ID: 948116244

View in Genome Browser
Species Human (GRCh38)
Location 2:235495606-235495628
Sequence CCTGACATGCAGAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948116244_948116257 26 Left 948116244 2:235495606-235495628 CCCGCTTCCCTCTGCATGTCAGG 0: 1
1: 0
2: 4
3: 30
4: 295
Right 948116257 2:235495655-235495677 ACAGCAGCAGTCTGCCTTCCGGG 0: 1
1: 0
2: 2
3: 23
4: 260
948116244_948116252 -3 Left 948116244 2:235495606-235495628 CCCGCTTCCCTCTGCATGTCAGG 0: 1
1: 0
2: 4
3: 30
4: 295
Right 948116252 2:235495626-235495648 AGGCAGGGCCATGGCCTTCCAGG 0: 1
1: 0
2: 1
3: 37
4: 389
948116244_948116256 25 Left 948116244 2:235495606-235495628 CCCGCTTCCCTCTGCATGTCAGG 0: 1
1: 0
2: 4
3: 30
4: 295
Right 948116256 2:235495654-235495676 TACAGCAGCAGTCTGCCTTCCGG 0: 1
1: 0
2: 0
3: 14
4: 157
948116244_948116258 27 Left 948116244 2:235495606-235495628 CCCGCTTCCCTCTGCATGTCAGG 0: 1
1: 0
2: 4
3: 30
4: 295
Right 948116258 2:235495656-235495678 CAGCAGCAGTCTGCCTTCCGGGG 0: 1
1: 0
2: 0
3: 25
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948116244 Original CRISPR CCTGACATGCAGAGGGAAGC GGG (reversed) Intronic
901129737 1:6954834-6954856 CCAGGCAAGCAGAGGGAAGGCGG - Intronic
904303970 1:29575161-29575183 CCTGTCAGGCAGAGGGGAGTGGG + Intergenic
904492967 1:30871634-30871656 CCTGCCAGGCAGAGGGCAGAGGG + Intronic
906223632 1:44103351-44103373 CCAGACCTGCAACGGGAAGCCGG - Intergenic
906775956 1:48529816-48529838 CTTGACATGCAGAGGGCCCCTGG - Intergenic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
912745132 1:112239704-112239726 AGTGACATGCAGTGGGAAGGAGG + Intergenic
913485989 1:119333293-119333315 CCTGACATGTGGAGGGAAATAGG - Intergenic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
916740839 1:167645865-167645887 CATGACAGACTGAGGGAAGCAGG - Intronic
916879097 1:169001495-169001517 CATGCCATACAAAGGGAAGCGGG - Intergenic
918363441 1:183782389-183782411 CATTACATGGACAGGGAAGCTGG + Intronic
918608279 1:186456032-186456054 CCTAACATGCAGAGGAATACTGG - Intronic
920560687 1:206936338-206936360 GCTGAGATCCAGAGAGAAGCAGG + Intronic
920694323 1:208170405-208170427 ATTGACAGGCAGGGGGAAGCAGG + Intronic
922664095 1:227454233-227454255 GCAGACAGGCAGAGAGAAGCTGG + Intergenic
923006635 1:230055090-230055112 TCTGACATGCAGCTGTAAGCTGG - Intergenic
923339003 1:232992209-232992231 GCTGACATGCTGAGGAAAGAAGG - Intronic
1063067412 10:2623750-2623772 CATGACAGGGAGAGGGAAGCAGG + Intergenic
1064376607 10:14802050-14802072 AATGACATCCAGAGGGAATCCGG + Intergenic
1064462677 10:15550436-15550458 CCTGCCCTTCAGAGGGAAGAGGG + Intronic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065880476 10:30033487-30033509 CCTGTCGTGCAGAGGAGAGCCGG + Intronic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067838228 10:49654670-49654692 CATGACCTCCAGAGGGAGGCAGG - Intronic
1068467607 10:57415334-57415356 CCTGAGATACAGTGGGAAACAGG + Intergenic
1069021635 10:63494946-63494968 TCTCACATACAGAGGGAAGTGGG - Intergenic
1069620857 10:69836475-69836497 CCTACCATGCAAAGGGGAGCTGG + Intronic
1070483906 10:76911697-76911719 CAAGAGAGGCAGAGGGAAGCTGG - Intronic
1070804911 10:79265262-79265284 CCTGCCCAGCACAGGGAAGCAGG + Intronic
1072072805 10:91936332-91936354 CCTGATGTGCAGAGTAAAGCAGG + Intronic
1072988329 10:100164496-100164518 TTTGACATGCAGAATGAAGCTGG + Intronic
1073190814 10:101649641-101649663 CCTGACAAGGAGAAAGAAGCTGG - Intronic
1075428437 10:122361035-122361057 CCTGACAGGCACTGGGAAGAGGG + Intergenic
1076590374 10:131578314-131578336 CCAGGGATGCAGAGAGAAGCGGG + Intergenic
1079202027 11:18384582-18384604 CCTGACCAGAAGAGGAAAGCAGG - Intergenic
1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG + Intronic
1080455147 11:32412004-32412026 CCTGAGATGCAAAGTGAAGGTGG - Intronic
1080752740 11:35165830-35165852 GCTGACATGCTGAGATAAGCCGG - Intronic
1081265869 11:41020519-41020541 ACAGACATGCAGAGGGAAGATGG + Intronic
1081595101 11:44453518-44453540 CCTCACAGACAGAGGGCAGCAGG - Intergenic
1081851251 11:46276702-46276724 CCTTTCACACAGAGGGAAGCTGG + Intergenic
1084359899 11:68662447-68662469 GCTGAGATCCAGAGGGAAGTGGG + Intergenic
1084938800 11:72601386-72601408 CCTCACATGCTGGGGGAAGGAGG - Intronic
1086120307 11:83298947-83298969 CCGGCCATGCAGAGAGAAGAGGG - Intergenic
1086337413 11:85812801-85812823 CCTGCCTTGCTGAGGGAAGCAGG + Intergenic
1089356673 11:117858407-117858429 CCTGACATGGAGAGGGAGTGAGG - Intronic
1090854510 11:130599579-130599601 CCTGAGATGCACAGGGAAATGGG + Intergenic
1091601755 12:1922203-1922225 CCGGCCACGCAGGGGGAAGCAGG - Intergenic
1091603344 12:1930864-1930886 CCTGAAATGCTGAGGGCAGCAGG - Intergenic
1092008188 12:5087271-5087293 CCAGACATTGACAGGGAAGCCGG - Intergenic
1092549395 12:9481631-9481653 CCTGTCATGCAGTGGGGAGAGGG + Intergenic
1093846890 12:23983267-23983289 GTTAACATTCAGAGGGAAGCAGG - Intergenic
1094486109 12:30926923-30926945 CCGGGCGGGCAGAGGGAAGCCGG + Intronic
1095380871 12:41590129-41590151 CCTAACATGCACTGGGAAGATGG - Intergenic
1096388426 12:51210995-51211017 CCTGACAAGGAGATGGCAGCAGG - Intronic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1097606340 12:61759075-61759097 CTTGAAATACAGAAGGAAGCTGG - Intronic
1097894361 12:64809727-64809749 TCACAGATGCAGAGGGAAGCTGG - Intronic
1099828267 12:87807150-87807172 CCTAATATGCAATGGGAAGCTGG - Intergenic
1100085763 12:90908431-90908453 GCTGACGTGCAGAGAAAAGCAGG - Intronic
1100856720 12:98763958-98763980 CATGACATCCACAGGGAACCTGG - Intronic
1101433299 12:104644672-104644694 CCTGGCAGGCAGAGTGCAGCTGG + Intronic
1102575630 12:113854489-113854511 CCCCACATGTGGAGGGAAGCAGG - Intronic
1103450626 12:121026104-121026126 CCTGGGAGGCAGAGGGGAGCCGG + Intronic
1103848520 12:123916114-123916136 CCTGGCAGGCTGAGGGAAGAGGG - Intronic
1103912967 12:124362289-124362311 GGTGACCTGCTGAGGGAAGCAGG + Exonic
1103920427 12:124396596-124396618 CCTGACCTGCAGCGGCAGGCAGG + Intronic
1103953677 12:124565497-124565519 CCGGACAAGCAGAGGGGAGTGGG + Intronic
1104307499 12:127622683-127622705 CCTGACAGGCAGAGCAGAGCAGG - Intergenic
1105941608 13:25152841-25152863 CCTGACATGGAAGGGGAAGATGG - Intergenic
1106033740 13:26025524-26025546 CTGGTGATGCAGAGGGAAGCAGG + Exonic
1106134209 13:26962122-26962144 CCTGACATGAAAAGGGGAGAGGG + Intergenic
1111308339 13:86446566-86446588 CATGACTTGCAGAGGGGAGGAGG - Intergenic
1114259612 14:21026809-21026831 ACTGGCATCCAGAGGGAAGAGGG - Intronic
1117370359 14:55072939-55072961 CCTCACATGCCGGGGGGAGCAGG + Intergenic
1117378686 14:55138396-55138418 CTTGACATGCAGAGGGCTTCAGG + Intronic
1118238225 14:64031258-64031280 TCTGCCAGGCAGAGAGAAGCAGG + Exonic
1121183290 14:91945660-91945682 GCTGACATCCAGAGGGAATAGGG + Intronic
1121422390 14:93824779-93824801 CCTGACAAGCAGATGGAAGTGGG - Intergenic
1122647223 14:103203008-103203030 CCAGACATGGACAGGCAAGCTGG - Intergenic
1122663592 14:103313976-103313998 CATGACATGCACAGAGAAACAGG + Intergenic
1123048964 14:105531513-105531535 CCTGGCATGGAGAGAGAAGAGGG + Intergenic
1123051711 14:105547229-105547251 GATGACCTGCAGAGGGAAGCCGG + Intergenic
1123077125 14:105672932-105672954 GATGACCTGCAGAGGGAAGCCGG + Intergenic
1123685177 15:22792047-22792069 GATGACATGCTGTGGGAAGCAGG + Intronic
1124658405 15:31526457-31526479 CCTGACTGGCAGAGGGGAGCCGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1127728007 15:61769849-61769871 CCTGATGTGCAGAGGGATTCAGG - Intergenic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1129467331 15:75731446-75731468 CCCGACATGCAGAGAGAGGTGGG + Intergenic
1130256303 15:82327584-82327606 CCTGCCATGGAGAGGGCAGCTGG - Intergenic
1130598648 15:85262404-85262426 CCTGCCATGGAGAGGGCAGCTGG + Intergenic
1131425636 15:92343567-92343589 GCTGAAATACACAGGGAAGCAGG + Intergenic
1132971894 16:2693210-2693232 CCTGCCATGCTGAGGGCAGTGGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133933308 16:10249718-10249740 CAGGACATGCAGGGGGCAGCTGG - Intergenic
1134016573 16:10892515-10892537 CATGACATGCAGATGAAGGCTGG - Intronic
1135776745 16:25263168-25263190 CCTGACAAGCAGCTGGGAGCAGG - Intergenic
1136385239 16:29921377-29921399 CGTGAGGTGCAGAGGGAACCTGG + Intronic
1137054107 16:35735248-35735270 GGTGACAAGCAGAGGAAAGCAGG - Intergenic
1137486780 16:48897918-48897940 CCTGACCTGCAGAGCAAATCTGG - Intergenic
1137712074 16:50573447-50573469 CCTGCCCTGCAGTGTGAAGCCGG + Intronic
1138201333 16:55091110-55091132 CCCGAGATGCAGAGGAAACCAGG + Intergenic
1138948983 16:61887572-61887594 CCTTACATGAAGAGGAAATCCGG - Intronic
1139937717 16:70583500-70583522 CCTGAGATGCAGGGGAAGGCTGG - Intronic
1139950409 16:70665540-70665562 TCTGCCATGCAGAGGCCAGCAGG + Exonic
1140553244 16:75890912-75890934 CCTGTCAGGCAGAGGGGTGCAGG - Intergenic
1141407028 16:83803776-83803798 CCTGACAAGCAGAGGGTCTCAGG - Intergenic
1141659633 16:85435123-85435145 CCTGACCTGGACAGGGAATCGGG - Intergenic
1142802050 17:2352405-2352427 CCTGTCGTGCAGATGGCAGCTGG + Intronic
1144256619 17:13474723-13474745 CGGTAAATGCAGAGGGAAGCAGG + Intergenic
1144426903 17:15151711-15151733 TCTGAAATGGAGAGGGAAGAGGG - Intergenic
1148843128 17:50511863-50511885 CCGGAGAGGCAGAGGCAAGCTGG - Intronic
1148966828 17:51442793-51442815 CTAGAAATGCAGAGGGAAACGGG - Intergenic
1149529077 17:57380503-57380525 CCTAACAGGGAGAGTGAAGCGGG + Intronic
1149642063 17:58209381-58209403 GCTGACATTCTGGGGGAAGCAGG + Intronic
1149776921 17:59365509-59365531 CCTGGCCTGGAGAGTGAAGCTGG + Intronic
1150172621 17:63015465-63015487 CCTGTCATGGGGTGGGAAGCGGG - Intronic
1150193363 17:63267317-63267339 CCAGACATTCAGAGGCAAGATGG + Intronic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1151783880 17:76265765-76265787 CCCCACGTGCAGAGGGGAGCCGG - Intronic
1152247530 17:79192927-79192949 CCTGACCCCCAGAGGGAAGCAGG + Intronic
1153416037 18:4846651-4846673 GCTGAGTTGCAGAAGGAAGCAGG - Intergenic
1153625120 18:7016034-7016056 CAGGAGATGCTGAGGGAAGCGGG + Intronic
1154502363 18:15003199-15003221 ACAGACATGCAGAGTGAAACAGG + Intergenic
1156408770 18:36807850-36807872 CATGACATGGAGTGTGAAGCTGG - Exonic
1157572968 18:48725123-48725145 CCTGACATGCAGAGCCAGTCTGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159131779 18:64288187-64288209 ACCGTCCTGCAGAGGGAAGCAGG - Intergenic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1160418409 18:78727639-78727661 CCTGACATGCTGAGGACAACAGG + Intergenic
1160443321 18:78909435-78909457 GCTGACATTCAGTCGGAAGCAGG - Intergenic
1161599296 19:5171092-5171114 GCTAACATGCACAGAGAAGCCGG - Intronic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162459984 19:10809216-10809238 CCTGCCATGCATAGAGAAGAGGG - Intronic
1163666482 19:18606244-18606266 CCTGGCATGCAGAGGGTCTCAGG + Intronic
1166178796 19:41092751-41092773 GCTGACATCCAGAGGTAGGCGGG - Intronic
1166570782 19:43795661-43795683 CCTGACATACAAGGGGAAGCTGG - Intergenic
1166782174 19:45348548-45348570 CCTGACAGGCCCAGGGAACCTGG - Intronic
1167636782 19:50659980-50660002 CCTGACATGGTGAGGGGAGGGGG + Intronic
1168115657 19:54220320-54220342 CCTGGCATGCAGAAGGCACCAGG - Intronic
1168118644 19:54240066-54240088 CCTGGCATGCAGAAGGCACCAGG - Intronic
1168588925 19:57616734-57616756 CCTCACAAGAGGAGGGAAGCTGG - Intronic
925122708 2:1431885-1431907 TCTAACTTGCAGAGGGAAGGAGG + Intronic
925311011 2:2881603-2881625 CCTGTCAGCCACAGGGAAGCAGG + Intergenic
925466394 2:4110463-4110485 ACTGACAGGCAGGGGGCAGCAGG - Intergenic
927178026 2:20424050-20424072 ACTGACTTGCAGAGAGATGCAGG + Intergenic
928530620 2:32187153-32187175 CAGGACATGCAGAGAAAAGCAGG - Intronic
929526377 2:42706995-42707017 CCTGGGTTACAGAGGGAAGCGGG - Intronic
929554962 2:42920487-42920509 CATGCCAAGCAGAGGGAAGGAGG - Intergenic
929913430 2:46113660-46113682 CCTGGCTTGCAGTGGGAAGGGGG + Intronic
931141425 2:59462606-59462628 CCTGAAATTCAGAGAGGAGCCGG - Intergenic
931569951 2:63657845-63657867 CCTGCCAAGCAGAGGCCAGCTGG - Intronic
936056765 2:109267719-109267741 CCTGACATGCACTGAGAAACAGG - Intronic
940913646 2:159230395-159230417 CCTGAGCTGGTGAGGGAAGCTGG - Exonic
941001711 2:160209121-160209143 CCAGACAGGCAAAGGGAAGAGGG + Intronic
941050419 2:160726375-160726397 CCAGACATACAGAGAAAAGCTGG + Intergenic
941648116 2:168063930-168063952 CCTGCAATGCAGAGGAAGGCGGG + Intronic
944368069 2:198947858-198947880 CCTGACATCAAGTGGGTAGCTGG - Intergenic
944667850 2:201971827-201971849 GATGACAGTCAGAGGGAAGCAGG + Intergenic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946339674 2:219059409-219059431 GCTGAGATGCCGAGGGAGGCAGG - Intronic
947371031 2:229445849-229445871 TCTGACATTCAGAGGGAATAGGG - Intronic
947394912 2:229676802-229676824 CATGAAATGGAGAGGGAAGCAGG - Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
1168903589 20:1386629-1386651 CCTGTCATGCAGTGGGGAGTGGG + Intronic
1169172992 20:3480594-3480616 CCTAACATACAGAGGGAGGGAGG + Intronic
1169451229 20:5713377-5713399 TCTGCCATGCAGAGAGAAGGTGG + Intergenic
1170582767 20:17711502-17711524 CCTGACCTGGTGAAGGAAGCAGG + Intronic
1170648101 20:18214475-18214497 CTTGAGATGCAGAGGTTAGCTGG + Intergenic
1171266429 20:23775517-23775539 CGTGACTTGGGGAGGGAAGCAGG + Intergenic
1172204834 20:33155880-33155902 CCTGCCCTGAAGAGGGAGGCAGG - Intergenic
1172593789 20:36135629-36135651 TCAGATATGTAGAGGGAAGCAGG - Intronic
1172756139 20:37285856-37285878 TCTGACATGCACAGGTCAGCTGG + Intergenic
1173545526 20:43894822-43894844 CCGGGCATCCAGAGGGAAGTGGG + Intergenic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1174143639 20:48434954-48434976 CATGAGATGCAGAGGGGAGCAGG - Intergenic
1174492787 20:50913763-50913785 CTTGGCCTACAGAGGGAAGCTGG + Intronic
1174831136 20:53813288-53813310 CCTGACAAGCAGAGAGAAAATGG - Intergenic
1175345199 20:58268163-58268185 CCTGAGATGCAGACGCTAGCTGG + Intergenic
1175488490 20:59362917-59362939 ACTGCCACCCAGAGGGAAGCGGG - Intergenic
1176185914 20:63778973-63778995 CCTGACCTGCAGATGGCGGCAGG + Intronic
1178343513 21:31805857-31805879 GATGACATGCAGAGGCAGGCTGG + Intergenic
1178490516 21:33048123-33048145 CCCCACCTGCAGAGGCAAGCAGG + Intergenic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1179358735 21:40685609-40685631 GGTGACATTCAGAGGAAAGCAGG - Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1180167436 21:46037304-46037326 CCTCACATGCGGAGCGGAGCAGG + Intergenic
1181573886 22:23782057-23782079 CCCCACCCGCAGAGGGAAGCGGG - Intronic
1181618807 22:24073535-24073557 CCTGACATGTAGTGAGCAGCTGG - Intronic
1181764719 22:25083240-25083262 CCACACACGCAGAGGGAAGATGG - Intronic
1182518302 22:30871349-30871371 CCAGACAGAAAGAGGGAAGCAGG - Intronic
1184031842 22:41899829-41899851 CCTGAAAAGCAGAGGGACCCAGG - Intronic
1184602885 22:45553881-45553903 CCCGCCATGCTGAGAGAAGCGGG + Intronic
950182842 3:10927266-10927288 CCTGCCTGGCAGAGGGAGGCAGG + Intronic
951266596 3:20575126-20575148 CCTGACATGCTGAGGAGAACTGG + Intergenic
953381155 3:42473768-42473790 CCTGAGAGGAAGACGGAAGCTGG + Intergenic
953850169 3:46459924-46459946 CATGAAATGGAGAGGGAAGGAGG - Intronic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
954866993 3:53738084-53738106 CCCGACCAGCAGAGGGAGGCTGG + Intronic
957976286 3:87448838-87448860 CTTGATATGCAGAGGTAAGAAGG + Intergenic
958145039 3:89613211-89613233 CATGTCATTCTGAGGGAAGCAGG - Intergenic
958266701 3:91446260-91446282 CCAGACATGAAAAGGGAGGCTGG - Intergenic
960121884 3:113955466-113955488 CCTGGCATGCAGTGGGTAGAAGG + Intronic
961102747 3:124215352-124215374 ACTGGTATGCAGTGGGAAGCTGG + Intronic
961393494 3:126570403-126570425 CCTGGCCTGCAGAGGGCACCGGG + Intergenic
961468406 3:127096012-127096034 AGTGAAATGCAGAGGAAAGCAGG - Intergenic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
967909207 3:194527381-194527403 GCTGACATCCAGAGGGAACTAGG - Intergenic
969070520 4:4534570-4534592 ACTGACATGGAGAGCTAAGCAGG - Intronic
969319760 4:6404632-6404654 TCTGAGTTGCAGAGGGATGCTGG + Intronic
969837765 4:9857474-9857496 CCTGAGATGGTGAGGGAAGATGG - Intronic
972647508 4:40982967-40982989 CCTGACCTGCAGGGTGAAGGTGG + Intronic
972819992 4:42690771-42690793 CCTGACATGCACCAAGAAGCTGG - Intergenic
972918236 4:43905749-43905771 CCTGACAGACAGAGAGAAACCGG + Intergenic
973998902 4:56490162-56490184 CCACACATGTAGAGGAAAGCAGG - Intronic
976364838 4:84221830-84221852 TGTGAAATGCAGAGGGAAGTGGG + Intergenic
977495633 4:97771670-97771692 GCAGACATGCAGAGGGAATGGGG + Intronic
977715270 4:100175101-100175123 CCAGACATGAAGAGGGAACCTGG - Intergenic
977999032 4:103533573-103533595 GTAGACATGCAGAGAGAAGCAGG + Intergenic
979867830 4:125778054-125778076 CCTGGCATGCAGGGTGGAGCTGG - Intergenic
980649205 4:135688248-135688270 CCAGACATACAAAGAGAAGCTGG - Intergenic
981903861 4:149896832-149896854 CCAGAAATGCAGAGGGGAGAGGG + Intergenic
983491802 4:168398134-168398156 CCAAACCTGCAGAGGGAAGGGGG - Intronic
983678876 4:170329453-170329475 CATGAAATGGAGAGTGAAGCAGG + Intergenic
984106152 4:175549091-175549113 CCTGACAGGCAGAGTCAAACAGG - Intergenic
985672007 5:1211443-1211465 CCAGACTTGCACAGGGAAGAGGG + Intronic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
985925117 5:3009750-3009772 GCTGACATCCACAGGGAAGTTGG + Intergenic
986401336 5:7384539-7384561 CCTGACATTCAGAGGCATGCAGG - Intergenic
987500353 5:18700936-18700958 ACTGACAAGAAAAGGGAAGCTGG - Intergenic
988303947 5:29470374-29470396 CCTAACATGCAGCGGAAACCTGG - Intergenic
988633028 5:32951549-32951571 GATGACATGCTGAGGGCAGCTGG + Intergenic
991036367 5:62131698-62131720 CCTGGCTAGCAGAGGGAAGTGGG - Intergenic
991481794 5:67089247-67089269 TTAAACATGCAGAGGGAAGCAGG + Intronic
997009489 5:129859962-129859984 AGTGACATGGAGAGGGAATCTGG - Intergenic
998229258 5:140349253-140349275 CCTGACATCCAGAGAGCAGGTGG - Intergenic
998406324 5:141876601-141876623 TCTGACTTACAGAGGGTAGCTGG + Intronic
998534303 5:142915287-142915309 CACGCCATGCAGAGGGAACCAGG - Intronic
999117198 5:149174341-149174363 CCTGCCATGTTGAGGAAAGCCGG + Intronic
1001670353 5:173468453-173468475 CTTGACATCCAGAGGGATGGTGG + Intergenic
1002459823 5:179367773-179367795 CCTGCCACACAGAGGGGAGCTGG + Intergenic
1002499513 5:179638715-179638737 CTGGTCAGGCAGAGGGAAGCAGG - Intergenic
1003011775 6:2433665-2433687 GCTGAGATACAGAGGGCAGCGGG - Intergenic
1003892037 6:10572159-10572181 CCTGACATGGAAAGGTGAGCAGG - Intronic
1004041266 6:11978411-11978433 TCTGACATGTAAAGGCAAGCTGG - Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006341214 6:33448170-33448192 CCTGAGATGCAGAGAGGAGTGGG - Intronic
1006804816 6:36781216-36781238 CCAGACAGGGAGAAGGAAGCTGG + Intronic
1006845596 6:37059395-37059417 CCTGACCGGCAGGGGGAACCAGG + Intergenic
1007237148 6:40398953-40398975 CCCCACAGGCAGAGGCAAGCAGG - Intronic
1007485427 6:42177942-42177964 CTTGACAATCACAGGGAAGCAGG + Intronic
1007687102 6:43673500-43673522 CATGCCTTGGAGAGGGAAGCTGG + Intronic
1007746107 6:44043854-44043876 CCTGGCAAGCTGAGGGAGGCAGG - Intergenic
1007883270 6:45191398-45191420 CCAGAAATTCAGAGGGAAGGAGG + Intronic
1007904394 6:45444576-45444598 CCTAACAAGCTGAGTGAAGCAGG - Intronic
1008549069 6:52610333-52610355 CCTGACAGGCAGAGGGAATCCGG + Intergenic
1008988512 6:57575333-57575355 CCAGACATGAAAAGGGAGGCTGG + Intronic
1009177119 6:60473924-60473946 CCAGACATGAAAAGGGAGGCTGG + Intergenic
1010103112 6:72133475-72133497 TCTGACATGCACAGTGCAGCTGG + Intronic
1011154876 6:84319784-84319806 CCTGTCATGGGGTGGGAAGCTGG + Intergenic
1014689354 6:124543950-124543972 CCTGACAAACAGTGGGAAACAGG - Intronic
1014943465 6:127470340-127470362 CCCCACATGTAGAGGGAGGCAGG - Intronic
1016201587 6:141416914-141416936 CCCTACGTGCAGAGTGAAGCAGG + Intergenic
1016793321 6:148089796-148089818 CCAGTCTTGCAGAGGCAAGCTGG - Intergenic
1017582402 6:155880502-155880524 CCTGACCTGCAGAGAGCATCTGG + Intergenic
1018366909 6:163130286-163130308 CCGGACAGACACAGGGAAGCTGG - Intronic
1018720294 6:166566798-166566820 CCTGACAGGCTCAGGGAAGCTGG + Intronic
1019774701 7:2905705-2905727 CCTGACCTGCAGGAGGAAGCGGG + Intergenic
1020205856 7:6115183-6115205 CCTGAAATACAGGGGGAAGAGGG - Intronic
1021007990 7:15423850-15423872 CCTGACATCAAGATGGCAGCAGG - Intronic
1021065805 7:16170964-16170986 CCCCACAAGAAGAGGGAAGCCGG + Intronic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022508868 7:30922778-30922800 CCTGCCATGTAGAGGCAGGCTGG + Intronic
1022893089 7:34720744-34720766 CCTGACATGCATCTGGAGGCAGG - Intronic
1022924921 7:35047065-35047087 CCTGTCATGCTGAGGGGAGGAGG + Intergenic
1023049076 7:36235515-36235537 ACAGAGATGCAGAGGGGAGCCGG - Intronic
1023090854 7:36616074-36616096 CCTGACCTCCACGGGGAAGCCGG + Intronic
1023629417 7:42148854-42148876 CCAGGCAGGCAAAGGGAAGCTGG - Intronic
1025875817 7:65478894-65478916 CCGGACTAGCAGAGAGAAGCAGG - Intergenic
1029822932 7:103161770-103161792 CCTGTCATGCTGAGGGGAGGAGG + Intergenic
1031581342 7:123478415-123478437 CCTGTCATGGGGTGGGAAGCAGG + Intronic
1031913910 7:127544847-127544869 CCTGAAAGGCAGGGAGAAGCGGG + Intergenic
1032515489 7:132503472-132503494 CCTGACTTGGAGTGGGCAGCTGG - Intronic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1033231824 7:139604172-139604194 GCTGCCATGCTGGGGGAAGCAGG + Exonic
1034167891 7:149039634-149039656 ACAGACATACAGAGGGAAGATGG + Intergenic
1034434864 7:151058611-151058633 TCTGACATGCTGAGGAAAACTGG + Exonic
1035492613 7:159293536-159293558 GCTGGCATGCAGAGAGAGGCTGG + Intergenic
1038409652 8:27348324-27348346 CCTGTCATGCAGAGGAAACAGGG - Intronic
1039139928 8:34375279-34375301 CCTAACATGCAGTGGAAATCAGG - Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1041299395 8:56394911-56394933 TCTGACATGCAGAATCAAGCAGG + Intergenic
1041554846 8:59141946-59141968 CCTGCCATTCAGGGGTAAGCGGG + Intergenic
1044800727 8:95951721-95951743 CCTGACACATAGATGGAAGCAGG + Intergenic
1045054202 8:98355283-98355305 CCAGACATGCAGAGAGGAGTAGG - Intergenic
1047875961 8:129137894-129137916 CCCGACATGTAGAGGGAGGGAGG + Intergenic
1048442076 8:134467401-134467423 GATGACCTGCAGAGGGAAACAGG - Intergenic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1050095371 9:2059414-2059436 CCTGGTATGGAGAGGGAGGCAGG - Intronic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1053218539 9:36292792-36292814 GCTGACCTGCAGAGGGCAGGAGG - Intronic
1054744707 9:68843018-68843040 CGTGAAGGGCAGAGGGAAGCTGG - Intronic
1055624771 9:78165180-78165202 CCTGTCAGGGAGTGGGAAGCTGG - Intergenic
1057764824 9:97907576-97907598 AGTGACATGCAAAGGCAAGCTGG - Intronic
1057949250 9:99356731-99356753 CCTGCCAGGGAGAGGGCAGCAGG + Intergenic
1059573771 9:115468373-115468395 CCTCACTGGTAGAGGGAAGCTGG - Intergenic
1060407205 9:123378732-123378754 CCTAACATGCAGATGAAAGCTGG + Exonic
1060434477 9:123581805-123581827 CCTGACTTCCAGAGTGAAACGGG - Intronic
1061149599 9:128821265-128821287 TCGGACCTGCAGAGGGAAGGTGG - Exonic
1061430661 9:130528313-130528335 CCTGAGATGAGGAGGGAAGGTGG + Intergenic
1061734943 9:132648001-132648023 GATGACTTGCAGAGGGAAGTTGG + Intronic
1062121841 9:134838110-134838132 TCAGCCATGCAGAGGGAACCGGG + Intronic
1062517124 9:136942333-136942355 CCTGACCTGCTGCTGGAAGCCGG - Exonic
1062635377 9:137487803-137487825 CCTGACAGGCAGGTGGAGGCTGG - Intronic
1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG + Exonic
1191027574 X:55930962-55930984 CCTGAGGTACAGAGAGAAGCTGG - Intergenic
1195743578 X:108091463-108091485 CCTGGCCTACAGCGGGAAGCTGG - Exonic
1195920095 X:109975050-109975072 TCTGAGATCCAGAGAGAAGCTGG - Intergenic
1200834151 Y:7716702-7716724 CCTGACATGCATAGTGAATGAGG + Intergenic