011 CCCCGCAGCCGCCAGGGGGCGGG - Intergenic
1194524254 X:94958190-94958212 TGCCTCAGCCCCCAGGTAGCTGG - Intergenic
1195393199 X:104384602-104384624 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1195680054 X:107538772-107538794 TGCCTCAGCCCCCGAGGAGCTGG + Intronic
1195751811 X:108167448-108167470 CACCTCAGCCCCCGAGTAGCTGG + Intronic
1197700386 X:129595201-129595223 CTCCCCAGGCCCCGTGGAGCAGG - Intergenic
1198381105 X:136084392-136084414 TGCCTCAGCCCCCGAGTAGCTGG + Intergenic
1200174879 X:154107106-154107128 TGCCTCAGCCCCCGAGTAGCTGG - Intergenic
1200285402 X:154817425-154817447 CGCCGCAGCCCGCAGGCACCCGG - Intronic
1202187799 Y:22206307-22206329 CGCCTCAGCCCCCAAGGATCTGG - Intergenic
1202203561 Y:22380089-22380111 CGCCTCAGCCCCCAAGGATCTGG + Intronic