ID: 948119119

View in Genome Browser
Species Human (GRCh38)
Location 2:235515810-235515832
Sequence AATTAAACACGCACAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948119119 Original CRISPR AATTAAACACGCACAGAGCT GGG Intronic
905263995 1:36738715-36738737 AAGTTAACACGCAGAGAGCAGGG - Intergenic
907310523 1:53536467-53536489 AATGAAACACACACAGCACTTGG - Intronic
911631741 1:100191476-100191498 AATTTAACACGAACTGAGGTGGG + Exonic
911736220 1:101339161-101339183 AGTTTAACACACACAGAGCCAGG - Intergenic
915687745 1:157652198-157652220 AATTAAACAAGTAAAGAGATTGG - Intergenic
916325594 1:163556346-163556368 ACTTAACCACACACAGAGCCAGG - Intergenic
919851317 1:201674877-201674899 AAATACACACACACATAGCTGGG + Intronic
920937324 1:210447744-210447766 AATTATGCACTCAGAGAGCTTGG - Intronic
922475399 1:225903847-225903869 AAGTTAACACGCAAAGATCTGGG - Intronic
1065602360 10:27382639-27382661 AATGAAACACGCTTAAAGCTTGG - Intergenic
1066646112 10:37611140-37611162 AATTTAACACACAAAGTGCTAGG - Intergenic
1068107427 10:52636550-52636572 AAATAACAACGCACAGATCTGGG - Intergenic
1069289302 10:66757589-66757611 AATTAGAGAAGCAGAGAGCTGGG - Intronic
1070840929 10:79487448-79487470 AATTAAACATGCAGAGTCCTGGG + Intergenic
1071266649 10:83970588-83970610 AATCAAACACCCACAGATTTGGG - Intergenic
1072527620 10:96287530-96287552 AACTGAACACGCAAAGAGCCTGG + Intergenic
1074006975 10:109436531-109436553 AATGAAATGAGCACAGAGCTTGG - Intergenic
1075316652 10:121458659-121458681 AATGAAAACCGCATAGAGCTGGG - Intergenic
1076609458 10:131712254-131712276 AATTAAAACCACACAGATCTCGG - Intergenic
1076885970 10:133262574-133262596 GCTTAAACACACACAAAGCTGGG + Exonic
1081805454 11:45887546-45887568 GACTAAACACGCACAGACCTGGG - Intronic
1084774915 11:71368858-71368880 ATCTAAACACCCCCAGAGCTGGG + Intergenic
1085982452 11:81741484-81741506 AACTAAAAAGGCACGGAGCTGGG + Intergenic
1087174141 11:95080703-95080725 AAGTTTACAAGCACAGAGCTGGG - Intergenic
1087741519 11:101892772-101892794 AATGAAACAAACATAGAGCTTGG - Intronic
1090831579 11:130424386-130424408 AATTGAACACGCTCAGAGAGTGG + Intronic
1091934006 12:4420784-4420806 AATAATACACGCAAAGTGCTTGG - Intergenic
1092784506 12:12015282-12015304 AAATAAACAGGCAGACAGCTCGG - Intergenic
1094163775 12:27421077-27421099 ACTTAGGCAAGCACAGAGCTGGG + Intronic
1094563247 12:31575803-31575825 AATTAACCAGGCACATAGCAGGG + Intronic
1094825021 12:34263315-34263337 AATTAGCCAGGCACAGAGGTGGG - Intergenic
1099016965 12:77354962-77354984 CATTAAACAAGCACTGAGCTAGG + Intergenic
1101308936 12:103558480-103558502 AAGTAGACACACACAGAGCCAGG - Intergenic
1102030524 12:109737679-109737701 GATTAAACTGGCACAGGGCTTGG - Intronic
1105289527 13:19041991-19042013 AAACAAACACACACACAGCTGGG - Intergenic
1107071412 13:36273911-36273933 GAATGAACACGCACAGAGCTGGG - Intronic
1108200528 13:48038592-48038614 AAGTATACATGCAAAGAGCTTGG - Intronic
1110123490 13:71912385-71912407 AATTAACCAAGCAAAGAGGTGGG - Intergenic
1112030617 13:95453385-95453407 AAATAAACAAGCACAGAGGCTGG + Intronic
1112112106 13:96312801-96312823 AATTAACCAGGCACAGTGGTGGG + Intronic
1113184394 13:107670973-107670995 AATTAAAAATCAACAGAGCTGGG - Intronic
1113748396 13:112762002-112762024 ACTCAAACACCCACAGGGCTAGG - Intronic
1119512904 14:75225798-75225820 AACAAGACACGCACAGGGCTGGG + Intergenic
1121960374 14:98253903-98253925 GATTAAAGACCCACAGAACTGGG - Intergenic
1122175519 14:99915538-99915560 GATAATACACGCACAGTGCTTGG - Intronic
1123678089 15:22733022-22733044 AATAAAATATGCACAGAGCTTGG - Intergenic
1124330287 15:28807289-28807311 AATAAAATATGCACAGAGCTTGG - Intergenic
1126866954 15:52947279-52947301 AATTAAGCACACAAATAGCTTGG - Intergenic
1128780196 15:70354153-70354175 CATTAAACACAAACAAAGCTGGG - Intergenic
1130831475 15:87605542-87605564 ACTTAAACACACACAGTTCTTGG + Intergenic
1133070574 16:3244087-3244109 AATGAGTCACGCACAGAGCCTGG + Intronic
1133399811 16:5477395-5477417 AATCAAATACCCAAAGAGCTAGG + Intergenic
1133866009 16:9644055-9644077 AAATAAAGAGGCACAGAGGTCGG + Intergenic
1135135021 16:19881046-19881068 TATTAAATATGCACAGGGCTCGG - Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1136033277 16:27519039-27519061 CTTTAAGCACGCACAGAGTTTGG + Intronic
1138329851 16:56204801-56204823 AGCTAAACAGGAACAGAGCTGGG - Intronic
1144106388 17:11990113-11990135 AACCATACACCCACAGAGCTAGG + Intronic
1146372142 17:32271640-32271662 CATTAAACATTCACAGATCTTGG - Intronic
1152157519 17:78644521-78644543 CATGAGACACGCACAGAGCAGGG + Intergenic
1152939271 17:83158740-83158762 CATTAAAAACGCAGAGAGATTGG - Intergenic
1153755718 18:8280839-8280861 ACTTCCACAGGCACAGAGCTGGG - Intronic
1154056789 18:11020535-11020557 AAATAAACACTCACAGCTCTTGG + Intronic
1159496380 18:69212760-69212782 TATGAACCAAGCACAGAGCTTGG - Intergenic
1159533117 18:69680609-69680631 AACTATACACACACAGAGATTGG + Intronic
1163396451 19:17065830-17065852 AAAAAAAAAAGCACAGAGCTTGG + Intronic
1166981324 19:46633969-46633991 ACTGAGGCACGCACAGAGCTTGG - Intergenic
926005607 2:9371457-9371479 ATTTAAGCAGGCACAGAGCTGGG - Intronic
927671918 2:25075553-25075575 TGTTAAACACACACAGAGCAAGG - Intronic
931325717 2:61220379-61220401 AAATAAACTGGCACACAGCTGGG - Exonic
933037242 2:77415602-77415624 AATTAAACAGGCAAATAGATGGG - Intronic
933306560 2:80607424-80607446 CATCAAGCACACACAGAGCTTGG - Intronic
939372376 2:141317818-141317840 AAATAACCCAGCACAGAGCTTGG + Intronic
940622979 2:156136982-156137004 AAATTAACACTCAAAGAGCTGGG + Intergenic
941826863 2:169908731-169908753 AATTTAATATTCACAGAGCTGGG - Intronic
943645798 2:190407613-190407635 AGTTAAACACGCAGAGAGTTGGG - Intergenic
943719906 2:191193014-191193036 AATTAGACAGGCATAGTGCTGGG - Intergenic
944926417 2:204469574-204469596 GATTAAACTCTCACAGAGGTTGG + Intergenic
948119119 2:235515810-235515832 AATTAAACACGCACAGAGCTGGG + Intronic
948970554 2:241422279-241422301 AATTAACCACGCACAGCGGTAGG + Intronic
1172277656 20:33688731-33688753 AGTTAAACCAGCACAGTGCTTGG - Intergenic
1172977919 20:38920280-38920302 AATAAAAGGCGCACAGAGCAAGG - Exonic
1173608584 20:44350123-44350145 AATTAACTAGGCACAGTGCTAGG + Intronic
1174400114 20:50271431-50271453 AATGAAGCACCCACTGAGCTGGG + Intergenic
1177111270 21:17032496-17032518 GGTTAAACATCCACAGAGCTAGG + Intergenic
1178111953 21:29377562-29377584 AATTAAAAATGCACAAAGTTAGG + Intronic
1183676825 22:39303696-39303718 AATTAGCCAGGCATAGAGCTGGG + Intergenic
949784727 3:7728401-7728423 AATTAATCAGGCATAGAGATCGG - Intronic
952488746 3:33844461-33844483 AATAAAATATGCACAGAGTTTGG - Intronic
952860915 3:37811584-37811606 AAACAAACAAGGACAGAGCTGGG - Intronic
955810698 3:62785350-62785372 AATGAAACTCTCACAGTGCTAGG - Intronic
956506628 3:69947429-69947451 AACTAAACACACACAGAGCAAGG + Intronic
957938224 3:86970776-86970798 AACTAAACAAGCACTGGGCTGGG + Intronic
959413676 3:106058202-106058224 AATTAAACACTCACAAAAATAGG - Intergenic
960756123 3:121015288-121015310 ACTTCAACATGCAAAGAGCTTGG + Intronic
963296652 3:143554245-143554267 AATTAAACAAGCACTGTTCTTGG - Intronic
970630829 4:17942566-17942588 AATTACAGAGGCACAGAGCTGGG + Intronic
975664687 4:76723405-76723427 AATTAACCATGCAAAGAGCTAGG - Intronic
977796752 4:101174899-101174921 ACTTGAACAGTCACAGAGCTGGG + Intronic
978673134 4:111275643-111275665 ACGTAGACATGCACAGAGCTTGG - Intergenic
980311155 4:131130387-131130409 AATTCATCAGGCACAGGGCTAGG + Intergenic
982732141 4:158967479-158967501 AACTAAACACGCACTCATCTGGG + Intronic
983015122 4:162604142-162604164 ACTTCATCACGCAAAGAGCTTGG + Intergenic
985657837 5:1141199-1141221 AAATAGACACTCACAGAGCAGGG - Intergenic
989307085 5:39970683-39970705 AATTAAACACACACACAACTAGG + Intergenic
989584145 5:43061447-43061469 AATTCAAAAGGCACAGGGCTGGG - Intergenic
990129395 5:52562086-52562108 AATAAAACATGCTAAGAGCTAGG + Intergenic
990571520 5:57083674-57083696 AATTAACCAGGCACAGTGGTGGG + Intergenic
991246945 5:64518729-64518751 AATTAAACACCCAAAGTGGTAGG + Intronic
993904606 5:93608978-93609000 AATTAACAACACACAGAGCTCGG + Intergenic
995391329 5:111643033-111643055 AAGTAAGCACGGAAAGAGCTTGG - Intergenic
995942029 5:117598280-117598302 AATTTAACATGCACAATGCTGGG + Intergenic
996591700 5:125155291-125155313 ACTAATACACACACAGAGCTAGG - Intergenic
996933535 5:128920573-128920595 AATGAAACAAGCACAGACTTAGG + Intronic
997282555 5:132657954-132657976 AATTAAACCCACCCAGATCTTGG + Intronic
998223743 5:140309713-140309735 AACCAAACATGCAAAGAGCTTGG + Intergenic
998379200 5:141711959-141711981 AATTAGACTGGCACAGAGCCTGG - Intergenic
999367109 5:151030301-151030323 AATTAAACACACACACAAATTGG + Exonic
999392523 5:151204434-151204456 AACTAAACACGTTCAGAGATAGG + Intronic
1002403095 5:179003835-179003857 AATAAAACACCCACATAGGTGGG - Intergenic
1003329394 6:5117173-5117195 GATTAAACAAGCACAGTGCCAGG + Intronic
1009317577 6:62240268-62240290 AATAAAACACCCACAGTGATGGG - Intronic
1009879033 6:69541853-69541875 AAATAATTAAGCACAGAGCTTGG + Intergenic
1010639058 6:78299896-78299918 AATTAATCAGGGACAGAGTTAGG - Intergenic
1012409708 6:98943036-98943058 AACTAAACAGGCACAGGGATGGG + Intronic
1013990071 6:116243365-116243387 AATTAAACTCACATAGAGCTCGG + Intronic
1014807804 6:125850576-125850598 AATTAAACTCACTCAGATCTGGG - Intronic
1019344638 7:523216-523238 AATTATACAAGGAAAGAGCTTGG - Intergenic
1021144633 7:17069871-17069893 AATGTAACAGGCACTGAGCTAGG + Intergenic
1021892975 7:25205194-25205216 AATTAAACACACACAGATAGAGG + Intergenic
1021934565 7:25616952-25616974 AATTTAGGAAGCACAGAGCTGGG - Intergenic
1022040180 7:26573692-26573714 AATTAAAAAGGGGCAGAGCTAGG + Intergenic
1022574349 7:31483097-31483119 ATTTAAACACTCTCAGAGCTTGG - Intergenic
1023343446 7:39247084-39247106 AAGCACCCACGCACAGAGCTTGG - Intronic
1024322235 7:48082947-48082969 TAGAAAACACGCAGAGAGCTAGG - Intergenic
1025827102 7:65019401-65019423 AATTAACCAGGCACAGTGGTGGG + Intergenic
1028838894 7:95404843-95404865 AATTAAACACAGACAAAACTGGG + Intergenic
1031244022 7:119283737-119283759 AGTTAAAAACACAGAGAGCTGGG - Intergenic
1034488313 7:151380064-151380086 ACTTAAGCACACACAGACCTCGG - Intronic
1035069790 7:156134983-156135005 ATTGAAACATGCACAGGGCTTGG - Intergenic
1036971782 8:13363411-13363433 AATTAAACAGGCATAATGCTAGG - Intronic
1038409608 8:27347943-27347965 GTTTAAACACCCACAGAGATGGG + Intronic
1040975027 8:53181351-53181373 AAAAATACACGCACAGAGATTGG - Intergenic
1041318604 8:56590704-56590726 AATTAAAGGCACAAAGAGCTTGG + Intergenic
1042951596 8:74205704-74205726 ATTAAAACACACACAAAGCTGGG - Intergenic
1047821139 8:128522172-128522194 AATTAAAACCCCAAAGAGCTTGG + Intergenic
1053048345 9:34938031-34938053 AATTCCACAGGCACAGAGCCCGG + Intergenic
1055715666 9:79115260-79115282 AAACACACACTCACAGAGCTGGG + Intergenic
1059044576 9:110852010-110852032 AAATAAACAGGTACTGAGCTGGG - Intergenic
1060990864 9:127848100-127848122 AATTACACCTGCACAGCGCTAGG + Intronic
1187237198 X:17478544-17478566 AAAGAAACAGGCACAGACCTTGG - Intronic
1188369444 X:29350533-29350555 AATTGAACATGCACAGATCTTGG - Intronic
1190250126 X:48716981-48717003 AAATATACTCACACAGAGCTTGG + Intergenic
1194861832 X:99008818-99008840 AAGTAGACATGAACAGAGCTTGG - Intergenic
1200355033 X:155539760-155539782 AATTAAACAAGAACATAGATAGG + Intronic