ID: 948118221

View in Genome Browser
Species Human (GRCh38)
Location 2:235509678-235509700
Sequence GGGTGCAAGCAGACGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948118221_948118225 -2 Left 948118221 2:235509678-235509700 CCTCTGTCCGTCTGCTTGCACCC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 948118225 2:235509699-235509721 CCATCTGCTGTCTGTCACTGTGG 0: 1
1: 1
2: 10
3: 49
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948118221 Original CRISPR GGGTGCAAGCAGACGGACAG AGG (reversed) Intronic
900809089 1:4787587-4787609 GAGTGGAAGCAGAGGGGCAGGGG + Exonic
901157524 1:7150399-7150421 GGGGGCAAGCAGATGGGGAGGGG + Intronic
901475239 1:9485014-9485036 GGGTCCATGCAGAGGGGCAGGGG - Intergenic
905514310 1:38550630-38550652 GGCTGGAAGCAGAGGGGCAGTGG + Intergenic
905768916 1:40624956-40624978 GGGAGAAAGCAGCAGGACAGTGG - Exonic
908309037 1:62857170-62857192 GGCTGCAAGCAGAAGGTGAGCGG + Intronic
910907109 1:92192715-92192737 GGAGGCAAGCAGACGGGTAGTGG - Intergenic
912274480 1:108242035-108242057 GGGGGCAGGCAGATGGGCAGGGG - Intronic
912286787 1:108377823-108377845 GGGGGCAGGCAGATGGGCAGGGG + Intronic
912293739 1:108452306-108452328 GGGGGCAGGCAGATGGGCAGGGG + Intronic
916894895 1:169151817-169151839 GGGAGGAGGCAGATGGACAGAGG - Intronic
920201089 1:204260019-204260041 GGCTCAAAGCAGACTGACAGAGG - Intronic
920962088 1:210672343-210672365 GGAGGCAGGCAGACAGACAGTGG - Intronic
922785610 1:228280982-228281004 GGGTGCAAGCAGGTGGACCCGGG + Intronic
923071972 1:230573943-230573965 GGGCCCAAGCAGAGGAACAGAGG - Intergenic
924954978 1:248917422-248917444 GGGTCCAAGCAGCTGCACAGGGG + Exonic
1067450982 10:46381670-46381692 GGGTGCAAGCAGCTCGACTGAGG - Intronic
1067586261 10:47478081-47478103 GGGTGCAAGCAGCTCGACTGAGG + Intronic
1067826814 10:49580563-49580585 CGGTGCAAGCAGAAACACAGTGG + Intergenic
1070020907 10:72584986-72585008 GGGTAGAAGCAAAAGGACAGAGG + Intronic
1071672549 10:87622629-87622651 GGCTGCCAGCAGCCTGACAGAGG - Intergenic
1073481961 10:103791671-103791693 GGTTCCAAGCAGATGGAGAGAGG - Intronic
1073483397 10:103801149-103801171 AGGTGGGAGCAGAGGGACAGAGG - Intronic
1074654875 10:115573359-115573381 GGAGGCAAGCAGACAGACAATGG - Intronic
1076757215 10:132578842-132578864 GGGTGCCAGCAGAGGGGCTGCGG + Intronic
1077012318 11:384789-384811 GGCTGCAAGGAGGCGGACAGGGG + Intergenic
1077629898 11:3804282-3804304 GGAAGCAAGCAGATGAACAGGGG + Intronic
1079122471 11:17695779-17695801 GGGTGCGAGCACAGGGTCAGTGG + Intergenic
1083079638 11:60077303-60077325 AGGTGGAAGTAGACGGACAGGGG - Intergenic
1083427122 11:62593920-62593942 GGGTGCAGGTAGAGGGACAGGGG + Exonic
1083619233 11:64040774-64040796 GGGTGCAGGCAGAGGGAGAAGGG + Intronic
1084214880 11:67641792-67641814 GGGTGCCAGCATCAGGACAGAGG + Intergenic
1084376252 11:68779834-68779856 AGGTGCAGGCAGGGGGACAGGGG + Intronic
1084434542 11:69131252-69131274 GGGTGCAGGCAGCCTGGCAGGGG + Intergenic
1084453277 11:69252471-69252493 GGCTCCAAGCAGATGAACAGAGG - Intergenic
1084556512 11:69879238-69879260 GGCTGTAAGCAGAGGGACTGGGG + Intergenic
1084668707 11:70592586-70592608 GGGTGCAGACAGAGGGACAGAGG - Intronic
1088459645 11:110069147-110069169 GGGTACTAGGAGAAGGACAGAGG + Intergenic
1089505318 11:118958382-118958404 GGGGGCAAGGAGAGGGACAGAGG - Exonic
1090238305 11:125165210-125165232 GGGTGCAAGGAGCCGGGCTGCGG + Intronic
1090933972 11:131325257-131325279 GGAGGCGAGCAGAAGGACAGAGG - Intergenic
1090966422 11:131601209-131601231 GGGAGCATACAGATGGACAGTGG + Intronic
1091775121 12:3179448-3179470 GGCTCCAAGCAGGGGGACAGTGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093503103 12:19834976-19834998 GGAAGCAAGCAGAATGACAGAGG - Intergenic
1097694478 12:62763214-62763236 GGGTGGAATCAGGCGGACCGGGG + Intronic
1099090010 12:78294987-78295009 GGGGGCAAGCTGATGTACAGCGG - Intergenic
1099737635 12:86590344-86590366 GGTTGAAAGCAGAAAGACAGGGG - Intronic
1100003007 12:89859901-89859923 GGCTGCCAGCAGAGTGACAGAGG - Intergenic
1100024261 12:90108616-90108638 GGATGAAAGCAGACGCAAAGAGG + Intergenic
1100694422 12:97076164-97076186 GTGTGAAAGCAGACGGTCAAAGG + Intergenic
1103699464 12:122841301-122841323 GGGAGGAAGCAGACAGACATGGG + Intronic
1103867618 12:124065177-124065199 GGGTGCACTTAGAAGGACAGTGG + Intronic
1104766458 12:131333324-131333346 GGGTGTCAGCAGAGGGGCAGGGG + Intergenic
1104812956 12:131629301-131629323 GGGTGTCAGCAGAGGGGCAGGGG - Intergenic
1106823268 13:33490457-33490479 GGAGGCAAGCAGACCGACAGTGG + Intergenic
1106858734 13:33881691-33881713 GGGTACAAGAACAGGGACAGAGG - Intronic
1106936945 13:34732983-34733005 GTGTGCGAGCAGATGGAAAGGGG + Intergenic
1107301626 13:38971999-38972021 GGGGGCAGGCATAAGGACAGAGG - Intronic
1109300776 13:60587643-60587665 GGGAGCATGCAGACAGTCAGGGG - Intergenic
1109589806 13:64463182-64463204 GGGAGCAGACAGATGGACAGGGG - Intergenic
1113929157 13:113957339-113957361 GGGTGCATGCAGAGGTGCAGGGG - Intergenic
1114547517 14:23513501-23513523 GTGTACAACCAGAAGGACAGAGG + Intergenic
1115490518 14:33953540-33953562 GGGTTCAAGCAGAAGTAGAGAGG - Intronic
1118310417 14:64688375-64688397 GCTTGCATGCAGAAGGACAGAGG + Intergenic
1120423011 14:84312478-84312500 GGGTTCGAGCACACGTACAGAGG - Intergenic
1122228350 14:100292526-100292548 GGCTGCAGGCGGACGGACTGCGG - Exonic
1202905410 14_GL000194v1_random:68798-68820 GGTTGCCAGGAGGCGGACAGGGG - Intergenic
1129034520 15:72641355-72641377 GGGAGGAGGCAGAGGGACAGAGG + Intergenic
1129215362 15:74095861-74095883 GGGAGGAGGCAGAGGGACAGAGG - Intergenic
1129392264 15:75226346-75226368 GGGAGGAGGCAGATGGACAGAGG + Intergenic
1129472130 15:75761819-75761841 GGGAGGAGGCAGATGGACAGAGG - Intergenic
1131765273 15:95668927-95668949 GGATGAAAGCATACAGACAGAGG + Intergenic
1132994076 16:2813981-2814003 GGGTGGGAGCAGAGGTACAGTGG - Intergenic
1141038790 16:80654131-80654153 GGGTGCAAGGAGACGCAGACAGG + Intronic
1141633021 16:85299134-85299156 CGGTGCAAACATACGGACATGGG - Intergenic
1142123922 16:88400874-88400896 GGGACCAAGCAGAGGGCCAGGGG + Intergenic
1148468417 17:47878466-47878488 GGGTGCTGGCAGACAGACACAGG - Intergenic
1151267563 17:72968510-72968532 GGGCAGAAGCAGAGGGACAGTGG - Intronic
1151728868 17:75899381-75899403 GGGTGCTAGCAGACTCCCAGGGG - Intronic
1153328628 18:3848836-3848858 GAGTGGAAGGAGAAGGACAGTGG - Intronic
1153768432 18:8396521-8396543 TGGTGCACGCTGAAGGACAGGGG + Intronic
1160833941 19:1115969-1115991 GGGAGAAAGCAGAGGGGCAGGGG + Intronic
1161087389 19:2341334-2341356 GGGTGCCAGGAAAGGGACAGCGG - Intronic
1162536620 19:11266260-11266282 GGGTGCAGGCAGACGAGGAGTGG - Intergenic
1166305288 19:41934062-41934084 GGGTGCCAGGAGAAGGGCAGAGG + Intergenic
1167066683 19:47191589-47191611 AGGTGCAAGGTGATGGACAGTGG + Intronic
1167364944 19:49049754-49049776 GCATGCAAGCAGATGGCCAGGGG - Intergenic
1168287101 19:55340458-55340480 GAGTGCCAGGAGAGGGACAGAGG - Intronic
1168433839 19:56302447-56302469 GGGAGGAAGCAGACGGAGAGAGG - Intronic
925263443 2:2547675-2547697 GGGTGCCAGGAGAGGGGCAGGGG - Intergenic
927146582 2:20170107-20170129 GGCTGCAAGGAGATAGACAGAGG - Intergenic
933731338 2:85458509-85458531 GGCTGCAGGCAGAAGGGCAGTGG + Intergenic
934501214 2:94861670-94861692 GGCTGCCAGGAGGCGGACAGGGG + Intergenic
935985207 2:108665966-108665988 GTGTGCAAGCAGAGGGAAAATGG - Intronic
936104895 2:109615033-109615055 GGCTGCGAGGAGGCGGACAGGGG + Exonic
936137642 2:109909610-109909632 GTGTGCAAGCAGAGGGAAAATGG - Intergenic
936207055 2:110461875-110461897 GTGTGCAAGCAGAGGGAAAATGG + Intronic
942409060 2:175687599-175687621 GGGTGCCAGCAGAAGGGCACGGG - Intergenic
943824377 2:192370582-192370604 GGCTACAAGCAGATGGGCAGTGG + Intergenic
944531273 2:200670106-200670128 GGGTGGAGGCAGACTGTCAGAGG - Intronic
947610492 2:231522308-231522330 GGCAGCAAGCAGACGGGCAGTGG - Intergenic
948084139 2:235232389-235232411 GGGTGCAGGCAGCCGGGCTGGGG + Intergenic
948118221 2:235509678-235509700 GGGTGCAAGCAGACGGACAGAGG - Intronic
1172591816 20:36123051-36123073 TGGTTCAAGCAGAAGGAGAGAGG + Intronic
1175862369 20:62157195-62157217 GGGTGGCAGCAGAGGAACAGGGG - Intronic
1175914259 20:62418470-62418492 GGGAGCAAGCAGAGGGGCGGGGG + Intronic
1176624781 21:9083557-9083579 GGTTGCCAGGAGGCGGACAGGGG - Intergenic
1180569559 22:16702476-16702498 GGAGGCAGGCAGAGGGACAGAGG - Intergenic
1182780077 22:32860610-32860632 AGGGACAAGGAGACGGACAGGGG - Exonic
1184774087 22:46614906-46614928 GGGGGAAACCAGACGCACAGGGG - Intronic
951716110 3:25648316-25648338 GGGAGCAGACAGATGGACAGAGG + Intronic
959651639 3:108756437-108756459 AGGTGCAGGGAGATGGACAGGGG + Intronic
966213317 3:177475479-177475501 GGGAGCAGGCAGAGGAACAGAGG + Intergenic
966512638 3:180781397-180781419 GGCTGCAAGCAGATGCACACTGG + Intronic
967382333 3:188872946-188872968 GTGAGCAAGCAGACTGAGAGAGG - Intronic
968349656 3:198043327-198043349 GCGTCCAAGGACACGGACAGTGG - Intronic
971363085 4:25954585-25954607 GAGCGCAAGCAGTCAGACAGGGG + Intergenic
982428180 4:155291786-155291808 TGGTGTTAGCAGAGGGACAGAGG - Intergenic
984856438 4:184199840-184199862 GAGTGGGAGCAGACGGAAAGTGG - Intronic
985497032 5:214571-214593 GGGGGGAAGCAGAATGACAGAGG + Intronic
985738536 5:1600387-1600409 GGGGGAAAGCAGAATGACAGAGG - Intergenic
985796025 5:1962680-1962702 GGGTGCAGGCTTACAGACAGAGG + Intergenic
993773588 5:91962794-91962816 GGGAGCATGCAGATGGGCAGGGG - Intergenic
996627322 5:125586072-125586094 GAAAGCAAGCAGACGGACAGTGG + Intergenic
1002131428 5:177084366-177084388 GGGAGCCAGCAGAGGGCCAGAGG + Intergenic
1003051289 6:2783143-2783165 GAGTGCACGCACACGCACAGAGG - Intronic
1003311158 6:4971003-4971025 GGGGGCAAGCAGAGGGAAAGGGG + Intergenic
1003593123 6:7452590-7452612 GGAGACAAGCAGACGAACAGCGG + Intergenic
1005033499 6:21533874-21533896 GGGTAGATGCAGACTGACAGTGG + Intergenic
1006512653 6:34529995-34530017 GAGTGCAAGCTGACGCACACTGG + Intronic
1010001874 6:70956639-70956661 GGGTGCAGGCGGGCGGGCAGGGG + Exonic
1010801927 6:80186526-80186548 TGGTGCAGGCAGACGGAAAAGGG - Intronic
1015181517 6:130366267-130366289 GGGTGCAAGCGGACGGAGGGTGG - Intronic
1019018326 6:168896647-168896669 GGTTGAAAGCAGATGGAGAGGGG - Intergenic
1019204299 6:170346245-170346267 GCGTGCAGGGAGATGGACAGTGG - Intronic
1022093522 7:27123675-27123697 GCGTGAAGGCAGACAGACAGCGG - Intronic
1022517667 7:30986426-30986448 GAGAGCAAGAAGACGGACGGAGG + Intronic
1023848618 7:44138413-44138435 GGGTGCGAGCAGTGGGCCAGGGG + Intergenic
1024394411 7:48849199-48849221 GGGGGCAAGCATTGGGACAGTGG - Intergenic
1024400852 7:48923442-48923464 GGGGGCAAGCATTGGGACAGTGG + Intergenic
1025071978 7:55907650-55907672 GGGTGCATGTAGACATACAGAGG - Intronic
1025904670 7:65774847-65774869 AGGTGCACCCAGAGGGACAGAGG - Intergenic
1025914423 7:65854309-65854331 TAGTGCCAGCAGACGGAGAGGGG - Intergenic
1027892989 7:84001292-84001314 GGGTGGAAGCAGCAGGACATGGG - Intronic
1029150529 7:98477321-98477343 GGGTGCAAAGGGAGGGACAGAGG - Intergenic
1029968224 7:104762878-104762900 GGCAGCAAGCACATGGACAGAGG + Intronic
1030654199 7:112148280-112148302 GAGTGCTGGCAGAGGGACAGGGG + Intronic
1037743533 8:21626000-21626022 GGAGGCAGCCAGACGGACAGAGG + Intergenic
1039348213 8:36731692-36731714 GGGTGCAAACACATGGACACAGG + Intergenic
1040472087 8:47742338-47742360 GGGTGCAAGGAGGCTGGCAGAGG - Intergenic
1042399596 8:68330851-68330873 GGGCGCACGCGGGCGGACAGGGG - Exonic
1043510939 8:80949589-80949611 TTGTGCAGGCAGATGGACAGGGG + Intergenic
1048580167 8:135724052-135724074 GTGTGAAAGCAGAAGGACAATGG - Intergenic
1049761557 8:144334121-144334143 GGGCGGAGGCGGACGGACAGCGG + Intronic
1053302233 9:36960442-36960464 GTGAGCAAGCAGAGGGACATGGG + Intronic
1053351301 9:37415025-37415047 GGGTGTAAGGAGGCGGAGAGCGG - Intergenic
1057195638 9:93114561-93114583 GGGTGCACACAGATGGACAGGGG - Intergenic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1059443671 9:114325019-114325041 GGGAGCAAGGAGACTGACTGGGG - Intronic
1059444871 9:114331796-114331818 GGGAGCAAGGAGACTGACTGGGG - Intronic
1061597078 9:131637960-131637982 GGCTGCAGGCAGCAGGACAGTGG - Intronic
1061819689 9:133220122-133220144 GGGTGAGAGCAGACGGGCATAGG + Intergenic
1062380253 9:136283674-136283696 GGGTGCAGCCAGAGGGGCAGAGG - Intronic
1203747944 Un_GL000218v1:53985-54007 GGTTGCCAGGAGGCGGACAGGGG - Intergenic
1203561782 Un_KI270744v1:63988-64010 GGTTGCCAGGAGGCGGACAGGGG + Intergenic
1187118314 X:16376279-16376301 GGCTGCAAGCAGACACTCAGGGG - Intergenic
1190057002 X:47186872-47186894 GGACCCAAGCAGATGGACAGGGG + Intergenic
1191586266 X:62829772-62829794 GGGTCTAAGCAGATGGGCAGGGG + Intergenic
1191683996 X:63870156-63870178 AGATGCAAGCAGAGGGAGAGCGG - Intergenic
1196465636 X:115969125-115969147 GGGTGGAAGCTGAAGGTCAGAGG + Intergenic
1197079289 X:122393307-122393329 GGGTGCCAGCAGGCAGAGAGGGG + Intergenic
1198962387 X:142195983-142196005 GGCTGCAGGCACAGGGACAGGGG + Intergenic
1201161289 Y:11168979-11169001 GGTTGCCAGGAGGCGGACAGGGG - Intergenic