ID: 948121695

View in Genome Browser
Species Human (GRCh38)
Location 2:235535636-235535658
Sequence CTGGAGCTGGAGCGCGACGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948121695 Original CRISPR CTGGAGCTGGAGCGCGACGC GGG (reversed) Intronic
900120659 1:1047350-1047372 CTGGAGCTGGAGGGCGTCGAGGG + Exonic
900166704 1:1246867-1246889 CGGGGGCTGGAGCGGGACCCCGG - Intergenic
900633959 1:3652682-3652704 CGGGGGCTGGAGCGCAGCGCTGG + Intronic
902508569 1:16953428-16953450 CTGCAGCAGGAGCGCGACGAGGG + Exonic
904039413 1:27575553-27575575 CTGCAGCTGGAGAGCGCGGCCGG - Intronic
904684126 1:32248494-32248516 CTGGAGCTGGAGCTGGAGCCCGG + Exonic
904684129 1:32248500-32248522 CTGGAGCTGGAGCCCGGGGCCGG + Exonic
905029011 1:34869015-34869037 CTGGAGCTGGAGGGCCTGGCAGG - Exonic
905322722 1:37129385-37129407 CTGGAGCTGGAGCCTGTGGCGGG + Intergenic
905869593 1:41395417-41395439 CTGGAGCTGGAGAGCTCCCCGGG + Intergenic
906161131 1:43649939-43649961 CTCTAGCTGGATCGCGAAGCTGG - Intergenic
908195486 1:61742708-61742730 CCGGAGGTGGAGGGCGCCGCCGG + Intronic
912431986 1:109632842-109632864 CTGGAGCAGGAGGGGGAGGCTGG + Intergenic
912867033 1:113266914-113266936 CTGGAGCTGGAGCCAGGGGCAGG - Intergenic
916075578 1:161198326-161198348 CTAGAGCTGGAGCAGGACTCCGG - Exonic
916666957 1:166975426-166975448 CGGGGGCTGGATCGCGCCGCCGG + Intronic
918388645 1:184036569-184036591 CTGGAGCAGGAGCCCGGCACCGG + Intronic
920704986 1:208244237-208244259 CTGGAGCGGGAGGGCGGCGGAGG - Exonic
922477979 1:225920103-225920125 CTGCAGCTGAAGCCCGAGGCAGG - Exonic
922496660 1:226062746-226062768 CTGGCGTTGGAGAGCGACGGCGG - Intronic
922575744 1:226659643-226659665 CTGAAGCTGGAGGGAGATGCAGG + Intronic
922936524 1:229426963-229426985 CTGGAGCTGGGGAGAGAAGCAGG + Intergenic
923506553 1:234610019-234610041 GTGGAGCTCGGGCGCGGCGCGGG + Intergenic
1066954092 10:42149280-42149302 CTGGTGCTGGAGCCCAACCCTGG + Intergenic
1073812387 10:107164785-107164807 CGGGCGCTGGCGGGCGACGCGGG + Intergenic
1075667289 10:124240389-124240411 GTGGAGCTGGAGCCGGATGCAGG - Intergenic
1076501482 10:130939744-130939766 CTGGAGATGGAGGGTGAGGCTGG + Intergenic
1083227665 11:61294987-61295009 CGGCAGCAGGAGCGCGACACAGG + Exonic
1084057310 11:66643967-66643989 CTGGGGCTGTAGCGCGACGCAGG - Exonic
1084331555 11:68433417-68433439 CTGGAGGTGGAGCGGCACACAGG + Intronic
1084643950 11:70443460-70443482 CTGGAGCTGGACGGCGGCGACGG + Intergenic
1084646842 11:70463834-70463856 CGGGTCCTGGAGCGAGACGCCGG + Intergenic
1084899018 11:72295749-72295771 CTGGGGCTGGAGGGAGACACAGG - Intronic
1088742980 11:112781817-112781839 TTGAAGCTGGAGAGAGACGCAGG - Intergenic
1089577961 11:119460074-119460096 CTTGAGCTGGAGCTTGACGGAGG + Intergenic
1091698339 12:2643059-2643081 CAGGAGCTGCAGCCCCACGCTGG + Intronic
1092743066 12:11649073-11649095 CGGGCGCCCGAGCGCGACGCCGG - Intergenic
1096123873 12:49105839-49105861 CTGGAGCTGGAGGGAGAAGGGGG - Intronic
1096649250 12:53053824-53053846 CTGGAGCAGGAGGGGGAAGCAGG + Intronic
1097007899 12:55932060-55932082 CTGGAGCTGGAGCCCGAGCTGGG - Intronic
1104304744 12:127599626-127599648 CTAGAGCTGGAGCCGGAAGCCGG + Intergenic
1104602317 12:130162227-130162249 CCGGGGCTGGCGGGCGACGCGGG + Intergenic
1105290578 13:19050626-19050648 CTGGAGCTGGAGCTGGGGGCGGG - Intergenic
1107086408 13:36431856-36431878 CTGGCTCGGGAGAGCGACGCGGG - Intronic
1107722839 13:43267135-43267157 CTGGAGCTGCAGCTCGAGGAAGG - Intronic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1110553373 13:76831263-76831285 CTGGGGCTGGTGCCCGGCGCGGG - Intergenic
1113803075 13:113096455-113096477 CTGGTGCAGGAGGGCGACGAGGG + Exonic
1114453031 14:22838701-22838723 CTGGAGCTGGTGCAGGACTCTGG - Intronic
1119079157 14:71675715-71675737 CTGCAGCTGCAGCGAGAGGCAGG + Intronic
1120789222 14:88563477-88563499 CTGGAGCTGGAGTGGGGTGCGGG + Intronic
1122634312 14:103123081-103123103 CTGGAGCCGGTGTGTGACGCGGG + Intergenic
1123098386 14:105777089-105777111 GTGAAGCTGGAGCGAGAGGCTGG - Intergenic
1123107556 14:105849769-105849791 GTGAAGCTGGAGCGAGAGGCTGG + Intergenic
1124215648 15:27805625-27805647 GTGGGGCTGGAGCGGGCCGCTGG + Intronic
1125720998 15:41845111-41845133 CTGGAGCTGGGGCTCGGTGCTGG + Intronic
1126116792 15:45215448-45215470 CTGGCGTTGGAGAGCGACGGCGG - Intergenic
1128454099 15:67823136-67823158 CTCCAGCTAGAGCGGGACGCAGG + Intronic
1129388418 15:75208262-75208284 CTGGAGCTGGAGCTGGATCCCGG - Exonic
1129541114 15:76347384-76347406 CTCGAGCCGGAGCGCCGCGCTGG + Intergenic
1129635441 15:77311804-77311826 GTGGAGCTGGATAGCCACGCAGG + Intronic
1130637567 15:85639476-85639498 CTGGAGCTGCAGCCCCACTCTGG + Intronic
1132785420 16:1654573-1654595 CTGGAGCTGGACAGAGACGGTGG - Intronic
1135592291 16:23713131-23713153 CTGGAGCTGGAGCCCCAGCCGGG + Exonic
1136004003 16:27315831-27315853 CTGAATCTGGAGGGAGACGCTGG + Intronic
1137665330 16:50246182-50246204 GTGGAGCGGGAGCGCGCAGCAGG + Intronic
1138660197 16:58512129-58512151 CTGGTGCTGTAGGGCCACGCAGG + Exonic
1139961523 16:70720798-70720820 CTGGAGCTGGAGCTCAAGACTGG + Intronic
1141665482 16:85463232-85463254 ATGGGGCTGGAGGGCGAGGCTGG - Intergenic
1142556535 17:782126-782148 CAGGGGCTGGCGCGCGAGGCTGG - Intronic
1145293807 17:21572987-21573009 CTGGGGCTGGAGCTGGATGCAGG - Intronic
1145386172 17:22412996-22413018 CTGGGGCTGGAGCTGGATGCAGG + Intergenic
1146398539 17:32486910-32486932 CGGGAGCGGGAGCGCGGCGGCGG + Exonic
1148436551 17:47690220-47690242 CTGGAACTGGAGGGCGAAGGTGG + Intergenic
1151194662 17:72423055-72423077 CTGGAGATGGAGCCCGCTGCAGG + Intergenic
1151323669 17:73366141-73366163 CTGGGGCTGGAGCCGGAAGCAGG - Intronic
1151761226 17:76104270-76104292 CTGGAGCTGCAGTTGGACGCTGG - Intronic
1151964370 17:77423689-77423711 CTGCAGCAGGAACGCGACGGGGG - Intronic
1152138557 17:78522556-78522578 TTGGAGCTGAAGCCCAACGCAGG + Intronic
1152196466 17:78921298-78921320 CTGGAGCTGGAGCTCCTCGGGGG + Intronic
1157325288 18:46664531-46664553 CTGGAGCTGGAGCCCCACTCTGG - Intergenic
1160370377 18:78368267-78368289 CTGGAGCTGGAGTGAGGCGGGGG + Intergenic
1160491145 18:79337420-79337442 CTGGAGATGCTGCGCAACGCCGG + Exonic
1160699139 19:497749-497771 CCGGGGGTGGAGCGGGACGCAGG + Intronic
1160703647 19:519310-519332 CTGGCGCTGGACCGCGCCGTCGG + Exonic
1160777260 19:862010-862032 CTGCAGAGGGAGCGCGAAGCGGG + Intronic
1162044529 19:7989700-7989722 CTGGAGCAGGAGAGAGATGCTGG + Intronic
1162123041 19:8484132-8484154 CTGGCTCTGGAGCTCCACGCTGG + Intronic
1162345166 19:10114496-10114518 CTGGAGCTGGGGCCCTACGTGGG + Exonic
1163557581 19:18001345-18001367 CTGGAGCTGGCGCGGGGCCCGGG + Intronic
1168297364 19:55383943-55383965 CAGGAGCTGGAGCGCGACTACGG - Exonic
1168594473 19:57664346-57664368 GAGGAGCTGGGGCGCGGCGCGGG + Intergenic
925379351 2:3414490-3414512 CTGGAGCTGGAGCTAGAGGCTGG - Intronic
925971981 2:9112379-9112401 CTGGAGCTGGAGGGGAAGGCCGG - Intergenic
926430556 2:12780995-12781017 CTGGGGCTGGAAGGCGACTCTGG - Intergenic
927472663 2:23386765-23386787 CTGGGGCCGGAGCGCGGGGCTGG + Intronic
927936748 2:27080449-27080471 CTGGGGCTGGCGCGTGAGGCAGG - Intronic
930828726 2:55720112-55720134 CAGGAGCTGGAGTGTGAAGCTGG - Intergenic
931645006 2:64414226-64414248 CTGGGGCTGGAGCCTGACTCTGG + Intergenic
934754765 2:96817148-96817170 CTGGAGCTGGCGCGCGGCGGCGG + Exonic
939202341 2:139053532-139053554 CTGGAGCTGGAGCCCCACTTTGG + Intergenic
942319038 2:174719819-174719841 CTGGCGTTGGAGAGCGACGGCGG - Intergenic
945968975 2:216217874-216217896 GTGGAGCTGGAGCGGGAGGGAGG + Intergenic
948121695 2:235535636-235535658 CTGGAGCTGGAGCGCGACGCGGG - Intronic
948237213 2:236400213-236400235 CTGGAGCTGCAGCCTGACTCTGG + Intronic
948893129 2:240916552-240916574 CTGGAGCCGGAGGGGGGCGCGGG - Intergenic
948901966 2:240960659-240960681 CTGGTGCTGGAGCGAGCGGCTGG + Intronic
948920900 2:241065467-241065489 CTGGAGCTGGTGCGAGGAGCGGG - Exonic
1170698916 20:18685536-18685558 CTGAAGCTGGAGCGAGGCGCAGG - Intronic
1171480379 20:25451073-25451095 CTGCTGCTGGAGCACGAAGCAGG + Intronic
1172248979 20:33465695-33465717 CTGGAGCTGGAGCCAGATGGTGG - Intergenic
1173322382 20:41999400-41999422 CTGGAGCAGGTGCGCGGGGCCGG + Intergenic
1173631740 20:44521615-44521637 CTGGAGCTGGAGAGGGACCAAGG - Intronic
1174153586 20:48502770-48502792 CTGCAGCTGGAGCCCTAGGCAGG - Intergenic
1176027975 20:62995823-62995845 CTGGACATGGAGAGTGACGCTGG + Intergenic
1177894612 21:26844746-26844768 CCGGAGCTGGAGCGCGCCCCGGG - Exonic
1180077153 21:45468718-45468740 CTGGAGCTGGAGCCTGGCGCCGG + Exonic
1181025529 22:20125319-20125341 ATGGAGCTGAAGCCCAACGCAGG + Exonic
1181602107 22:23958814-23958836 CTGGAGATGGAGGGCGAGGCTGG - Intronic
1181606403 22:23982493-23982515 CTGGAGATGGAGGGCGAGGCTGG + Intronic
1184119157 22:42439104-42439126 CTGAGGCTGGAGAGAGACGCAGG + Intergenic
1184662656 22:45972444-45972466 CTGGGGCTGGAGTGCGGGGCGGG + Intronic
950668211 3:14509907-14509929 GTGGAGCTGAAGCGCTACGGGGG - Exonic
954693757 3:52409841-52409863 CTGGAGCTGGAGAGCGACCCAGG - Exonic
955246306 3:57227946-57227968 CGGGAGCTGGTGGGCGACGAGGG + Intronic
956438834 3:69260466-69260488 CTAGAATTCGAGCGCGACGCAGG - Intronic
963939679 3:151086267-151086289 CTGGAGGGGGCGCGAGACGCAGG - Intronic
976027024 4:80700564-80700586 CTGGAGCTCTAGTGCGACACTGG + Intronic
978781864 4:112564899-112564921 CTGGCGTTGGAGAGCGACGGCGG - Intronic
979289615 4:118965408-118965430 CTGGAGCTGGAGCTTGAAGGAGG - Intronic
980480872 4:133385481-133385503 CTGCAGCTGGAGGGCGCCGAAGG - Intergenic
980930411 4:139177921-139177943 TTCGGGCAGGAGCGCGACGCCGG + Intergenic
985462598 4:190121380-190121402 CCGGAGCGGGGGCGCGGCGCAGG - Intergenic
991587710 5:68216397-68216419 CTGCAGCTGGAGGGCCACGGGGG - Intronic
996458160 5:123708894-123708916 CTGGAGCTGGTGCACACCGCTGG + Intergenic
997569815 5:134917705-134917727 CTGGAGCTGCAGCGGGAGGGAGG + Intronic
999283227 5:150378810-150378832 CTGGAGCTGGAGCCCGAGTCTGG - Intronic
999383906 5:151140901-151140923 CTGGAGCTGGAGAGCAGAGCGGG - Intronic
1001577096 5:172771465-172771487 CTGGGCCTGGAGCGCGGCGCGGG - Intergenic
1001818928 5:174694499-174694521 CTGGAGTTGGAGCGTGACTTTGG + Intergenic
1002418724 5:179134722-179134744 CTGGAGCTGGAGCTGGAGCCGGG - Intronic
1002418729 5:179134741-179134763 CTGGAGCTGGAGCCGGGAGCTGG - Intronic
1002418827 5:179135013-179135035 CTGGAGCTGGAGCCGGGAGCTGG - Intronic
1002638968 5:180621618-180621640 CTCGTGCTCGGGCGCGACGCGGG + Exonic
1003139243 6:3457057-3457079 CAGGAGCTGGAGAGCGCGGCCGG - Intergenic
1003608350 6:7585729-7585751 CGGGAGCCGGAGCGGGACCCCGG - Exonic
1006808729 6:36806205-36806227 CTGGAGCTGGGGCGGGCAGCAGG - Intronic
1006929240 6:37677874-37677896 CAGGAGCTGGAGCTCTACCCAGG - Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1016982166 6:149863776-149863798 CTGGAGCTGGAGCTGCGCGCGGG - Exonic
1018960049 6:168441523-168441545 CTGGGCCTGGAGCGGGGCGCGGG - Intronic
1025233372 7:57217751-57217773 CTGGAGCTGGAGCCCTAGGCAGG + Intergenic
1025850526 7:65239866-65239888 CCGGTGCCGGAGCGGGACGCGGG - Intergenic
1026013395 7:66654249-66654271 CAGCAGCGGGAGAGCGACGCTGG - Intronic
1026017334 7:66681847-66681869 CAGCAGCGGGAGGGCGACGCCGG - Intronic
1026025374 7:66740416-66740438 CAACAGCTGGAGGGCGACGCTGG - Intronic
1026692406 7:72560876-72560898 CTGGAGCTGAAGGGCGATGTGGG - Intronic
1030067779 7:105673647-105673669 CTGGAGTTGGAGAGAGAGGCAGG + Intronic
1031483447 7:122304021-122304043 CTGCAGCGGCAGCGCGTCGCGGG + Exonic
1033282169 7:140014023-140014045 CTGGAGCTGGAGCAAGACCCAGG - Intronic
1035234674 7:157488562-157488584 CCGCTGCTGGAGCACGACGCTGG - Intergenic
1036105469 8:5833450-5833472 CTGGAGCTGGGGCTTGACACCGG - Intergenic
1038160342 8:25031232-25031254 CTGGAGCTGGAGCTGGACCCTGG + Intergenic
1039865742 8:41499823-41499845 CTGGAGGTGGAGCGCTAGCCAGG + Intronic
1060596873 9:124853763-124853785 CTGGAGCTGGGGCCCGGCACTGG - Intronic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1061900682 9:133670620-133670642 CTGGAGCAGCAGCGGGCCGCAGG - Exonic
1062131589 9:134897185-134897207 CTGGAGATGGAGTGGGAGGCAGG - Intergenic
1187365380 X:18661998-18662020 CTGGGGGTGGAGCCCGAGGCAGG + Intronic
1188064802 X:25645984-25646006 ATGGAGCTGAAGCCCAACGCAGG - Intergenic
1196763635 X:119223188-119223210 CTGCGGCTGGAGGGCGAGGCGGG + Intergenic
1197179025 X:123514381-123514403 CTGGCGTTGGAGAGCGACGGCGG - Intergenic
1198233392 X:134714569-134714591 CTGGAGATGGAGGGTGGCGCTGG - Intronic
1198410508 X:136362499-136362521 GTGGAGCTGGAGCACGACAGTGG - Intronic
1200129042 X:153831021-153831043 CTGGAGCCGGCGCGGGAAGCCGG + Intergenic