ID: 948120710

View in Genome Browser
Species Human (GRCh38)
Location 2:235528323-235528345
Sequence CTGAGTGCACAGATGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 797
Summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 719}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948120710_948120725 15 Left 948120710 2:235528323-235528345 CCATCCACCATCTGTGCACTCAG 0: 1
1: 0
2: 4
3: 73
4: 719
Right 948120725 2:235528361-235528383 CCCGCCCCCTCCCCTCCCACTGG 0: 1
1: 1
2: 14
3: 161
4: 1270
948120710_948120727 18 Left 948120710 2:235528323-235528345 CCATCCACCATCTGTGCACTCAG 0: 1
1: 0
2: 4
3: 73
4: 719
Right 948120727 2:235528364-235528386 GCCCCCTCCCCTCCCACTGGCGG 0: 1
1: 1
2: 3
3: 61
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948120710 Original CRISPR CTGAGTGCACAGATGGTGGA TGG (reversed) Intronic
900097120 1:944363-944385 CGGAGGGCAGAGGTGGTGGAAGG + Exonic
900823343 1:4907201-4907223 CTCTGTGCTCACATGGTGGAAGG + Intergenic
901291395 1:8126928-8126950 CTGTGTCCCCACATGGTGGAAGG - Intergenic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901451229 1:9338083-9338105 TTGAGTGCTCAGATGGGGGAGGG + Intronic
901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG + Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
902899753 1:19506778-19506800 CTGTGTCCCCACATGGTGGAAGG + Intergenic
904269093 1:29337499-29337521 ATGAGTACATAGATGGTGGCAGG - Intergenic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
904869877 1:33610005-33610027 CTGCGTCCTCACATGGTGGAAGG - Intronic
905105550 1:35561490-35561512 GTGAGTGCACATATGGTGTGTGG - Intronic
905272793 1:36797855-36797877 GTGAGTGCACGCCTGGTGGAGGG + Exonic
906118129 1:43368760-43368782 GTGAGTGCACGGACGGTGGGTGG - Intergenic
906697851 1:47836793-47836815 CTGTGTCCTCATATGGTGGAAGG - Intronic
906730042 1:48072932-48072954 CTGCGTCCTCACATGGTGGAAGG - Intergenic
907306250 1:53514651-53514673 CAGAGGGGACAGATGGTGGTGGG + Exonic
907485313 1:54774040-54774062 CTGCATGCTCACATGGTGGAAGG + Intergenic
907554880 1:55334981-55335003 CTCAGTGCACATGGGGTGGAGGG + Intergenic
907664346 1:56421248-56421270 ATAAATGCAAAGATGGTGGATGG - Intergenic
907810600 1:57865983-57866005 CTGTGTCCTCACATGGTGGAGGG + Intronic
907919763 1:58901673-58901695 ATGAGTGGACAGATGGATGATGG - Intergenic
908267361 1:62392585-62392607 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
908554632 1:65245552-65245574 CTGTGTCCTCACATGGTGGAAGG + Intergenic
908905684 1:69006194-69006216 CTGTGTCCTCACATGGTGGAAGG + Intergenic
908905853 1:69007932-69007954 CTGTGTCCTCACATGGTGGAAGG + Intergenic
909134607 1:71782219-71782241 CTGAGTCCTTACATGGTGGAAGG - Intronic
909167687 1:72249179-72249201 CTGTGTTCTCACATGGTGGAAGG - Intronic
909198327 1:72655776-72655798 CTGTGTTCTCACATGGTGGAAGG - Intergenic
909563227 1:77027516-77027538 TTCAGGGCAGAGATGGTGGAGGG + Intronic
911093254 1:94034708-94034730 CTGAGCTCACAGAGGTTGGAGGG - Intronic
911228533 1:95334434-95334456 CTGTGTTCTCATATGGTGGAAGG + Intergenic
911445161 1:97983578-97983600 CTGAGTGTACAGTAGGTAGATGG + Intergenic
912000371 1:104825756-104825778 CTGATTGCACTGATAGTGAATGG - Intergenic
912224016 1:107711311-107711333 CCGAGTGCAAAGATTTTGGAGGG + Intronic
912269708 1:108196721-108196743 CTGTGTCCTCACATGGTGGAAGG + Intronic
912720889 1:112019014-112019036 CTGTGTCCTCACATGGTGGAAGG - Intergenic
912908726 1:113734833-113734855 CTGTGTCCTCACATGGTGGAAGG - Intronic
912959378 1:114181546-114181568 CTGAGCCTACAGATGGGGGAGGG + Intergenic
913056103 1:115161241-115161263 CTGTGTCCTCATATGGTGGAAGG + Intergenic
913162921 1:116161668-116161690 CTGTGTCCTCACATGGTGGAAGG - Intergenic
914172399 1:145237606-145237628 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914297277 1:146340072-146340094 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914527044 1:148478609-148478631 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914639354 1:149588526-149588548 CTGTGTCCTCACATGGTGGAAGG - Intergenic
914751513 1:150538057-150538079 CTCAGTGGACAAAGGGTGGACGG - Intergenic
914944403 1:152051299-152051321 AGGAGTCCACAGGTGGTGGAAGG - Intergenic
915082724 1:153363063-153363085 CTGATTGAACAGGGGGTGGAGGG - Intergenic
915083894 1:153371326-153371348 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915168214 1:153960351-153960373 CTTAGGGCACAGGTGGTGGCTGG - Exonic
915590251 1:156866569-156866591 CTGAGGCCACAGCTGGGGGAAGG - Intronic
915647504 1:157284238-157284260 CTGCGTCCTCACATGGTGGAAGG + Intergenic
915647524 1:157284360-157284382 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915647530 1:157284390-157284412 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915663137 1:157420189-157420211 CTGTGTCCTCACATGGTGGAAGG - Intergenic
916030660 1:160875090-160875112 GGGAGTGCACAGACGGTGGTGGG - Intergenic
916671406 1:167024640-167024662 CTGTGTCCCCACATGGTGGAAGG - Intergenic
917685953 1:177416268-177416290 CTGTGTCCTCACATGGTGGAAGG - Intergenic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
919639752 1:200036417-200036439 GTGAGTGCTCAGAGGGAGGAGGG + Intronic
919794336 1:201312119-201312141 CTGCGTGCACACATGGAGGCAGG - Intronic
920975422 1:210781210-210781232 CTCAGTGTACAGAGTGTGGAAGG - Intronic
921334528 1:214072944-214072966 CTGAGTGGGCAGATCATGGATGG - Intergenic
921887093 1:220317982-220318004 CTGTGTCCTCACATGGTGGAAGG + Intergenic
922514181 1:226194688-226194710 CTGAGTCCTCACATGGTAGAAGG + Intergenic
922790877 1:228310262-228310284 ATGAATGGACAGATGATGGATGG - Intronic
922824636 1:228509128-228509150 CTGTGTCCTCACATGGTGGAAGG - Intergenic
922857541 1:228787988-228788010 CTGAGTGCACTGTGGGTAGATGG - Intergenic
922885711 1:229019007-229019029 CTGTGTCCTCACATGGTGGAAGG + Intergenic
922978116 1:229801909-229801931 CTGAGTCTCCACATGGTGGAAGG + Intergenic
922990886 1:229910164-229910186 CTGTTTCCACACATGGTGGAAGG - Intergenic
923091650 1:230745589-230745611 CTGTGTCCTCACATGGTGGAAGG + Intergenic
923094599 1:230764729-230764751 TCGAGTGAACGGATGGTGGATGG + Intronic
923114226 1:230919466-230919488 CTCAGTGCACATATGTTGGGAGG - Intronic
923394972 1:233552790-233552812 CTGTGTCCTCACATGGTGGAAGG - Intergenic
923426842 1:233879068-233879090 ATGAGTGCTCAGATGGAGGTGGG + Intergenic
923899717 1:238312394-238312416 CTGTGTCCTCACATGGTGGAAGG + Intergenic
924330461 1:242935971-242935993 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063010192 10:2014073-2014095 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1063023535 10:2154934-2154956 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1063168786 10:3487269-3487291 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1063563969 10:7155842-7155864 TTGAGTGCACAGCAGGTGGAAGG - Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1064105105 10:12494060-12494082 TTGAGTGCAGTGCTGGTGGAGGG + Intronic
1064185796 10:13161137-13161159 CTCACTGCACAGATGGTGAAGGG + Intergenic
1064286506 10:13996101-13996123 CTGTGTCCTCACATGGTGGAAGG + Intronic
1064548472 10:16475009-16475031 CTGTGTGTTCACATGGTGGAAGG + Intronic
1064801746 10:19082999-19083021 CTGTGTTCTCACATGGTGGAAGG + Intronic
1064856461 10:19773757-19773779 CTGTGTCCTCATATGGTGGAAGG + Intronic
1064934087 10:20660694-20660716 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG + Intergenic
1066184727 10:32998156-32998178 CTGTGTCCTCACATGGTGGAAGG + Intronic
1068174955 10:53446425-53446447 CTGAGTGCTCACATGGTGGAAGG + Intergenic
1069036992 10:63656032-63656054 CTGAGTCCTCACATGGTGGAAGG - Intergenic
1069376176 10:67795210-67795232 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1070532476 10:77349250-77349272 CTGTGTCCTCACATGGTGGAAGG - Intronic
1070762741 10:79034881-79034903 CTGAGTGCACAGGTGTGGGTGGG - Intergenic
1070789924 10:79182920-79182942 CTCACTGCTCAGATGGTGAAGGG - Intronic
1071200577 10:83217631-83217653 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1071598979 10:86947103-86947125 CTGGGTGCAGAGATGATGGGAGG + Intronic
1071860234 10:89664834-89664856 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1071884130 10:89931007-89931029 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1072434245 10:95400974-95400996 CAGATTGCACAGAGGGTTGAAGG + Intronic
1072751569 10:97984315-97984337 ATGACTGCTCAGATGGGGGAGGG - Intronic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1074480446 10:113815503-113815525 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1074625433 10:115178720-115178742 CTGTGTCCTCACATGGTGGAAGG - Intronic
1075619041 10:123912288-123912310 GTGAGTGTGCAGATGGTGGGCGG + Intronic
1075724954 10:124606374-124606396 CTGAGGGCACTGATGGGAGAGGG - Intronic
1076175479 10:128364679-128364701 GTGAGGGCACAGGAGGTGGAAGG - Intergenic
1076211068 10:128645398-128645420 CTGTGTCCACAAATGGTGGAAGG + Intergenic
1076784509 10:132743187-132743209 CTGAGTGCAGCGCTGGTGGGTGG - Intronic
1076784528 10:132743245-132743267 CTGAGTGCAGCGCTGGTGGGTGG - Intronic
1076784547 10:132743303-132743325 CTGAGTGCAGCGCTGGTGGGTGG - Intronic
1076784566 10:132743362-132743384 CTGAGTGCAGCGCTGGTGGGTGG - Intronic
1076784584 10:132743421-132743443 CTGAGTGCAGCGCTGGTGGGTGG - Intronic
1076832271 10:133001796-133001818 TTAAGTGCACGGATGGTGGATGG + Intergenic
1076845121 10:133066046-133066068 ATGGGTGGATAGATGGTGGATGG + Intergenic
1077977506 11:7263310-7263332 CTGTGTCCTCACATGGTGGAAGG + Intronic
1077980386 11:7294079-7294101 CTGTGTCCTCATATGGTGGAAGG + Intronic
1078406132 11:11071428-11071450 TGGGGTGCACAGAAGGTGGATGG + Intergenic
1078499017 11:11850884-11850906 CTGTGTCCTCACATGGTGGAAGG + Intronic
1078826785 11:14937546-14937568 CTGACTGTAGAGATGGGGGAGGG - Intronic
1079461107 11:20678708-20678730 CTGTGTCCTCAAATGGTGGAAGG + Intronic
1079519119 11:21303914-21303936 CTGCGTCCTCACATGGTGGAAGG + Intronic
1079551271 11:21701459-21701481 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1080195487 11:29603631-29603653 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1080294090 11:30705274-30705296 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1080492698 11:32783579-32783601 CTGTGTCCTCACATGGTGGAAGG + Intronic
1080792215 11:35531612-35531634 CTGAGTCCTCACATGGTGGAAGG + Intergenic
1081062670 11:38500018-38500040 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1082781387 11:57290225-57290247 GTGAGTGCACAGATGGTGAATGG + Intergenic
1082874778 11:57977325-57977347 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1084430218 11:69106796-69106818 CTGAGTGGGAAGATGGTGGAGGG - Intergenic
1084461892 11:69300847-69300869 ATGAATGCACGGATGATGGATGG + Intronic
1084857015 11:71995945-71995967 CTGAATGCAGAGAAGGTGGGAGG - Intronic
1084970863 11:72771391-72771413 CTGAGTCCAAAGATGGGGCAAGG - Intronic
1085122138 11:73974095-73974117 CTGACTCCACAGAGGGTGGGTGG - Intergenic
1085250242 11:75138681-75138703 CTGTGTCCTCACATGGTGGAAGG + Intronic
1085310058 11:75510798-75510820 CAGAGTGCACAGATGTTGCAAGG - Intronic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1085871825 11:80359116-80359138 CTGGGTCCTCACATGGTGGAAGG + Intergenic
1085923939 11:80991842-80991864 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1086640766 11:89152826-89152848 CTGAGTCCTCACATGGTGAAGGG + Intergenic
1086790429 11:91030733-91030755 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1087272279 11:96123725-96123747 CAGTGTGCACAGATGGGGAAGGG + Intronic
1087570443 11:99920694-99920716 CTGTGTACTCACATGGTGGAAGG + Intronic
1088400806 11:109421769-109421791 ATGTGTGCACCGATGGTAGATGG + Intergenic
1088823944 11:113477993-113478015 CTGTGTTCACACATGGTGGAAGG + Intergenic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091022087 11:132109362-132109384 CTGTGTCCTCACATGGTGGAAGG - Intronic
1091033526 11:132213168-132213190 CGGTGTGCACAGATGGATGAAGG + Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1091958260 12:4667108-4667130 CTGTGTGCTCACATGGTGGAAGG + Intronic
1092123364 12:6059595-6059617 CTGTGTCCTCACATGGTGGAAGG + Intronic
1092350707 12:7753512-7753534 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1092526428 12:9312716-9312738 CTGGGTGGACAGATGGGGGCTGG + Intergenic
1093010406 12:14101338-14101360 CTGAGTGCCCAAACTGTGGAAGG + Intergenic
1093909291 12:24727297-24727319 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1094512199 12:31103416-31103438 CTGGGTGGACAGATGGGGGCTGG + Intronic
1096005313 12:48165786-48165808 CTGTGTCCTCATATGGTGGAAGG - Intronic
1096159960 12:49367733-49367755 CGAAGTGCCCAGAGGGTGGAAGG + Intronic
1096753757 12:53781594-53781616 CTGACATCACAGATGGTGCAGGG + Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097905908 12:64919569-64919591 CTGTGTGCTCACACGGTGGAAGG + Intergenic
1098492264 12:71095344-71095366 CTGTGTCCTCACATGGTGGAAGG + Intronic
1100119570 12:91353193-91353215 CTGTGTTCTCAGATGGTGGAAGG + Intergenic
1100595814 12:96071084-96071106 GTGGGTGCACAGATGGTGACAGG - Intergenic
1100791777 12:98138083-98138105 CCAAGTGCACAGAAGGAGGAAGG - Intergenic
1100901931 12:99251019-99251041 CTGGGTCCTCACATGGTGGAGGG + Intronic
1101385017 12:104249217-104249239 CTGTGTCCTCACATGGTGGAAGG + Intronic
1101734569 12:107453455-107453477 CTGTGTTCTCACATGGTGGAAGG - Intronic
1101804573 12:108052180-108052202 CTGAGTGCCCAGCTGTTGGGGGG + Intergenic
1102414325 12:112747311-112747333 CTGTGTCCTCACATGGTGGAAGG - Intronic
1102907096 12:116685124-116685146 TAGAGTCCACAGGTGGTGGAGGG - Intergenic
1103966451 12:124642964-124642986 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1103980338 12:124732963-124732985 CTGAGTTCCCAGAAGGTGGTCGG + Intergenic
1104128778 12:125872799-125872821 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1104222081 12:126794879-126794901 CTTATTGAACAGATGATGGATGG - Intergenic
1104236363 12:126941752-126941774 CTGTGTCCTCACATGGTGGAGGG + Intergenic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104979233 12:132566202-132566224 CTGCGTCCTCACATGGTGGAAGG + Intronic
1106118337 13:26836780-26836802 CTGAGTGCACATGTTGTGGGAGG - Intergenic
1106223504 13:27767455-27767477 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1106696130 13:32175397-32175419 GTGAGTGCCCAGAGGGTGGAAGG - Intronic
1106738913 13:32618028-32618050 CTGTGTTCTCATATGGTGGAAGG + Intronic
1107300799 13:38963881-38963903 CTGTGTCCTCAGTTGGTGGAAGG - Intergenic
1107400823 13:40067311-40067333 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1107600127 13:42004617-42004639 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1107623060 13:42253311-42253333 CTGTGTCCGCACATGGTGGAAGG - Intronic
1107748853 13:43542896-43542918 CTGAGTTCTCACATGGTGGAAGG + Intronic
1108161466 13:47644724-47644746 CTGGGTCCTCATATGGTGGAAGG - Intergenic
1108498670 13:51048898-51048920 CTGAGTTAACAAATGGGGGAAGG + Intergenic
1109241010 13:59888251-59888273 CTGTGTTCTGAGATGGTGGAGGG - Intronic
1109478094 13:62911506-62911528 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1109752886 13:66719451-66719473 CTGAGTCCTCACATGGTGGAGGG - Intronic
1110486447 13:76050453-76050475 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1110685422 13:78367701-78367723 CTGAGGGCACAGCTGATAGAGGG + Intergenic
1110727290 13:78840033-78840055 CTGTGTCCACACATGGTAGAAGG + Intergenic
1111260563 13:85734377-85734399 CTGTGTCCTCACATGGTGGAGGG - Intergenic
1111407577 13:87829255-87829277 CTGATTGCACAAATGGTGTATGG + Intergenic
1111487306 13:88920454-88920476 TTGAGTTCTCACATGGTGGAAGG + Intergenic
1111608994 13:90578985-90579007 CTGTGTCCTCACATGGTGGAGGG + Intergenic
1111720301 13:91935423-91935445 CTGTGTCCTCACATGGTGGAAGG - Intronic
1112523745 13:100122874-100122896 CTGTGTCCTCACATGGTGGAAGG + Intronic
1112740991 13:102472484-102472506 AAGAGTGCAGGGATGGTGGACGG + Intergenic
1112764259 13:102724001-102724023 CTGTGTGCTCACACGGTGGAAGG - Intergenic
1112884031 13:104147007-104147029 CTGTGTGCTCACATGGTAGAAGG + Intergenic
1113501539 13:110779355-110779377 CTGTGTGCTCACATGGTGGAAGG + Intergenic
1113743256 13:112725353-112725375 CTGAGAGCAGAGAGAGTGGAGGG - Intronic
1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG + Intergenic
1115863649 14:37717972-37717994 CTGTGTCCTCACATGGTGGAAGG - Intronic
1115913540 14:38283640-38283662 CTGTGTCCTCAGGTGGTGGAAGG - Intergenic
1115965902 14:38887916-38887938 GAGACTGCACAGCTGGTGGAGGG - Intergenic
1116250685 14:42479219-42479241 CTGTGTCCACACGTGGTGGAAGG - Intergenic
1117157701 14:52957184-52957206 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1117514356 14:56485682-56485704 CTGAGTCCTCACATGGTGGAAGG - Intergenic
1118133545 14:62995714-62995736 CTGAGAGTAAAGATGGTGAAGGG - Intronic
1118401250 14:65381574-65381596 CTGAGAGCAAAGAAGGTAGAAGG - Intergenic
1119333941 14:73816697-73816719 TTGAGTACACAGATGGTGACTGG - Intergenic
1119547653 14:75484122-75484144 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1119739680 14:77006251-77006273 CTGACAGCAAAGCTGGTGGAAGG - Intergenic
1119911468 14:78353432-78353454 CTGTGTCCTCACATGGTGGAAGG + Intronic
1121069919 14:91009279-91009301 CTGTGTCCTCACATGGTGGAAGG - Intronic
1121418531 14:93796084-93796106 CTGAGTATACAGTTGGTGGTAGG - Intergenic
1121427303 14:93861625-93861647 CTGTGTTCTCACATGGTGGAGGG - Intergenic
1121545943 14:94763755-94763777 GTGAGTGGACAGCTGGTGGCTGG - Intergenic
1122484439 14:102069183-102069205 CTGAGTGCAGAGATGTAGTAGGG + Intergenic
1122495843 14:102154365-102154387 CTGTGTCCTCACATGGTGGAGGG + Intronic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1123024597 14:105418851-105418873 CTGCCTGCTCAGATGCTGGAGGG - Intronic
1123072259 14:105647595-105647617 CTGAGTGCACAGATGGGAGGAGG - Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1123704583 15:22941724-22941746 CTGTGTGCAAAGCTGGGGGAAGG - Intronic
1124159161 15:27253416-27253438 CTGAGTGGACAGCTTGGGGAGGG - Intronic
1124362071 15:29044972-29044994 CTGTGTCCACACATGGTGAAAGG + Intronic
1124395954 15:29301833-29301855 CTGTGTCCTCACATGGTGGAAGG - Intronic
1124572585 15:30878666-30878688 CTGTGTCCACACATGGTGGAAGG - Intergenic
1124682083 15:31740415-31740437 CTCAGTGAGCAGATGGTGGGGGG + Intronic
1125370042 15:38965596-38965618 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1125686856 15:41568647-41568669 CGGAATGCACAGGTGGGGGATGG - Intronic
1126358742 15:47823591-47823613 CTGAGACCTCACATGGTGGAAGG - Intergenic
1126541163 15:49825574-49825596 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1127093824 15:55493109-55493131 CTGTGTCCTCACATGGTGGAAGG - Intronic
1127251218 15:57240442-57240464 CTGATAACACTGATGGTGGATGG - Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128405470 15:67333051-67333073 CTGTGTCCTCACATGGTGGAGGG + Intronic
1128507687 15:68287772-68287794 CTGTGTCCTCACATGGTGGAAGG + Intronic
1128723894 15:69973775-69973797 CTGATTTCACAGATGGGGGCAGG - Intergenic
1129779439 15:78260418-78260440 CAGAGAGCACAGATGGATGAAGG - Intergenic
1130050113 15:80477343-80477365 CTGTGTCCTCACATGGTGGAAGG + Intronic
1130949810 15:88576897-88576919 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1131874689 15:96792273-96792295 CTGAGAGCACTGATGAGGGAGGG + Intergenic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1134104772 16:11477667-11477689 CTGTGTGCAGAGATGCTGGGTGG - Intronic
1135060101 16:19264071-19264093 CTGAGTCCCCACATGGTGGAAGG - Intronic
1135489757 16:22899194-22899216 ATGAGGGTGCAGATGGTGGAGGG + Intronic
1135507962 16:23055445-23055467 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1135845327 16:25913378-25913400 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1136567162 16:31077360-31077382 CCCAGTGCACAGATGCTGAATGG + Exonic
1137423419 16:48355359-48355381 CTGTGTCCTCATATGGTGGAAGG - Exonic
1137595156 16:49718732-49718754 CTGCGTCCTCACATGGTGGAAGG + Intronic
1138215770 16:55204010-55204032 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1138693212 16:58788174-58788196 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1138694348 16:58797860-58797882 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1138730001 16:59184098-59184120 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1138954382 16:61953093-61953115 CTGTGTCCCCACATGGTGGAAGG - Intronic
1139085775 16:63583916-63583938 CTCAGTGCAGAGATGTTGGGAGG + Intergenic
1139314526 16:66056928-66056950 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1140694027 16:77514076-77514098 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1141110073 16:81265208-81265230 ATGGGTGGACGGATGGTGGATGG - Intronic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1142144310 16:88486445-88486467 CTGAGTGCACAGTGGGTGCTGGG + Intronic
1142244718 16:88964783-88964805 CTGGATGGATAGATGGTGGATGG - Intronic
1142244740 16:88964889-88964911 ATAAGTGGATAGATGGTGGATGG - Intronic
1142960568 17:3549974-3549996 ATGAGTGGATAGATGATGGATGG + Intronic
1143007702 17:3847497-3847519 CTAAGGTCACACATGGTGGATGG - Intergenic
1144147932 17:12416182-12416204 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1144320973 17:14119441-14119463 CTGAGAGCAAAGATCGTGGCAGG - Intronic
1144597181 17:16580523-16580545 CTGATTTCACAAATGGCGGAGGG + Intergenic
1144770771 17:17758243-17758265 CTGAGTGCCCAGGTGGTGGCCGG - Intronic
1144836946 17:18161499-18161521 CTGGGTGGACAGCTGGTGGGAGG + Intronic
1144865111 17:18330610-18330632 CCAAAGGCACAGATGGTGGAAGG - Exonic
1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1145009565 17:19360113-19360135 CTGAGTGCAGTCTTGGTGGATGG + Intronic
1145837525 17:27965856-27965878 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1146296315 17:31653400-31653422 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1146303104 17:31706634-31706656 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1146625535 17:34432272-34432294 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1149436041 17:56634216-56634238 CTGTGTCTACACATGGTGGAAGG + Intergenic
1149442657 17:56688009-56688031 ATTAGTGGACAGAGGGTGGATGG + Intergenic
1149572709 17:57684997-57685019 CAGAGGACCCAGATGGTGGAAGG + Intergenic
1149666395 17:58367695-58367717 GTGACTGGACAGAGGGTGGAGGG + Intronic
1149852758 17:60050206-60050228 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1150608084 17:66711581-66711603 CTGAGAGCACAGCTGGTGTGTGG - Intronic
1151544830 17:74786376-74786398 CTTGGTGCACAGATGGGGCAGGG - Intronic
1151978659 17:77496799-77496821 CTGAGCGCACACAAGGTGGATGG + Intronic
1152092008 17:78252354-78252376 CAGAGTGTGCAGCTGGTGGATGG - Intergenic
1152311143 17:79550606-79550628 ATGAGTGGACAGATGATGGGTGG + Intergenic
1152372194 17:79895891-79895913 CTGAGTCCTCACTTGGTGGAAGG - Intergenic
1152446206 17:80345839-80345861 CTGTGTGATCATATGGTGGATGG + Exonic
1153100914 18:1468599-1468621 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1153841573 18:9012734-9012756 CTGCTTCCACACATGGTGGAAGG + Intergenic
1155254745 18:23985013-23985035 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1155369151 18:25079654-25079676 GTGAGCGCACAGATGGTGGGGGG + Intronic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG + Intergenic
1157416336 18:47506439-47506461 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1158620400 18:59027858-59027880 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1159270379 18:66141563-66141585 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1159463897 18:68754865-68754887 CTGCATGCTCACATGGTGGAAGG - Intronic
1159554109 18:69927169-69927191 CTGCGTCCTCATATGGTGGAAGG - Intronic
1159814508 18:73056086-73056108 CTGCTTCCACTGATGGTGGAGGG + Intergenic
1160226833 18:77018411-77018433 ATGAGTGGATAGATGGTGGGTGG - Intronic
1160570961 18:79817660-79817682 CTGAGGGCACAGTCAGTGGAGGG + Intergenic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1163479009 19:17543476-17543498 CTGGGTGCTCAGATGGTTGCTGG + Intronic
1163675165 19:18652067-18652089 CTGAGTGCAGAAATGCTGGTGGG + Intronic
1163809056 19:19419050-19419072 CTGAATTCAAGGATGGTGGAGGG - Intronic
1164709501 19:30345244-30345266 CTGAGTGCACTCATGCTGGGGGG - Intronic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1166156041 19:40911808-40911830 CTGCGTTCTCACATGGTGGAAGG + Intergenic
1166705089 19:44904033-44904055 CTGAGTGCAGAGATGGGGGCAGG + Intergenic
1168358090 19:55714793-55714815 CGGCGTCCACAGATGGTGGAAGG + Intronic
1168414308 19:56159028-56159050 ATGAATGTACAGATGATGGATGG - Intronic
1168414333 19:56159147-56159169 ATGAATGTACAGATGATGGATGG - Intronic
1168414362 19:56159300-56159322 ATGAATGTACAGATGATGGATGG - Intronic
924988875 2:294425-294447 CTGAGTCCTCACGTGGTGGAGGG + Intergenic
925016879 2:534697-534719 CTGTGTTCTCACATGGTGGAAGG + Intergenic
925483364 2:4301416-4301438 CTGTGTCCTCACATGGTGGAAGG - Intergenic
925676129 2:6362834-6362856 CTGAGTTCTCACATGGTGGAAGG + Intergenic
926452892 2:13027307-13027329 CTGTGTCCTCACATGGTGGAAGG + Intergenic
927311310 2:21634825-21634847 CTGTGTCCTCACATGGTGGAAGG - Intergenic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
927792352 2:26020245-26020267 CAGAGTCCTCAGATGCTGGAAGG - Intergenic
928257163 2:29732740-29732762 CTGTGTCCTCACATGGTGGAAGG - Intronic
928694017 2:33830421-33830443 CTGTGTCCTCACATGGTGGAAGG - Intergenic
929119874 2:38475910-38475932 ATGAGTATAAAGATGGTGGAGGG - Intergenic
929228114 2:39531623-39531645 CTGTGTCCTCACATGGTGGAAGG + Intergenic
929537399 2:42792389-42792411 GTGAGGGCGCAGATGGAGGAGGG + Intronic
930107175 2:47649474-47649496 CTGTGTCCTCACATGGTGGAGGG - Intergenic
930114383 2:47706415-47706437 CTGATTGCACAGAGCATGGATGG - Intronic
930253667 2:49064466-49064488 CTGAGTCCTCACATGGTGGAAGG - Intronic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930851748 2:55968477-55968499 CTGTGTCCTCACATGGTGGAGGG - Intergenic
931700017 2:64901917-64901939 CTGGGTGCACAGATGAGGGGAGG - Intergenic
931948871 2:67338765-67338787 CTGCTTGCACACATGGTAGAAGG + Intergenic
932326890 2:70869156-70869178 CTGAGTCATCACATGGTGGAGGG - Intergenic
932340522 2:70960349-70960371 ATGAGTGCAGGGATGGTGGTAGG - Intronic
932837679 2:75052257-75052279 CTAAGTCCTCAGATGGTGGAAGG - Intronic
933133887 2:78707359-78707381 CTGTGTCCTCACATGGTGGAGGG + Intergenic
933372953 2:81440513-81440535 CTGGGGGCACAGGTGGTGAATGG - Intergenic
933982398 2:87562410-87562432 CTGTGTCCTCACATGGTGGAGGG + Intergenic
934720249 2:96569541-96569563 CTGAATGAACTGATGGGGGATGG + Intergenic
934771136 2:96908193-96908215 CTGAGCACACAGAGTGTGGACGG + Intronic
934946416 2:98545733-98545755 CTGGGTGCTCAGGTGGTGAATGG - Intronic
935825826 2:106948265-106948287 CTGAGTCCTCAAATGGTGAAAGG + Intergenic
935899770 2:107778954-107778976 CTGAGTGCTCACATGCTGGAAGG - Intergenic
936346026 2:111675875-111675897 CTGTGTGCTCACGTGGTGGAAGG - Intergenic
936896372 2:117432506-117432528 CTGTGTCCTCAGATAGTGGAAGG + Intergenic
937088620 2:119189621-119189643 CTGTGTCCTCACATGGTGGAGGG - Intergenic
937282785 2:120731751-120731773 CTGAGTCCTCACATGGAGGAAGG - Intergenic
937448999 2:121984961-121984983 CTGTGTCCTCATATGGTGGAAGG + Intergenic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938303487 2:130231909-130231931 CGGAGGGCAGAGGTGGTGGAAGG - Intergenic
938453192 2:131442347-131442369 CGGAGGGCAGAGGTGGTGGAAGG + Intergenic
938556852 2:132432270-132432292 CTGTGTCCTCACATGGTGGAAGG + Intronic
938706282 2:133930477-133930499 CTGTGTCCTCATATGGTGGAAGG + Intergenic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
939826094 2:147017222-147017244 CTGTGTCCCCACATGGTGGAAGG + Intergenic
940008358 2:149030397-149030419 CTGTGTCCACACATGGTGGAAGG + Intergenic
940363706 2:152822412-152822434 CTGCGTCCTCACATGGTGGAAGG + Intergenic
940378569 2:152986963-152986985 CTGTGTCCAAAGGTGGTGGAGGG - Intergenic
940485795 2:154294086-154294108 CTGTGAGCACAGATGGCTGATGG + Intronic
940765248 2:157783264-157783286 CTAAGTACACAGATGCAGGAAGG + Intronic
940771617 2:157844869-157844891 CTGTGTTCTCACATGGTGGAAGG - Intronic
941709439 2:168696681-168696703 CTGTGTCCTCACATGGTGGAAGG + Intronic
942368865 2:175259074-175259096 CTGAGTGCACAGACCAGGGAGGG - Intergenic
943195627 2:184744485-184744507 CTGTGTCCTCACATGGTGGAAGG - Intronic
944167085 2:196734514-196734536 CTGTGTCCTCACATGGTGGAAGG - Intronic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
946113258 2:217438504-217438526 CTGTGTCCTCACATGGTGGAAGG - Intronic
946331533 2:219012018-219012040 CTGTGTCCTCACATGGTGGAGGG - Intronic
946972348 2:225108558-225108580 CTGTGTCCTCACATGGTGGAAGG + Intergenic
947361791 2:229352854-229352876 CTGTGTCCTCACATGGTGGAAGG - Intergenic
947556991 2:231101773-231101795 CTGAGGGCTCAGATGGTCGGTGG + Intronic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
947814594 2:233027881-233027903 CTGTGTCCTCACATGGTGGAGGG + Intergenic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948137572 2:235648218-235648240 CTGAGGGCACAGGAGGTGGAGGG - Intronic
948512470 2:238477948-238477970 CTGTGTCCTCACATGGTGGAAGG - Intergenic
948522903 2:238552243-238552265 CTGTGTCCTCACATGGTGGAAGG - Intergenic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
1169594574 20:7183280-7183302 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1169752341 20:9007118-9007140 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1169954641 20:11087730-11087752 CTGCTTGCACTCATGGTGGAAGG + Intergenic
1170382918 20:15781571-15781593 CTGTGTCCCCACATGGTGGAAGG + Intronic
1170796934 20:19556045-19556067 CTGTGTCCTCACATGGTGGAAGG + Intronic
1171336059 20:24386613-24386635 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1171428319 20:25062521-25062543 CTGAGTGCACAGGGAGTGGTTGG - Intergenic
1171726253 20:28623884-28623906 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1171790447 20:29518379-29518401 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1171857265 20:30358456-30358478 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1171902873 20:30873143-30873165 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1172669427 20:36624680-36624702 CTGTGAGCACAGATGGTGTTGGG + Intronic
1172822372 20:37748745-37748767 CTGCGTCCTCACATGGTGGAAGG + Intronic
1172822924 20:37754439-37754461 CTGACTCCACAGTGGGTGGATGG + Intronic
1173574586 20:44103943-44103965 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1174403278 20:50287771-50287793 CTGAGGCCACAGGTGGTGGTGGG - Intergenic
1174650420 20:52120107-52120129 CTGTGTCCACACATGGTGGAAGG - Intronic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175156285 20:56973674-56973696 CTGAGGCCACAAAAGGTGGAAGG - Intergenic
1175538917 20:59736140-59736162 CTCAGTCCTCAGATGATGGATGG - Intronic
1175552380 20:59825946-59825968 CTGTGTCCTCACATGGTGGAGGG - Intronic
1175630971 20:60536140-60536162 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1175649456 20:60705792-60705814 TTGAGTAAACGGATGGTGGATGG - Intergenic
1176258364 20:64165884-64165906 CTGAGTGCACAAAAGGTGGGAGG + Intronic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1177462329 21:21429286-21429308 CAGGGTGCACAGTTGGTGAATGG + Intronic
1177824078 21:26063113-26063135 TTAAGTACATAGATGGTGGATGG + Intronic
1177842984 21:26255401-26255423 CTGTGTCCACACATGGTGGCAGG + Intergenic
1178097013 21:29226793-29226815 CTGTGTCCTCACATGGTGGAAGG + Intronic
1178305140 21:31484941-31484963 CTGAGTCCTTACATGGTGGAAGG - Intronic
1178352762 21:31884639-31884661 CTGAGTCCTCATATGGTGGAAGG - Intronic
1178458293 21:32776586-32776608 CTGAGTCCTCACATGGTGGAAGG + Intergenic
1178462337 21:32814378-32814400 CTGAGTCCTTACATGGTGGAAGG + Intergenic
1178485213 21:33014992-33015014 CTGAATGCAATGATGGTGCAAGG - Intergenic
1179533933 21:42039318-42039340 CTGTGTCCCCACATGGTGGAGGG + Intergenic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1179935256 21:44599968-44599990 CTAAGTGCCCAGATGGAAGAGGG + Intronic
1180318953 22:11303461-11303483 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1180336263 22:11579113-11579135 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1181004073 22:20001377-20001399 CTGAGTCCTCCCATGGTGGAAGG - Intronic
1181341681 22:22185821-22185843 CTGCGAGCTCACATGGTGGAAGG - Intergenic
1182483485 22:30625344-30625366 CTGTGTTCTCACATGGTGGAAGG + Intronic
1182810480 22:33111916-33111938 CTGAGGGAACAGACAGTGGAAGG + Intergenic
1182931144 22:34175482-34175504 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1182955136 22:34417422-34417444 CTGAGTCCCCACATGGTGGAAGG + Intergenic
1183778514 22:39983703-39983725 CTGTGGGTACAGATGGTGGTGGG - Intergenic
1184145036 22:42604989-42605011 CTGAGTCCTGACATGGTGGAAGG - Intronic
1184186985 22:42871546-42871568 TTGAGCCCACAGAGGGTGGAGGG + Intronic
1184390133 22:44199070-44199092 ATGGGTGCATAGATGGTGGGTGG - Intronic
1184414668 22:44345394-44345416 ATGAGTGAACAGATGGTAGATGG + Intergenic
1184468344 22:44681952-44681974 CTGAGAGCACAGTGGCTGGAGGG + Intronic
1184669793 22:46006675-46006697 CTGCGTGCACAGATGAGGGCCGG - Intergenic
1184768617 22:46585666-46585688 TTCAGGGCACACATGGTGGAAGG + Intronic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
1184858411 22:47159204-47159226 CTGTGTGCATACATGGTGTATGG - Intronic
1185005075 22:48271056-48271078 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1185053573 22:48566353-48566375 ATGGGTGGACGGATGGTGGATGG + Intronic
949131572 3:508233-508255 CTGAATGCACAAAAGCTGGAAGG - Intergenic
949372717 3:3352957-3352979 CTGTGTCCTCACATGGTGGAAGG - Intergenic
949957077 3:9277967-9277989 CTGTGTCCTCACATGGTGGAAGG - Intronic
950896633 3:16457950-16457972 CTGTGTCCTCACATGGTGGAAGG - Intronic
952124794 3:30287798-30287820 CTGCATCCACACATGGTGGAAGG - Intergenic
952434323 3:33257114-33257136 CTGTGTCCTCACATGGTGGAAGG - Intergenic
952509820 3:34041834-34041856 CTGTGTCCTCACATGGTGGAAGG - Intergenic
952960293 3:38585091-38585113 GTGAGTGGACAGATGGTTGATGG + Intronic
953206706 3:40837682-40837704 CTGTGTTCTCATATGGTGGAAGG + Intergenic
954454896 3:50592536-50592558 ATGAGGGGACAGATGCTGGAGGG - Intergenic
954627258 3:52029255-52029277 CAGAGGGCAGAGCTGGTGGAAGG + Intergenic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955123160 3:56082309-56082331 CTGTGTTCTCACATGGTGGAAGG - Intronic
955515649 3:59724026-59724048 CTGTGTCCTCACATGGTGGAAGG + Intergenic
955525944 3:59819919-59819941 CTGTGTCCTCACATGGTGGAAGG - Intronic
955541440 3:59980692-59980714 CTGTGTCCTCACATGGTGGAAGG - Intronic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
956840064 3:73131118-73131140 CTGTGTCCTCAGATGATGGAAGG + Intergenic
956898179 3:73685122-73685144 ATGAGTGCTCAAATGTTGGAAGG - Intergenic
957463104 3:80548149-80548171 CTGAGTCTTCATATGGTGGAAGG + Intergenic
957791057 3:84941851-84941873 CTGTGTCCTCACATGGTGGAAGG + Intergenic
957982040 3:87523148-87523170 ATGAGTCCAGAGATGGTGGTGGG - Intergenic
958411703 3:93825195-93825217 CTGTGTCCTCACATGGTGGAAGG + Intergenic
958501847 3:94921002-94921024 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
958594205 3:96201124-96201146 CTGAGTGCTTAGATGGTAGTTGG - Intergenic
958836023 3:99146024-99146046 CTGTGTCCTCACATGGTGGAAGG - Intergenic
959770190 3:110085671-110085693 CTGTGTCCTCACATGGTGGAAGG - Intergenic
959910599 3:111759311-111759333 CTGTGTCCTCACATGGTGGAAGG + Intronic
960121594 3:113952805-113952827 CTGTGTCCTCACATGGTGGAAGG + Intronic
960989781 3:123303029-123303051 CTGGGTGCACAGGGGCTGGAAGG - Intronic
961251802 3:125513217-125513239 CTGTGTCCTCACATGGTGGAAGG - Intronic
961990000 3:131179124-131179146 CTGTGTCCTCACATGGTGGAAGG - Intronic
962301237 3:134244925-134244947 CTGTGTTCTCACATGGTGGAAGG - Intronic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
963059707 3:141215339-141215361 CTGCGTCCTCACATGGTGGAAGG + Intergenic
963071660 3:141309894-141309916 CTGTGTCCTCACATGGTGGAAGG - Intergenic
963262639 3:143208206-143208228 CTGTGTCCTCACATGGTGGAAGG + Intergenic
963645471 3:147908376-147908398 CTGTGTTCTCACATGGTGGAAGG - Intergenic
963989363 3:151635413-151635435 CTGTGTCCTCACATGGTGGAAGG + Intergenic
964340864 3:155707078-155707100 CTGTGTTCTCATATGGTGGAAGG - Intronic
964736243 3:159921604-159921626 CTGTGTCCACACATGGTGGAGGG + Intergenic
964885140 3:161473363-161473385 CTGTGTACTCACATGGTGGAAGG + Intergenic
965443457 3:168745607-168745629 CTGTGTCCTCACATGGTGGAAGG + Intergenic
965759869 3:172064189-172064211 CTGTGTCCTCACATGGTGGAGGG - Intronic
965968294 3:174523004-174523026 CTGTGTCCTCACATGGTGGAAGG - Intronic
966003834 3:174983598-174983620 CTGTGTCCTCACATGGTGGAAGG + Intronic
966008462 3:175047023-175047045 CTGTGTCCTCAGATGGTGGAAGG + Intronic
966702959 3:182876664-182876686 CTGTGTCCACACATGGTGGAAGG + Intronic
967887508 3:194343081-194343103 CTCTTTGCACAGTTGGTGGAGGG + Intronic
968179077 3:196577547-196577569 CTCAGAGCACTGATGGTGCAAGG + Exonic
968707218 4:2085374-2085396 TTGAGTGACTAGATGGTGGATGG - Intronic
969128456 4:4972208-4972230 CTGTGTCCACACAGGGTGGAAGG - Intergenic
971041671 4:22760187-22760209 CTATGTGCAGAGATGGGGGAGGG + Intergenic
971353885 4:25877050-25877072 CTGTGTCCTCACATGGTGGAAGG - Intronic
972297133 4:37750634-37750656 CTGTGTCCTCACATGGTGGAAGG - Intergenic
972452310 4:39214365-39214387 CTGTGTGCAGAGATGGGGGGCGG - Intronic
972718511 4:41673231-41673253 CTGAGTTCATTGATGATGGATGG + Intronic
972990449 4:44817199-44817221 CTGTGTCCTCACATGGTGGAAGG + Intergenic
973770934 4:54205813-54205835 CTGCGTCCTCACATGGTGGAAGG + Intronic
974439673 4:61899816-61899838 CTGAATCCTCACATGGTGGAAGG + Intronic
974610598 4:64210401-64210423 CTGTGTGCTCACATGGTGGAAGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975409026 4:74026181-74026203 CTGAGTTCTCACATGGTGGATGG - Intergenic
976513966 4:85943411-85943433 CTGTGCCCTCAGATGGTGGAAGG + Intronic
976764498 4:88585099-88585121 CTGTGTCCTCACATGGTGGAAGG + Intronic
976944065 4:90742509-90742531 CTGAGTGCTCACATGTTGGAAGG - Intronic
977959823 4:103072987-103073009 CTGTGTTCTCAGATGGTGGAAGG - Intronic
978285025 4:107066883-107066905 CTGTGTCCTCACATGGTGGAAGG - Intronic
978361238 4:107932457-107932479 CCGAGGTCACAGCTGGTGGAAGG - Intronic
978488081 4:109278945-109278967 CTGTGTTCACACATGGTGGAAGG + Intronic
978494967 4:109348807-109348829 CTTTGTGCTCACATGGTGGAAGG - Intergenic
978497119 4:109371591-109371613 CTGAGTGCTCACATTGTGGCTGG - Intergenic
978696567 4:111587184-111587206 CTGTGTCCTCACATGGTGGAAGG + Intergenic
979458309 4:120951379-120951401 CTGAGTCCTCAGACAGTGGAGGG + Intergenic
979560280 4:122094363-122094385 CTGAGTGTAGATATGTTGGAAGG + Intergenic
979665777 4:123309358-123309380 CTGTGTCCTCACATGGTGGAAGG + Intronic
979727090 4:123975052-123975074 CTGTGTCCTCACATGGTGGAAGG - Intergenic
980727066 4:136776542-136776564 CTGTGTCCTCACATGGTGGAAGG - Intergenic
981038740 4:140199914-140199936 CTGTGTTCTCACATGGTGGAAGG + Intergenic
981648661 4:147029682-147029704 GTGATTGCACAGATGGTGGGAGG - Intergenic
981863637 4:149387204-149387226 CTGAGTCCTCACATGATGGAAGG + Intergenic
981917585 4:150051683-150051705 CTGGGTCCTCACATGGTGGAAGG - Intergenic
982115333 4:152094235-152094257 CTGTGTCCTCACATGGTGGACGG - Intergenic
982203753 4:152981797-152981819 CTGTGTCCTCACATGGTGGAAGG - Intergenic
982709979 4:158748242-158748264 CTGTGTTCTCACATGGTGGAAGG - Intergenic
982718759 4:158837853-158837875 AAGGGAGCACAGATGGTGGAGGG + Intronic
982743202 4:159079337-159079359 CTGTGTCCTCACATGGTGGAAGG - Intergenic
983477064 4:168226425-168226447 CTGTGTTCTCACATGGTGGAAGG - Intronic
983669688 4:170221714-170221736 CTGCCTCCACACATGGTGGAAGG - Intergenic
984489026 4:180408838-180408860 CTGTGTTCTCACATGGTGGATGG - Intergenic
984523752 4:180831649-180831671 CTGAGTCCTCACTTGGTGGAGGG + Intergenic
984578925 4:181487499-181487521 CTGTGTTCTCACATGGTGGAAGG + Intergenic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
985099513 4:186444489-186444511 CTGAGTGGACAGCTGTAGGAGGG + Intronic
985434274 4:189913817-189913839 CTGTGTCCTCACATGGTGGAAGG - Intergenic
985548573 5:522005-522027 CAGAGTGCACAGTGGGTTGAGGG + Intronic
985752864 5:1692319-1692341 CGGAGTGCACAGGTGCTGGTAGG + Intergenic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
986471528 5:8081298-8081320 CAGAGTGCACAGAGTGTGCAGGG + Intergenic
986670664 5:10140166-10140188 CTGTGTCCTCACATGGTGGAAGG - Intergenic
987225269 5:15833283-15833305 CTGTGTCCTCACATGGTGGAAGG + Intronic
987302026 5:16605779-16605801 CTGTGTCCTCACATGGTGGAAGG + Intronic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
989289408 5:39745937-39745959 CTGTGTCCTCACATGGTGGAAGG + Intergenic
989382394 5:40822269-40822291 CTGTGTCCTCATATGGTGGAAGG + Intergenic
989980481 5:50637736-50637758 CTGTGTCCTCACATGGTGGAAGG - Intergenic
990055517 5:51572344-51572366 CTGTGTCCTCCGATGGTGGAAGG + Intergenic
990845220 5:60130044-60130066 CTGTGTCCTCACATGGTGGAAGG - Intronic
991558255 5:67920849-67920871 CTGTGTCCTCACATGGTGGAAGG - Intergenic
991929051 5:71733624-71733646 CTGTGTCCTCATATGGTGGAAGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992388037 5:76304701-76304723 CTGTGTCCTCACATGGTGGAAGG + Intronic
992573981 5:78092135-78092157 TTGAAAGGACAGATGGTGGACGG - Intronic
992747333 5:79832688-79832710 CTGAGTACTCACATGGTGGAGGG + Intergenic
992943481 5:81786401-81786423 CTGTGTCCTCACATGGTGGAAGG + Intergenic
993281706 5:85933455-85933477 CTGTGTCCTCACATGGTGGAAGG - Intergenic
993575378 5:89592924-89592946 CTGTGTCCGCACATGGTGGAAGG + Intergenic
993881439 5:93366485-93366507 AGGAATGCAAAGATGGTGGAAGG - Intergenic
994047713 5:95328358-95328380 CTGTGTCCTCACATGGTGGAAGG - Intergenic
994682816 5:102910380-102910402 CTGAAAGCACAGAGGTTGGAGGG - Intronic
994899820 5:105757562-105757584 CTGAGTGCTCAGATGATTGTTGG - Intergenic
995482245 5:112604871-112604893 CTGAATTCAGAAATGGTGGAGGG + Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996178303 5:120387367-120387389 CTGTGTCCTCACATGGTGGAAGG + Intergenic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
996214022 5:120845879-120845901 CTGTGTCCTCACATGGTGGAAGG - Intergenic
996231924 5:121075202-121075224 CTGTGTGCTCACATGGTAGAAGG + Intergenic
996306709 5:122055202-122055224 CTGAGTCCTCACATGGTGGAAGG + Intronic
996331271 5:122331680-122331702 CTGTGTCCTCACATGGTGGAAGG + Intronic
996589409 5:125129285-125129307 CTGTGTTCTCACATGGTGGAAGG + Intergenic
997089309 5:130838493-130838515 CTGAATCCTCAAATGGTGGAAGG + Intergenic
997409368 5:133679448-133679470 CTGAGTCCTCAGATGCTTGAGGG - Intergenic
997849258 5:137316160-137316182 CTGTGTGCTCACATGGTGGAAGG + Intronic
999071797 5:148750812-148750834 CAGAGTGCAGAGATGGGGAAAGG + Intergenic
999886680 5:155931954-155931976 CTGTGTGCTCACATGGTAGAAGG + Intronic
1000259042 5:159568392-159568414 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1000284083 5:159811528-159811550 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1000701467 5:164456616-164456638 CTGTGTTCGCACATGGTGGAAGG - Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001446854 5:171792004-171792026 CTGTGTCCTCACATGGTGGAAGG - Intronic
1001566591 5:172703485-172703507 CTGAGTCCACACGTGGTGCAAGG + Intergenic
1001744247 5:174078748-174078770 CTGTGTCCTCACATGGTGGAAGG - Intronic
1002493936 5:179599268-179599290 CAGAGTGGGCAGCTGGTGGAGGG + Intronic
1003253743 6:4456591-4456613 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1003793177 6:9570097-9570119 ATGAGAGAAAAGATGGTGGAGGG - Intergenic
1003877037 6:10447073-10447095 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1003972588 6:11313354-11313376 CTGAGTAGATGGATGGTGGATGG + Intronic
1004190652 6:13460891-13460913 CTGTGTCCTCACATGGTGGAAGG - Intronic
1004224148 6:13770822-13770844 CAGAGCTCACAGATGGTGGCTGG - Intergenic
1004239945 6:13911917-13911939 CAAAATGCATAGATGGTGGAGGG + Intergenic
1006912404 6:37571934-37571956 CGGTGAGCACAGATGGTGCAAGG - Intergenic
1007470345 6:42086011-42086033 CTGTGTCCTCACATGGTGGAAGG - Intronic
1007514636 6:42401309-42401331 TTGAGAGCACGGATGGTGAAGGG - Intronic
1008560454 6:52719823-52719845 CTGAGTCCTCACATGGTAGAAGG - Intergenic
1008668232 6:53738752-53738774 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1009304803 6:62075282-62075304 CTGTGTCCTCACATGGTGGAGGG - Intronic
1009465252 6:63961171-63961193 CTTACTTCAAAGATGGTGGAAGG + Intronic
1009763131 6:68034818-68034840 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1010367595 6:75069850-75069872 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1010507656 6:76680204-76680226 CTGAGTCCTCACCTGGTGGAAGG - Intergenic
1010649474 6:78434565-78434587 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1010986967 6:82435703-82435725 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1011000352 6:82581770-82581792 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1011127355 6:84021438-84021460 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1011859605 6:91738264-91738286 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1012926617 6:105274267-105274289 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1014642160 6:123926010-123926032 CTGTGTCCTCACATGGTGGAAGG + Intronic
1014775911 6:125509632-125509654 CTGTGTGCTCACGTGGTGGAAGG - Intergenic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015169893 6:130240768-130240790 CTGAGTCCTCACATGGTGGAAGG - Intronic
1015684675 6:135846678-135846700 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1015985479 6:138880296-138880318 TGGAGTGCTCACATGGTGGAAGG + Intronic
1016353177 6:143189992-143190014 CTGTGTCCTCACATGGTGGAAGG + Intronic
1016923061 6:149315793-149315815 CTAAGTGCACTGCTGGTGCAAGG + Intronic
1017187486 6:151616803-151616825 CTGTGTCCTCACATGGTGGAAGG + Intronic
1017459419 6:154635188-154635210 CTGAGTCCTCACATGGTAGAAGG + Intergenic
1017595650 6:156025907-156025929 CTGTGTCCTCACATGGTGGAGGG - Intergenic
1017803865 6:157925953-157925975 CTGAGTCCCCACATGGTGGAAGG + Intronic
1017852345 6:158315790-158315812 CTGTGTCCTCACATGGTGGAAGG + Intronic
1018334791 6:162775135-162775157 CTGGGTCCCCACATGGTGGAAGG - Intronic
1018520576 6:164645662-164645684 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1018689617 6:166334145-166334167 ATGAGTGTACAGAGGCTGGAAGG - Intronic
1018785340 6:167103669-167103691 CTGTGTCCGCACATGGTGGAAGG - Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019505883 7:1390700-1390722 CAAAGTGCACGGATGCTGGATGG - Intergenic
1019692419 7:2423727-2423749 CTCAGTGTACAGAGGGTGGTGGG - Intronic
1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1020749289 7:12120168-12120190 CATAGTGAACAGATGGGGGATGG + Intergenic
1021863658 7:24932598-24932620 CTGTGTGCTCACAGGGTGGAAGG - Intronic
1022647614 7:32245794-32245816 CTGTGTCCTCACATGGTGGAAGG + Intronic
1023823344 7:43992265-43992287 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1023961391 7:44929592-44929614 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1027231105 7:76273001-76273023 CGGAGTGGACAGATGGGTGAAGG - Intronic
1027617649 7:80443650-80443672 CTGTGTCCTCACATGGTGGAAGG + Intronic
1027724678 7:81789104-81789126 CTGTGTGCTGACATGGTGGATGG - Intergenic
1028766770 7:94568802-94568824 CTGTGTCCACACATGGTGGAAGG - Intergenic
1029541141 7:101182792-101182814 CTGAGTGCTCAGAGGTTGCAGGG + Intergenic
1029604820 7:101592212-101592234 ATGAGTGGATGGATGGTGGATGG - Intergenic
1029751604 7:102545717-102545739 CTGTGTCCTCATATGGTGGAAGG + Intronic
1029769557 7:102644808-102644830 CTGTGTCCTCATATGGTGGAAGG + Intronic
1030099883 7:105936430-105936452 CTCTGTGCTCACATGGTGGAAGG - Intronic
1030271073 7:107668800-107668822 CTGCGTCCTCACATGGTGGAAGG + Intronic
1031213514 7:118860749-118860771 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1033478811 7:141717897-141717919 GTGAGTGCGCAGTTGGTAGAAGG + Intronic
1034362254 7:150510311-150510333 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1034402708 7:150876089-150876111 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1034530569 7:151693756-151693778 CTGCGTCCTCACATGGTGGAAGG - Intronic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034888930 7:154822353-154822375 CTGCGTCCTCACATGGTGGAAGG + Intronic
1034904618 7:154933247-154933269 ATGTGTGAACTGATGGTGGAGGG - Intronic
1037393749 8:18420686-18420708 CTGCTTCCACACATGGTGGAAGG - Intergenic
1037489989 8:19389019-19389041 TTGAGTGCTCAGATGGAGGTGGG + Intronic
1038358614 8:26854932-26854954 CTGTGTGCTCACTTGGTGGAAGG - Intronic
1038381268 8:27096598-27096620 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1040021398 8:42744545-42744567 CTGAGTCCTCACATGGTGGACGG + Intergenic
1041024356 8:53668777-53668799 CTGAGTCCTCACATGGCGGAAGG + Intergenic
1041884687 8:62794811-62794833 GTGAGTGCAGAGATAGTGAAGGG + Intronic
1042411409 8:68470739-68470761 CTGTGTCCTCACATGGTGGAAGG + Intronic
1042736744 8:71998176-71998198 CTGTGTTCTCACATGGTGGAAGG + Intronic
1042775884 8:72430808-72430830 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1042964324 8:74334560-74334582 ATGAGTGGATAGATGGTGGGTGG - Intronic
1043022429 8:75020500-75020522 CTGTGTCCTCACATGGTGGAGGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043749520 8:83917997-83918019 GGGATTGCAGAGATGGTGGAGGG - Intergenic
1046308617 8:112403589-112403611 CTGTGTCCTCACATGGTGGAAGG + Intronic
1046592322 8:116221198-116221220 CTGTGTCCCCATATGGTGGAAGG - Intergenic
1047206267 8:122804966-122804988 CTGAGTCTACAGCTGGGGGATGG - Intronic
1047432862 8:124807665-124807687 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1048332785 8:133482449-133482471 CCAAGTGCACAGATGGTGGGAGG + Intronic
1048355211 8:133648058-133648080 CTGCTTCCACTGATGGTGGAAGG - Intergenic
1048465552 8:134662147-134662169 CTGTGTCCTCACATGGTGGAAGG + Intronic
1048653010 8:136501609-136501631 CTGCGTCCACCCATGGTGGAAGG - Intergenic
1048732973 8:137464270-137464292 CTGAGAGTAAAGATGGTAGAAGG + Intergenic
1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG + Intronic
1049050683 8:140192550-140192572 CTGACTGCACAGCTGGTGCGAGG - Intronic
1049364217 8:142228927-142228949 ATGTGTGAACAGATTGTGGATGG + Intronic
1049474729 8:142791489-142791511 ATGAGTGGGCAGATGGTAGATGG - Intergenic
1050529530 9:6576306-6576328 CTGTGTCCTCACATGGTGGAAGG + Intronic
1051062758 9:13064099-13064121 CTGAGTGAACAGATGGTGTAGGG + Intergenic
1051352041 9:16206085-16206107 CTGAGTCCTCACATGGCGGAAGG + Intronic
1051508238 9:17848384-17848406 CTGAATTCTCAGATTGTGGAAGG - Intergenic
1051737377 9:20215162-20215184 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1052305150 9:27000131-27000153 CAGAGTGCAAGGATGGTGAATGG - Intronic
1052378735 9:27746145-27746167 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1052449503 9:28610563-28610585 CTGTGTTCACAGGTAGTGGAAGG - Intronic
1052528127 9:29647759-29647781 CTGTGTCCTCAGATGATGGAAGG - Intergenic
1053442808 9:38129901-38129923 ATGAGTGTAGTGATGGTGGAGGG + Intergenic
1053723363 9:40971979-40972001 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1054702233 9:68424399-68424421 CTGTGTCCTCACATGGTGGAAGG + Intronic
1055618210 9:78095112-78095134 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056834805 9:89945619-89945641 ATGAGTGCACAGGAAGTGGAGGG + Intergenic
1057043219 9:91862707-91862729 CTGTGTCCTCACATGGTGGAGGG - Intronic
1057202746 9:93151490-93151512 CTGAGTGCAGGGATGGGTGATGG - Intergenic
1057673306 9:97114895-97114917 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1058560844 9:106227269-106227291 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1058663202 9:107284042-107284064 ATGGGTGCACAGGTGGGGGAGGG + Intronic
1058737376 9:107906262-107906284 CTGAGTTCCCAGTTGGTGGCTGG - Intergenic
1058890737 9:109358517-109358539 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1058983179 9:110188864-110188886 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1059465147 9:114464452-114464474 CTGTGTCCTCACATGGTGGAAGG + Intronic
1059726285 9:117011391-117011413 CTGTGTTCTCACATGGTGGAAGG - Intronic
1060217489 9:121747010-121747032 CTGAGTGGAGAGATGGGGGAGGG + Intronic
1061402584 9:130376475-130376497 CTGAGAGCAGAGCTGGGGGATGG - Intronic
1062028861 9:134353008-134353030 CAGAGAGCACAGGTGGTGGGAGG - Intronic
1062092308 9:134684890-134684912 GTGAATGGATAGATGGTGGATGG - Intronic
1062172238 9:135141335-135141357 ATGAATGGACAGATGATGGATGG + Intergenic
1062172270 9:135141566-135141588 ATGAGTGGACAGATGGATGATGG + Intergenic
1062247967 9:135579329-135579351 ATGGGTGGATAGATGGTGGATGG - Intergenic
1203367178 Un_KI270442v1:269211-269233 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1185638903 X:1575471-1575493 ATGAATGAACAGATGATGGATGG + Intergenic
1185641253 X:1589682-1589704 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1185808302 X:3080661-3080683 CTGTGTCCTCACATGGTGGAAGG + Intronic
1185842601 X:3406530-3406552 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1185845321 X:3432496-3432518 CTGTGTCCCCACATGGTGGAAGG + Intergenic
1185869679 X:3653257-3653279 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185872258 X:3673897-3673919 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185876760 X:3708188-3708210 CTGTGTCCTCACATGGTGGAAGG - Intronic
1186027017 X:5324277-5324299 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1186029146 X:5347778-5347800 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186054869 X:5639407-5639429 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186057090 X:5661289-5661311 CTGTGTCCACACATAGTGGAAGG - Intergenic
1186066796 X:5775268-5775290 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1186117392 X:6319258-6319280 CTGTGTCTACACATGGTGGAAGG + Intergenic
1186170547 X:6872009-6872031 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1186178797 X:6952750-6952772 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186228984 X:7432099-7432121 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186281575 X:7998803-7998825 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186364411 X:8876014-8876036 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186408755 X:9327143-9327165 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186442746 X:9600301-9600323 CTGTGTTCTCACATGGTGGAAGG + Intronic
1186939770 X:14492946-14492968 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1186987056 X:15028489-15028511 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1187221761 X:17334095-17334117 CTGTGTACTCAGATGATGGAAGG + Intergenic
1187948364 X:24448225-24448247 CTGAATCCTCACATGGTGGAAGG + Intergenic
1188295349 X:28440758-28440780 CTGCTTCCACACATGGTGGAAGG - Intergenic
1188332126 X:28887247-28887269 CTGAGTTCTCACATGGCGGAAGG - Intronic
1188351816 X:29140777-29140799 CTGAGTCCTCACATGGTGGAAGG + Intronic
1188425567 X:30043278-30043300 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1188627589 X:32305749-32305771 GTGAGTGTCCAGATTGTGGAGGG - Intronic
1188760835 X:34027377-34027399 CTGTGTCTACACATGGTGGATGG - Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189554201 X:42125509-42125531 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1189560234 X:42184763-42184785 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1190073147 X:47295249-47295271 CTGTGTCCACATATGATGGAAGG - Intergenic
1190370326 X:49734129-49734151 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1190722287 X:53159678-53159700 CTGAGTGCAAAGATGGAGAGAGG - Intergenic
1190957418 X:55209064-55209086 CTAAGTGGGCAGATGGTGGGAGG + Intronic
1191885635 X:65885031-65885053 CTGCATCCTCAGATGGTGGAAGG - Intergenic
1192316242 X:70053936-70053958 TAGAGTGGAGAGATGGTGGAGGG - Intergenic
1193136951 X:77983008-77983030 CTGTGTCCTCACATGGTGGAAGG + Intronic
1193750758 X:85340264-85340286 CTAGGGGCACAGAAGGTGGATGG + Intronic
1195407730 X:104535157-104535179 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195676721 X:107512322-107512344 CTGAGGGCAGAGCTGGTGGGGGG + Intergenic
1195987617 X:110647312-110647334 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1196076740 X:111586080-111586102 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1196323218 X:114368813-114368835 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1196567229 X:117222411-117222433 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1197063796 X:122214848-122214870 CTGTGTTCTCACATGGTGGAAGG + Intergenic
1197787140 X:130210026-130210048 CTGCGTCCTCACATGGTGGAAGG - Intronic
1198308337 X:135404618-135404640 CTGAGTCCTCACATGGTGAAGGG + Intergenic
1198671778 X:139088914-139088936 CTGTGTCCTCACATGGTGGAAGG - Intronic
1198891844 X:141404996-141405018 CTGTGTCCTCACATGGTGGATGG - Intergenic
1200284826 X:154810615-154810637 CTGAATTCTCACATGGTGGAAGG + Intronic
1200788603 Y:7280222-7280244 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1200791646 Y:7304784-7304806 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1200842324 Y:7795392-7795414 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1202031839 Y:20583588-20583610 CTTAGTCCACACATAGTGGAAGG + Intronic