ID: 948123016

View in Genome Browser
Species Human (GRCh38)
Location 2:235544696-235544718
Sequence AAACCAATGCTGCCTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948123011_948123016 2 Left 948123011 2:235544671-235544693 CCTGCTGGATTGTAGATGGCCCC 0: 1
1: 0
2: 0
3: 16
4: 105
Right 948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG 0: 1
1: 1
2: 3
3: 13
4: 198
948123009_948123016 4 Left 948123009 2:235544669-235544691 CCCCTGCTGGATTGTAGATGGCC 0: 1
1: 0
2: 2
3: 32
4: 163
Right 948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG 0: 1
1: 1
2: 3
3: 13
4: 198
948123007_948123016 15 Left 948123007 2:235544658-235544680 CCTGCTGGGTACCCCTGCTGGAT 0: 1
1: 0
2: 1
3: 13
4: 204
Right 948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG 0: 1
1: 1
2: 3
3: 13
4: 198
948123010_948123016 3 Left 948123010 2:235544670-235544692 CCCTGCTGGATTGTAGATGGCCC 0: 1
1: 0
2: 1
3: 14
4: 132
Right 948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG 0: 1
1: 1
2: 3
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948123016 Original CRISPR AAACCAATGCTGCCTCTCAC AGG Intronic
902045882 1:13523998-13524020 AAACAAATGCTGCCCCTCCCAGG - Intergenic
902287606 1:15416656-15416678 AATCCTATTCTGCCCCTCACTGG - Intronic
902929109 1:19717798-19717820 AACCAAATGCTGCATCTCAAGGG - Intronic
903646952 1:24901734-24901756 GGGCCAATGCTGCCTCTCTCTGG + Exonic
912261039 1:108111766-108111788 ATAGCAATGGAGCCTCTCACTGG + Intergenic
912681929 1:111734263-111734285 ATTCCAATGCTGCCTCTTCCCGG + Intronic
915991366 1:160520413-160520435 ACACCAATGCTGCCTGTCCATGG - Intronic
916261626 1:162848031-162848053 AAACCAATGCTGCCCCCTAGTGG - Intronic
916530403 1:165651360-165651382 AAACCGATGTTGACTCTCCCAGG + Intronic
918428470 1:184434632-184434654 AACCCAGTGCTGCCACTCACAGG - Intronic
920033858 1:203053161-203053183 AAACCAAAGCCGTCTCTCTCTGG + Intronic
921314452 1:213877049-213877071 AAACAAATGCTGCCAGTCTCAGG - Intergenic
1067725041 10:48763532-48763554 AATCCACTGCGGCCTCTTACAGG + Intronic
1069363961 10:67676740-67676762 AAATCATTGTGGCCTCTCACTGG - Intronic
1071815899 10:89232566-89232588 AAACCATTCCTGCCTTTCTCTGG - Intronic
1071921164 10:90352102-90352124 AAACTACAGCTGCCCCTCACTGG - Intergenic
1071964305 10:90836433-90836455 ATAACAATGCTGCCTGTCAGTGG + Intronic
1074114836 10:110448010-110448032 AAACCAATGCAGCCACACATGGG + Intergenic
1074809943 10:117093857-117093879 AAACCAATGCTTTCTGTCAAGGG + Intronic
1077100206 11:819259-819281 AAACCAGAGCTCCCTCTCGCCGG + Intronic
1077291979 11:1801186-1801208 AAAACTATGCTGCCTGTCTCAGG + Intergenic
1079299937 11:19269034-19269056 AAACCAATGCTTCATTTCATTGG + Intergenic
1080067711 11:28038963-28038985 ATACCCCTGCTGCCTCTCATGGG - Intronic
1085488836 11:76894484-76894506 AATCCATTTCTGCCTCTTACTGG + Intronic
1086273831 11:85100212-85100234 AAATCTATGTTGCCTCTCAAAGG - Intronic
1086484274 11:87281643-87281665 AAACCTTTGCTGCCCCTCCCTGG + Intronic
1087296560 11:96382756-96382778 AAAACAATTTTGCCTCACACAGG - Intronic
1092764590 12:11841307-11841329 AACGCAATCCTGCCTCTAACTGG - Intronic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1093748826 12:22774932-22774954 AAACAATTGCTTTCTCTCACAGG + Intergenic
1094601326 12:31911555-31911577 AAAACAATGCTGCCTTTTAATGG - Intergenic
1096282236 12:50266119-50266141 AAACCAATTCTACTTCTCAAAGG + Intronic
1098536086 12:71595067-71595089 CATCCAATGCTGCCTGTGACTGG - Intergenic
1099011699 12:77298850-77298872 AAGCCAAAGTTGCCTCTCAAAGG - Intergenic
1103179484 12:118897438-118897460 ATGCCAATTCTGCCTCTCATAGG + Intergenic
1104958828 12:132478602-132478624 AGACCGATGGTGGCTCTCACTGG - Intergenic
1106118250 13:26835875-26835897 ACACCAATTCTGCCTCTTTCTGG + Intergenic
1107553083 13:41494877-41494899 ATACCAATGCTGCCTCCAATGGG + Intergenic
1108377943 13:49830521-49830543 AAACTAAAGCCGCCTTTCACAGG - Intergenic
1113135940 13:107089824-107089846 AAATCCATGGTGCCTGTCACAGG - Intergenic
1113832983 13:113311582-113311604 AGACCAACGCTGCCTCTCTGAGG + Intronic
1116019907 14:39447640-39447662 AAACCAGATCTCCCTCTCACTGG - Intergenic
1117646109 14:57854689-57854711 AGACCCATTCTGCCACTCACTGG + Intronic
1118142906 14:63104231-63104253 AAACCAATGACATCTCTCACTGG + Intergenic
1118333859 14:64835189-64835211 ATACCAAAGCTGCCTCTTGCAGG - Intronic
1118356258 14:65016426-65016448 GAGCCCATGCTGCCTCTCAGTGG - Intronic
1119863789 14:77956397-77956419 AAACAAGTGCTGCTTTTCACGGG + Intergenic
1123137053 14:106037845-106037867 AAACCCAGGCTGCTTCTCATTGG - Intergenic
1123207340 14:106726240-106726262 AAGTCAGTGCTGCCTCTCAGGGG - Intergenic
1123459773 15:20459383-20459405 AATCCAATGCCGACTCTCTCTGG + Intergenic
1123658289 15:22541037-22541059 AATCCAATGCCGACTCTCTCTGG - Intergenic
1124147766 15:27144330-27144352 AAACCCATGCTGCCTCTTCCAGG - Intronic
1124266003 15:28235220-28235242 AATCCAATGCCGACTCTCTCTGG + Intronic
1124312154 15:28635529-28635551 AATCCAATGCCGACTCTCTCTGG - Intergenic
1124454879 15:29832924-29832946 AAAGCTAGGCGGCCTCTCACAGG - Intronic
1124972809 15:34506326-34506348 AAAAAAATGCTGGATCTCACTGG - Intergenic
1129372800 15:75108721-75108743 AAACCACAGCTGCCTCTTGCTGG - Intronic
1130031395 15:80317742-80317764 AGACCAATGCTGCCGCTGTCTGG + Intergenic
1131376053 15:91924373-91924395 TAACCAATGCTGACTCGCAAAGG - Intronic
1132310518 15:100854205-100854227 AGCCCAAAGCTGCCTCTCGCTGG + Intergenic
1133229580 16:4360167-4360189 AAACCATTCCTGCCCCTCACTGG - Intronic
1134070851 16:11258813-11258835 AAACCAAAGCTGTCTGTCACTGG - Intronic
1134791985 16:16997406-16997428 AAATAAATCCTGCCTCGCACAGG + Intergenic
1136588584 16:31203028-31203050 AAACCTGGGCTGGCTCTCACTGG + Exonic
1140120435 16:72078890-72078912 AAACCTATTCTGCCTTTCAAGGG - Intronic
1140530112 16:75658310-75658332 AAACCAAAGCTGCAGCTCGCTGG - Intronic
1140590246 16:76343244-76343266 AAACCAATGAGGCCTTTCATCGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143373625 17:6455105-6455127 CAGCCACTGCTGCCTCCCACGGG - Exonic
1144622118 17:16824306-16824328 AAACCCCTGTTGCCTCTCTCTGG - Intergenic
1144671431 17:17134739-17134761 ACCCCCATGCTGCCCCTCACTGG + Intronic
1144884306 17:18448407-18448429 AAACCCCTGTTGCCTCTCTCTGG + Intergenic
1145147925 17:20495970-20495992 AAACCCCTGTTGCCTCTCTCTGG - Intergenic
1147574087 17:41588641-41588663 AAACCCCTGTTGCCTCTCTCTGG - Intergenic
1148635772 17:49148364-49148386 CAACCAAATCTGCCTCTTACTGG + Intronic
1150222577 17:63505440-63505462 ACACCAATGCTGCAGCTCTCTGG + Intronic
1151240603 17:72754731-72754753 AGACCAATGCTGACACACACAGG + Intronic
1153647408 18:7207553-7207575 AAACCCCTGCGGCCTCTAACAGG + Intergenic
1153735729 18:8065044-8065066 CAACCAATGCTCCCACTAACAGG - Intronic
1159462675 18:68740674-68740696 AACCCAGTGCTGCCTCGGACGGG + Intronic
1159475713 18:68918233-68918255 AAATGAATGCTGACTCTCAAAGG - Intronic
1160072450 18:75640503-75640525 CAACCACTGCTGCCTCTGATTGG + Intergenic
1160412998 18:78687685-78687707 AAAGCAATGTTGGCTCTCTCAGG - Intergenic
1162441932 19:10697950-10697972 CAGCCAATGTTGCCTCTCAGTGG - Intergenic
1164828402 19:31301305-31301327 AAACCAATGCTGCTGTTCACTGG - Intronic
1167730519 19:51250979-51251001 AAGCCCATGCAGCCTCTCATTGG + Intronic
924970316 2:120576-120598 AAGGCAATCCTGCCACTCACAGG + Intergenic
925147325 2:1589743-1589765 AACCTAATGATGCCTCTCTCAGG + Intergenic
925947263 2:8877235-8877257 AAGCTTATGCTGCATCTCACTGG - Intronic
929153999 2:38773263-38773285 AAACCAATCCTCCCTCTCTGAGG + Intronic
929357049 2:41038112-41038134 ATACCAATGCTGACTGTCAATGG + Intergenic
930543280 2:52734675-52734697 GAACCCCTGCTGCCTCTGACAGG - Intergenic
933042247 2:77484144-77484166 AAACAAATGCTGGCATTCACAGG + Intronic
933225813 2:79748208-79748230 AAATCAATGCAGGCTCTCATTGG - Intronic
933530265 2:83500881-83500903 AAATCAATGAAGCCTCTCTCAGG + Intergenic
934758977 2:96843087-96843109 ACACCCATGCTTCCTCCCACCGG + Intronic
934919101 2:98327938-98327960 AAACCACTGCTGCCCTTCAGGGG + Intergenic
934998021 2:98984128-98984150 AAAGCAATGCTATCTCACACAGG - Intergenic
935581424 2:104758915-104758937 AAACCAAGGCTGGCTGTCAGAGG - Intergenic
937578151 2:123449680-123449702 AAACAAAGGCTGCCTATGACTGG + Intergenic
937771433 2:125724850-125724872 ACTCCAATTCTGCCTCTAACTGG + Intergenic
939329041 2:140734789-140734811 AAGCCAATGTTGCCTGTCAGAGG - Intronic
939386856 2:141511820-141511842 AAACTACTTCTGCCTCTCATAGG - Intronic
940340135 2:152571399-152571421 AAACTGATGCTGCCTCTCACTGG + Intronic
940871980 2:158868049-158868071 AAACAGATTCTGCCTCTCAGGGG - Intergenic
940980579 2:159997772-159997794 AAACCACTGCTGCCCCAAACTGG - Intronic
943204846 2:184881275-184881297 AAACCAAGTCTGTCACTCACTGG + Intronic
943302130 2:186216461-186216483 ACATCACTGCTGCCTCACACTGG - Intergenic
943789772 2:191918960-191918982 AAAGCAATGATGCCCATCACTGG - Intergenic
944214071 2:197236359-197236381 AAACTGAGGCTGCCACTCACAGG + Intronic
945075184 2:206031675-206031697 AATCCAGTCCTGCCTCTCATCGG - Intronic
946180417 2:217945728-217945750 AAACCAAGTCTCCCACTCACTGG + Intronic
948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG + Intronic
948139872 2:235664644-235664666 AAACCAAGCTTGCTTCTCACTGG + Intronic
948184926 2:236013641-236013663 AAACCAGTGCAGGCTCCCACTGG - Intronic
948863109 2:240762418-240762440 ACACACATGCTGCCTCTAACAGG - Intronic
1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG + Intronic
1169823968 20:9745725-9745747 ATACCAATGCTGCCACTCCATGG + Intronic
1170027682 20:11907872-11907894 CAAGCCATGCTTCCTCTCACTGG + Intronic
1172794773 20:37529076-37529098 AAGCCAATGCTGACTCAGACAGG + Intergenic
1173000228 20:39100182-39100204 ATAGCAATTCTGCTTCTCACAGG + Intergenic
1173057572 20:39630650-39630672 AAAGCAATGTGGCCTCTTACTGG + Intergenic
1177635477 21:23782006-23782028 CAACTAATGCTGCCTAACACTGG + Intergenic
1178588901 21:33892902-33892924 AAACCACAGCTGCCATTCACGGG + Exonic
1179505368 21:41836336-41836358 CCACAAATGCAGCCTCTCACTGG + Intronic
1180124226 21:45778296-45778318 AATCCAATGCTGCCTCTAGTGGG - Intronic
1180955845 22:19740861-19740883 GAACCAATCCTGCCCCTCCCTGG + Intergenic
1183397379 22:37579802-37579824 AAACCATTGCTGTCCCTCTCTGG - Intronic
1184905745 22:47485301-47485323 AAACCACTGGTGCCTGTAACTGG + Intronic
950121078 3:10482918-10482940 GAAGCAATGCTTCCTCCCACTGG + Intronic
951515765 3:23557490-23557512 AGACCCATGCTTCCTCACACTGG + Intronic
952167062 3:30761866-30761888 ACACAAATGCTGCATTTCACAGG + Intronic
952746628 3:36787822-36787844 GAACTGGTGCTGCCTCTCACTGG + Intergenic
953068567 3:39497567-39497589 AATCCCTTGCTGCCTCTTACTGG + Intronic
956139728 3:66133651-66133673 AAACCACTGATTCCTCTCCCTGG - Exonic
958423139 3:93950787-93950809 AAAGGAATGCAGCCCCTCACTGG + Intronic
960362542 3:116731439-116731461 ACACCAATGCTACCTTTCAATGG - Intronic
961476475 3:127149985-127150007 CAGCAAATGCTGCCTCTCCCAGG - Intergenic
961917859 3:130396091-130396113 AAAACAATGATGCATCTCACAGG + Intronic
963837532 3:150072086-150072108 ACACCTCGGCTGCCTCTCACTGG + Intergenic
968925456 4:3544890-3544912 AAACCCATGCTGCTTCTGCCTGG - Intergenic
970410814 4:15806362-15806384 AAAGCAATGCTGCCTCCCACAGG - Intronic
980816233 4:137950092-137950114 AAACCAATCCTAGTTCTCACTGG - Intergenic
981469545 4:145115303-145115325 AATACAATGCTCCCTCACACTGG + Intronic
983295666 4:165865633-165865655 AAATAAATGCTTCCTTTCACAGG - Intergenic
987072139 5:14347777-14347799 AAACCAATTCAACCACTCACAGG - Intronic
987459863 5:18196003-18196025 TAAACAATTCTGCCTCTCAGAGG + Intergenic
992256622 5:74927639-74927661 AAACAAATGCAGCCACTCTCAGG - Intergenic
994398127 5:99244533-99244555 AAACCACTGTTGTCTTTCACTGG + Intergenic
994659472 5:102636371-102636393 TTTCCAGTGCTGCCTCTCACAGG - Intergenic
995386059 5:111590246-111590268 AAACCAATGCTTTATTTCACAGG - Intergenic
1002290327 5:178196036-178196058 GAGCCACTGCTGCCTCTCAGAGG + Intergenic
1003359811 6:5414124-5414146 TAACCACTGCTGCCTCTGTCGGG - Intronic
1003615710 6:7653531-7653553 AAACTACTGCTGCCTGTCTCTGG + Intergenic
1003960568 6:11205138-11205160 ATATCAATCCTGCCTCTCACTGG + Intronic
1004601855 6:17158077-17158099 AAACCACATCTGTCTCTCACTGG + Intergenic
1007515384 6:42406622-42406644 CAACAAATGCTGCCTCTCTCCGG + Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009895120 6:69739645-69739667 ATAACAATGGTGCCTCTCATGGG + Intronic
1010522272 6:76852471-76852493 AAATTATTGCTTCCTCTCACAGG + Intergenic
1011673766 6:89710751-89710773 AAGCCAGTGCTGCATCTCTCAGG - Exonic
1013967265 6:115969773-115969795 AAATCAAGACTGCCTCCCACTGG - Intronic
1015175716 6:130305956-130305978 AACCAAAAGCTGGCTCTCACTGG - Intronic
1016052760 6:139547583-139547605 AATCCAATGCTGGCTCACCCAGG + Intergenic
1016236813 6:141878016-141878038 AAGCCAAAGCTGTCTCTCAAAGG - Intergenic
1017065154 6:150522074-150522096 AAACCAATGCTTTCTGTCACTGG - Intergenic
1018103986 6:160465829-160465851 AAACCAATGCCCCCTCACCCTGG - Intergenic
1018115302 6:160578009-160578031 CAACGAATGCTGTCTCTCCCTGG - Intronic
1025839103 7:65127254-65127276 ATACCACTGCTCCCTTTCACAGG - Intergenic
1025883965 7:65568711-65568733 ATACCACTGCTCCCTTTCACAGG + Intergenic
1025889480 7:65633895-65633917 ATACCACTGCTCCCTTTCACAGG - Intergenic
1026770873 7:73197750-73197772 CATCCATTGCTGCCTCTCATTGG - Intergenic
1027011740 7:74751147-74751169 CATCCATTGCTGCCTCTCATTGG - Intronic
1027076300 7:75194904-75194926 CATCCATTGCTGCCTCTCATTGG + Intergenic
1029030591 7:97462529-97462551 TCACCACTGCTCCCTCTCACGGG + Intergenic
1031852974 7:126888082-126888104 ATACCACTGCTCCCTTTCACAGG + Intronic
1034465566 7:151226658-151226680 AAACCAATGCCGATTCTCAGCGG + Intronic
1035709911 8:1705301-1705323 AAACAAAAGCTGCATCTCCCAGG - Exonic
1036903713 8:12690545-12690567 AAACAACTTCTGCCTCTCAGGGG + Intergenic
1044001512 8:86887690-86887712 AAACCATTGCTGGCTCTCAGAGG + Intronic
1047057610 8:121183610-121183632 AAACTAATTCTGCCTTTCAGTGG - Intergenic
1048704616 8:137139048-137139070 AAAACAATGCAGCCTCCCAATGG + Intergenic
1049415917 8:142495056-142495078 AAACCACTGTTGATTCTCACTGG - Intronic
1049423283 8:142526192-142526214 ACACCAATCCTGGCTCTCCCTGG - Intronic
1051628646 9:19122703-19122725 AATCTAATGCCGCCTCTGACTGG - Intronic
1053086445 9:35227122-35227144 AAACAAAGTCTGTCTCTCACTGG - Intronic
1053153813 9:35759990-35760012 AAATCAATGCTGCCCCTCAGTGG - Intergenic
1053586269 9:39462551-39462573 ATACTAATGCTGCCTCTTTCCGG - Intergenic
1053800347 9:41760072-41760094 AAACCCATGCTGCTTCTGCCTGG - Intergenic
1054144851 9:61554763-61554785 AAACCCATGCTGCTTCTGCCTGG + Intergenic
1054188774 9:61972224-61972246 AAACCCATGCTGCTTCTGCCTGG - Intergenic
1054464543 9:65485720-65485742 AAACCCATGCTGCTTCTGCCTGG + Intergenic
1054580036 9:66902678-66902700 ATACTAATGCTGCCTCTTTCCGG + Intronic
1054649747 9:67616393-67616415 AAACCCATGCTGCTTCTGCCTGG + Intergenic
1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG + Intergenic
1056344995 9:85683863-85683885 AAAACAGTGCTACCTCACACTGG - Intronic
1056999589 9:91495299-91495321 AACGAAATGCTTCCTCTCACAGG + Intergenic
1058695440 9:107555108-107555130 AGACCAATGCTGCTTCACCCAGG - Intergenic
1058967426 9:110050006-110050028 AAACCCATGCTACCCCACACGGG - Intronic
1060705233 9:125792576-125792598 AAACCACTGCTCCCTATCACTGG - Intronic
1185486850 X:488206-488228 AAAGCAATGATGCCTCATACTGG + Intergenic
1186702421 X:12106236-12106258 AATCCAAAGCTGCCTCTCCAAGG - Intergenic
1187094376 X:16130828-16130850 AAACACATGCTGCCCCTCTCTGG + Intronic
1187298947 X:18029655-18029677 AAAATATTGCTGCCTCCCACAGG + Intergenic
1187339712 X:18410220-18410242 AACACACTGCTGCCTCCCACAGG - Intergenic
1187358199 X:18598839-18598861 AACCCAATGCTACCTTTCCCAGG - Intronic
1188575631 X:31646516-31646538 ATACCAATGCTGCCAGTCAGAGG + Intronic
1190432036 X:50387469-50387491 AAAGCAAACATGCCTCTCACTGG - Intronic
1192611294 X:72569978-72570000 AAACCACTGCTGCCTCCCTGTGG - Intronic
1194673216 X:96761325-96761347 AAACCAATGCTGCCTCTCAATGG - Intronic
1195287232 X:103396954-103396976 ATAACCATGCTGCCTCTTACTGG + Intergenic
1196193610 X:112818496-112818518 AAACCAAGGCAGCCCGTCACTGG + Intronic
1198145552 X:133853038-133853060 TACTCCATGCTGCCTCTCACTGG - Intronic
1199298612 X:146187004-146187026 AAACCACTCCTGACCCTCACAGG - Intergenic
1199569710 X:149255159-149255181 AGACCAAAGCTGCATCTCTCTGG + Intergenic
1199842058 X:151659389-151659411 AAAACAATTCTGCCTTTCAGTGG - Intronic