ID: 948123200

View in Genome Browser
Species Human (GRCh38)
Location 2:235546012-235546034
Sequence CTCACTCCTCACAGAAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 335}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948123200_948123205 27 Left 948123200 2:235546012-235546034 CCTTGCCTTCTGTGAGGAGTGAG 0: 1
1: 0
2: 1
3: 35
4: 335
Right 948123205 2:235546062-235546084 TGTGTGCTTTGCAAATGAACTGG 0: 1
1: 0
2: 1
3: 25
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948123200 Original CRISPR CTCACTCCTCACAGAAGGCA AGG (reversed) Intronic
900393895 1:2445272-2445294 CTCTCACCTCCCAGAGGGCAGGG - Intronic
900501640 1:3008515-3008537 CTCACTCATCACCAAAGGGATGG - Intergenic
900824830 1:4918133-4918155 CACAATCATCACAGAAGGCAAGG + Intergenic
901753165 1:11424437-11424459 CTCACTCATCACCGAGGGGATGG - Intergenic
902107495 1:14049961-14049983 CTAACTCCTCAGGCAAGGCAGGG - Intergenic
903698593 1:25229181-25229203 GACCCTCCTCAAAGAAGGCAAGG - Intronic
904299119 1:29542811-29542833 CTCAGCCCTCTCAGAAGGCCTGG - Intergenic
904306054 1:29591023-29591045 CTCACTGCACAAAGAAGGCCAGG - Intergenic
907427000 1:54386225-54386247 CTCGCTCCCCACAGAAGGAGGGG + Intronic
908062248 1:60363923-60363945 TTCACTCCTCACAGGATGCCTGG - Intergenic
908062859 1:60370840-60370862 CTCACTTATCACAAAGGGCATGG - Intergenic
909455864 1:75847806-75847828 CTCACTCATCACGGTAGGAATGG + Intronic
909878460 1:80841491-80841513 CACAATCGTGACAGAAGGCAAGG - Intergenic
910722232 1:90299272-90299294 TTTACTCCTCACAGCAGGCTTGG + Intergenic
910870726 1:91830549-91830571 CTCACTGTTCACAGAAGCCTAGG - Intronic
912470922 1:109906209-109906231 CTCCCTCCTCACAGACTGCCAGG - Intergenic
912557364 1:110525713-110525735 CTCACCCCTCACAGCAGGACAGG - Intergenic
912675412 1:111675853-111675875 CACAATCGTGACAGAAGGCAAGG + Intronic
912936099 1:114004912-114004934 CTCACTCCTCACCAAGGGGACGG + Intergenic
913126165 1:115792445-115792467 TTCACTCCACAAAGAAGGGAAGG - Intergenic
913217130 1:116630079-116630101 CTAAATCCCCACTGAAGGCAAGG + Intronic
914881305 1:151549005-151549027 CTCACTCCTCAAAGCAGGGAGGG - Intronic
915324433 1:155073645-155073667 CTAACTCCTCAGAGGAGACATGG + Intergenic
916301606 1:163281529-163281551 CTCACCCATCACAAAAGGGATGG + Intronic
916579530 1:166095217-166095239 CCCACTCCGCACACAGGGCATGG - Intronic
918018799 1:180664548-180664570 CTCTCTTCACACAGAAGGAAGGG + Intronic
919550914 1:198986262-198986284 GTCACTGACCACAGAAGGCATGG + Intergenic
919790812 1:201289668-201289690 TGCACTCCTCCCAGAAGGTAGGG - Intronic
919900681 1:202042220-202042242 CTCACTAATCCCACAAGGCAGGG - Intergenic
921022369 1:211247802-211247824 ATCAGATCTCACAGAAGGCAGGG + Intergenic
921127305 1:212189253-212189275 GTCTCTCCTCACTGCAGGCACGG + Intergenic
921161960 1:212479208-212479230 GTCATTCCTCACAGAAGGAATGG + Intergenic
921691390 1:218155282-218155304 CTCACTCCTAACATTAGGGAAGG - Intergenic
923754490 1:236778382-236778404 CCCACTCCTCAGAGATTGCAAGG - Intergenic
924495956 1:244589207-244589229 CCCACTCCTAACTGAAGGAAAGG - Intronic
1063303282 10:4873261-4873283 CACAATCATGACAGAAGGCAAGG - Intergenic
1064065108 10:12174941-12174963 TTCACTCCTCACAGTGGCCATGG - Intronic
1067782972 10:49222468-49222490 CTCACTCATTACCAAAGGCATGG + Intergenic
1068047092 10:51899873-51899895 CTCACTCATCACCAAGGGCATGG - Intronic
1068305760 10:55205864-55205886 CACAGTCATCGCAGAAGGCAAGG + Intronic
1070105315 10:73425862-73425884 CTTGCTCCTCCCAGAAGTCATGG + Exonic
1070368657 10:75760669-75760691 CTCTCTCCTCACTGCAGGCAGGG + Intronic
1070725332 10:78783857-78783879 CTCACTCAGCACAAAAGCCAAGG + Intergenic
1071587820 10:86842348-86842370 TTCCATACTCACAGAAGGCAAGG + Intronic
1071917005 10:90304231-90304253 CTCACAGAACACAGAAGGCAAGG + Intergenic
1076118015 10:127914058-127914080 CTCACTCATCACTAAAGGGATGG - Intronic
1076207303 10:128613371-128613393 CACCCACCTCACAAAAGGCATGG - Intergenic
1076476490 10:130757389-130757411 CTCACCTCTCCCATAAGGCAGGG - Intergenic
1076844306 10:133061532-133061554 CCCCCTCCTCACAGACAGCAAGG + Intergenic
1077055831 11:592600-592622 CGCACACCTCACAGAAGGTCGGG - Exonic
1077253346 11:1570397-1570419 GTCACTTCTTGCAGAAGGCAGGG - Intronic
1077347881 11:2072694-2072716 TTCACTCCTCGCAGTGGGCAGGG + Intergenic
1077607335 11:3621013-3621035 CCCACACCTCTAAGAAGGCAGGG + Intergenic
1077938516 11:6815293-6815315 GTCACTGCTCATAGATGGCATGG + Intergenic
1078124822 11:8551033-8551055 CACAATCATGACAGAAGGCAAGG + Intronic
1078531871 11:12142875-12142897 CTCTCTGCACACAGAAGGGAGGG + Intronic
1079710946 11:23680907-23680929 CTCCCACCTCACCGAGGGCAGGG - Intergenic
1080749355 11:35138646-35138668 CTCACTCCCCACTGTGGGCACGG + Intergenic
1080958407 11:37129435-37129457 CTCAATCATGGCAGAAGGCAAGG - Intergenic
1081050101 11:38328871-38328893 CTGAATCCTCACAGGAGTCAGGG + Intergenic
1081192435 11:40120107-40120129 CTCACAGCTCCCAGGAGGCAGGG - Intronic
1082160686 11:48885051-48885073 CTCACTCCTCAAAGCAGGCTTGG - Intergenic
1082161680 11:48895355-48895377 CTCACTCCTCAAAGCAGGCTTGG + Intergenic
1082167264 11:48963784-48963806 CACACTCCTCAAAGCAGGCTTGG + Intergenic
1082236314 11:49822915-49822937 CTCACTCCTCAAAGCAGGTTTGG - Intergenic
1082239764 11:49857423-49857445 CTCACACCTCAAAGCAGGCTTGG - Intergenic
1082242388 11:49886928-49886950 CTCACTCCTCAAAGTAGGCTTGG + Intergenic
1082609805 11:55282791-55282813 CTCACTCCTCAAAGCAGGCTTGG - Intergenic
1082656876 11:55867733-55867755 CTCACTCCTCAAAGCAGGCTTGG + Intergenic
1084607561 11:70181309-70181331 CTCAGTCCCCACAGAGGGCAGGG + Intronic
1084667591 11:70584738-70584760 CTCACTCTTCCCAGGAGGTAGGG - Intronic
1086546721 11:88004589-88004611 CTCACTCCTTCCAGAAAACATGG + Intergenic
1087136223 11:94723056-94723078 CAAACTCCTCACATAAAGCAGGG - Intronic
1087497209 11:98907077-98907099 CACACTCATGGCAGAAGGCAAGG - Intergenic
1087789740 11:102393477-102393499 CTCAGTCATCACAGAGGGCCAGG - Intergenic
1089416337 11:118295284-118295306 GTCAATACTCACAGAAGCCAGGG - Intergenic
1089554740 11:119310197-119310219 AACACTACTCACAGATGGCAGGG - Intronic
1089934534 11:122350147-122350169 CCCACTTCTCACAGTAGGCTAGG + Intergenic
1089994550 11:122893296-122893318 CACACTCCTCAGAGCAGGCATGG + Intronic
1090836031 11:130454662-130454684 CTCCTCCCTCCCAGAAGGCATGG - Intronic
1090934155 11:131326944-131326966 GCCTCTCCTCACAGGAGGCAAGG + Intergenic
1091101298 11:132876253-132876275 CTCAGTGCTCACAGAAGGAGGGG + Intronic
1091946580 12:4550417-4550439 CTCTCCGCTCAAAGAAGGCAAGG - Intronic
1092098708 12:5865113-5865135 GTCACTGCTAAGAGAAGGCAGGG - Intronic
1093141708 12:15517181-15517203 CACAATCATGACAGAAGGCAAGG + Intronic
1094182308 12:27604858-27604880 CACAATCTTGACAGAAGGCAAGG + Intronic
1094762719 12:33552328-33552350 CACAATCATCACAGAAGGCAAGG - Intergenic
1096219443 12:49819893-49819915 GTCATTCCACACAGAAGGAAAGG + Intronic
1098656337 12:73034898-73034920 CACAATCATGACAGAAGGCAAGG + Intergenic
1099890720 12:88585843-88585865 CTCACTCATTACCAAAGGCATGG + Intergenic
1101521320 12:105484941-105484963 CACAATCATGACAGAAGGCAAGG - Intergenic
1101835381 12:108291457-108291479 CTCACTGCTCACACCAGGAATGG + Exonic
1101962978 12:109264099-109264121 CTCAGACCTCTCACAAGGCAAGG + Intronic
1102947431 12:117001924-117001946 CTCACTCCACAAAGTAGGCCTGG + Intronic
1104378793 12:128288807-128288829 CTCAGCCCTCACTGAAGGGAAGG - Intronic
1104829852 12:131742903-131742925 CACAATCATGACAGAAGGCAAGG + Intronic
1105003039 12:132703502-132703524 CTCTCTCATCACAGAGGGCAGGG - Intronic
1105714319 13:23046832-23046854 CTCACTCATCACCAAAGGGATGG - Intergenic
1106124096 13:26885945-26885967 CACAATCATGACAGAAGGCAAGG + Intergenic
1106174852 13:27321596-27321618 CCCACTCCGCACATCAGGCAGGG - Intergenic
1108681728 13:52786542-52786564 CTCTCTCCTTCCAGAAGACAAGG + Intergenic
1109714690 13:66206025-66206047 CACAATCATGACAGAAGGCAAGG + Intergenic
1112008421 13:95274000-95274022 CACAATCATGACAGAAGGCACGG - Intronic
1113034116 13:106029821-106029843 CTCCTTCCTCACACATGGCACGG - Intergenic
1113145387 13:107201884-107201906 CTCACTCCTGCCAGAAAGTAAGG - Intronic
1118069747 14:62232812-62232834 CACAATCATGACAGAAGGCAAGG - Intergenic
1118598201 14:67452413-67452435 CACAATCATGACAGAAGGCAAGG - Intronic
1120337375 14:83174194-83174216 CACAATCATGACAGAAGGCAAGG + Intergenic
1121215225 14:92242509-92242531 CTCACTCCTCACCCCAGGCCTGG + Intergenic
1121278696 14:92685259-92685281 CTCACTGCTCCCCTAAGGCAGGG - Intronic
1121479959 14:94258957-94258979 CACAATCGTGACAGAAGGCAAGG + Intronic
1122008018 14:98721841-98721863 CTCAATCATGGCAGAAGGCAAGG - Intergenic
1122204829 14:100143187-100143209 CTCACTCCTCAGGAGAGGCAGGG - Intronic
1122691929 14:103535636-103535658 CCTACCCCTCACAGAAGCCAAGG + Exonic
1123778922 15:23606351-23606373 CTTACTACTCTCAGAAGGTAGGG + Intronic
1124530730 15:30503389-30503411 CTCTCTCCTCCCAGAAGGCTGGG - Intergenic
1124767930 15:32504306-32504328 CTCTCTCCTCCCAGAAGGCTGGG + Intergenic
1124847255 15:33303216-33303238 CACAATCATAACAGAAGGCAAGG - Intergenic
1125392405 15:39208308-39208330 CTCACTCGACACAGCAGGGAAGG + Intergenic
1125921462 15:43528052-43528074 CTCGATCCCCAGAGAAGGCAAGG - Exonic
1126354264 15:47778345-47778367 CTAATGCCTCACAGAAGGCTAGG - Intergenic
1127974021 15:63983946-63983968 TTCATTCCTCATAGAAGGAATGG - Intronic
1128371865 15:67045577-67045599 CTCCCTCCCCACATAAGGAACGG + Intergenic
1128900012 15:71411944-71411966 CCCACTCCTCCCAGAGCGCATGG - Intronic
1129182571 15:73886498-73886520 TTCTCTCCCCACAGAAGGGAAGG + Exonic
1131964847 15:97830871-97830893 CACAATCCTGGCAGAAGGCAAGG + Intergenic
1132236455 15:100225566-100225588 TTCAGTCCTCACAGCAGTCACGG + Intronic
1132479947 16:162444-162466 CGGACTCCTCACAGAAGGTGAGG - Intronic
1132902338 16:2264102-2264124 CCCACTCCCCACAGATGGCTCGG - Intronic
1133433744 16:5761503-5761525 CACAATCATGACAGAAGGCAAGG + Intergenic
1135297793 16:21298173-21298195 TTCACTCTTCACATAAGGAAAGG - Intronic
1135654601 16:24236787-24236809 CTCAAGCCACACAGAAGCCATGG + Intergenic
1135677422 16:24428697-24428719 TTCTCTCCTCTCAGAAGGCATGG + Intergenic
1135816529 16:25639349-25639371 CACAATCATGACAGAAGGCAAGG - Intergenic
1135880081 16:26247141-26247163 CTCCCTCCCCTCAGAAGTCAAGG + Intergenic
1135946634 16:26870674-26870696 CTCACTCATCACCAAAGGGATGG - Intergenic
1136775387 16:32868990-32869012 CTCACACACCTCAGAAGGCAAGG - Intergenic
1136895229 16:33992522-33992544 CTCACACACCTCAGAAGGCAAGG + Intergenic
1137036078 16:35571062-35571084 TGCAATCCCCACAGAAGGCAGGG + Intergenic
1138214470 16:55191132-55191154 CTCTCTCCTCACAGAGGGCCTGG - Intergenic
1139146815 16:64335105-64335127 GACACTTCTCAAAGAAGGCATGG + Intergenic
1139513350 16:67439621-67439643 CCCTCACCTCACAGAAGGCTGGG + Intronic
1142189755 16:88712463-88712485 CTCCCTCATCCCAGAAGGCGGGG + Intronic
1203077804 16_KI270728v1_random:1131099-1131121 CTCACACACCTCAGAAGGCAAGG - Intergenic
1143016051 17:3891921-3891943 GTCAGTCCTCACAGCAGCCATGG - Intronic
1143319896 17:6061441-6061463 GTCACTACTCACACAGGGCATGG - Intronic
1143392194 17:6566020-6566042 CACAACCCTCCCAGAAGGCAGGG + Intergenic
1143938942 17:10518194-10518216 CTCATTCCTCACAGAGTGCAAGG - Intronic
1144357809 17:14462510-14462532 CTCACTCATCACCAAAGGGATGG + Intergenic
1145321126 17:21768027-21768049 CTCTGTCCTCGCAGAAGCCATGG - Intergenic
1148335486 17:46838095-46838117 TTCACTTCTCCCAGAAGTCATGG + Intronic
1148617562 17:49012652-49012674 CTCCCTCCTCCCAGCAGGAAGGG + Intronic
1149058048 17:52388510-52388532 CTCACTCATCACCGATGGAATGG - Intergenic
1149366945 17:55954083-55954105 CACAATCATGACAGAAGGCAAGG - Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1152283905 17:79401531-79401553 CTCCCTCTGCACTGAAGGCAGGG - Intronic
1152486879 17:80600364-80600386 CTTCCTCCTCACAGAAGTCTGGG - Intronic
1153335178 18:3916297-3916319 CCCACTCTTGACAGATGGCAGGG - Intronic
1153803850 18:8694932-8694954 CTCACTCATCACTGAGGGAATGG - Intergenic
1155109819 18:22703128-22703150 CTCACTCCTTGCAGGAGGCATGG - Intergenic
1155440009 18:25852225-25852247 CCCACTACTCACAGCAGCCAAGG + Intergenic
1156065540 18:33139176-33139198 CACAATCATGACAGAAGGCAAGG - Intronic
1156246914 18:35309471-35309493 CTCTCTCCTCTCAGAGGTCAAGG - Intergenic
1156763310 18:40620107-40620129 ATAAGTCCTCACAGATGGCAGGG - Intergenic
1157114139 18:44847378-44847400 TTCACTCATCCCAGAAGGCACGG - Intronic
1159647190 18:70933137-70933159 CTCACTCCTGCCAGAATGCTAGG + Intergenic
1160497539 18:79384030-79384052 TTCAGTCCTCACAGGAGGCTGGG - Intergenic
1160718970 19:589465-589487 TTCAAACCTCACAGAAAGCAAGG + Intergenic
1161370724 19:3909460-3909482 CTCACGGGGCACAGAAGGCAGGG - Intronic
1162190979 19:8946595-8946617 TTCACTCCTCACCCCAGGCATGG - Exonic
1168689887 19:58369785-58369807 CTCACACCTCTCAGAAGACATGG - Exonic
925095179 2:1192914-1192936 CCCACTACTCACAGAGGACAGGG - Intronic
925371491 2:3348865-3348887 CTCCGTTGTCACAGAAGGCAGGG + Intronic
925969509 2:9096638-9096660 CTCACTCCTCACAGACAACAAGG + Intergenic
926350808 2:11992546-11992568 CTCACTGGTCTCAGAAGACAAGG + Intergenic
927866105 2:26588634-26588656 CTCAGTTCTCACAAAAGTCACGG - Intronic
928218506 2:29382624-29382646 ATCAGTCCTCACAGATGTCAAGG - Intronic
929066636 2:37982439-37982461 CTCTCTCATGACAGAGGGCAGGG - Intronic
931759533 2:65404631-65404653 CTCTCTCTGCACAGGAGGCAAGG - Intronic
931826770 2:66008387-66008409 CTCAACCTTCACTGAAGGCAGGG - Intergenic
932362743 2:71122522-71122544 CACACTCATGGCAGAAGGCAAGG + Intronic
932916057 2:75859417-75859439 CTCACTCATCACTGCAGGGAGGG + Intergenic
933071220 2:77860270-77860292 CACAATCATGACAGAAGGCAAGG - Intergenic
933764426 2:85697223-85697245 CATTCTCCACACAGAAGGCAGGG + Intronic
933999230 2:87692742-87692764 CTCCCTCTTCAAAGAGGGCAAGG + Intergenic
934064185 2:88324471-88324493 GTCATCCCTCACAGGAGGCAAGG + Intergenic
934589174 2:95530813-95530835 CTCACTCCTCAGAGCAGGCTTGG - Intergenic
939117258 2:138074695-138074717 CCCACTCATGACAGGAGGCAGGG + Intergenic
942640756 2:178058501-178058523 CACACTCCTGGCAGAAGGCAAGG - Intronic
942966779 2:181904046-181904068 GTCACTCTTCAAAGAAGTCAAGG + Intronic
943570207 2:189564995-189565017 CTCCCTCCTCACAGAGTCCAAGG + Intronic
943907247 2:193515251-193515273 CTCACTAATCACTGAAGGGATGG + Intergenic
944761412 2:202818736-202818758 CACAATCATCATAGAAGGCAAGG - Intronic
945669111 2:212780917-212780939 CACAATCATCGCAGAAGGCAAGG - Intergenic
946117038 2:217472145-217472167 CTCACGCCCCACAAAAGGAAAGG + Intronic
946645702 2:221831579-221831601 CTCACTTATCACAGAAGAGATGG + Intergenic
947237078 2:227952075-227952097 CTCAATCATGGCAGAAGGCAAGG - Intergenic
947278774 2:228425247-228425269 CTGACACCTCACACACGGCAGGG - Intergenic
948123200 2:235546012-235546034 CTCACTCCTCACAGAAGGCAAGG - Intronic
948598432 2:239095241-239095263 CTCAGCCCTCACAGGAGTCAAGG - Intronic
948841873 2:240655084-240655106 CACAATCCTGGCAGAAGGCAAGG + Intergenic
1169644370 20:7792993-7793015 CTCACTCTTCACAGTAAGCCTGG - Intergenic
1169651608 20:7874428-7874450 CACACTCATGGCAGAAGGCAAGG - Intergenic
1170782499 20:19438300-19438322 ATCAGTCCTCCCAGAAGGAAAGG - Intronic
1171376905 20:24700009-24700031 CTCACTCCCCATAACAGGCATGG + Intergenic
1171519344 20:25764270-25764292 CTAACTCCCCACTGCAGGCAGGG - Intronic
1171557577 20:26092221-26092243 CTAACTCCCCACTGCAGGCAGGG + Intergenic
1172604734 20:36206875-36206897 CACCCTCCTCACAGAGGACAGGG + Intronic
1172641515 20:36443068-36443090 CTCTCTCCTCCCAGAAAGCCTGG + Intronic
1172855770 20:38001085-38001107 CTCTCTCCCCACAAAAGACAGGG + Intronic
1173637998 20:44577977-44577999 CTCACTCATTACAGCAGGGAGGG - Intronic
1173998423 20:47357317-47357339 CTCGCTCCTCTGAGAAGCCAGGG - Intergenic
1175396034 20:58662349-58662371 TACAGTGCTCACAGAAGGCAGGG + Intronic
1175875210 20:62226315-62226337 CTCACTTCTCACAGCAGCCAGGG - Intergenic
1175923452 20:62460826-62460848 CTCACTCCTCAAAGCAGGCCCGG - Intergenic
1175969936 20:62680286-62680308 CTCCCTCTTCACAGATGACATGG - Intronic
1176214811 20:63943009-63943031 CTCCCAACCCACAGAAGGCAGGG + Intronic
1177612547 21:23470491-23470513 CTCAATCCTATCAGTAGGCATGG + Intergenic
1177658885 21:24056615-24056637 CTCACTCATCACAAAGGGAATGG - Intergenic
1177836710 21:26192859-26192881 CACAATCCTGGCAGAAGGCAAGG + Intergenic
1178341178 21:31786473-31786495 CTCTGTGCTCACAGATGGCATGG + Intergenic
1178745455 21:35245472-35245494 CCTACTCATCAGAGAAGGCACGG - Intronic
1178765798 21:35450087-35450109 CTCACTCATCACCGAGGGGATGG + Intronic
1181493247 22:23273878-23273900 CTCACCAATCCCAGAAGGCAAGG - Intronic
1182078561 22:27512337-27512359 CACACACCTACCAGAAGGCAGGG + Intergenic
1184253717 22:43275462-43275484 CTCACGTCTCACACAGGGCAGGG - Intronic
1185146733 22:49141236-49141258 CCCTCACCTCACAGCAGGCAGGG - Intergenic
950378147 3:12589026-12589048 TTCACTCATGGCAGAAGGCAAGG - Intronic
951311893 3:21136973-21136995 CTCACTCATCACAAATGTCATGG - Intergenic
952213538 3:31253185-31253207 CTCACTCCTCCCAGAAGGGAGGG - Intergenic
952396904 3:32929265-32929287 CACAATCATGACAGAAGGCAAGG - Intergenic
952402485 3:32975986-32976008 CTCATTTCCCCCAGAAGGCAGGG + Intergenic
955750019 3:62177932-62177954 CTCACCCCTCACAGAACTTATGG - Intronic
959388190 3:105739557-105739579 CTCACTCCACACACAAAGTATGG - Intronic
960517206 3:118615599-118615621 CTAACTCCTCACATGAGCCAGGG + Intergenic
960566634 3:119139587-119139609 CACACTCATGGCAGAAGGCAAGG - Intronic
960960175 3:123065139-123065161 GACTCTCCTGACAGAAGGCAAGG + Intergenic
961043380 3:123692989-123693011 CCCACTCCTCACCAAAGCCAGGG + Intronic
962014106 3:131422904-131422926 CACACTCCTCATAGAAGGCTGGG - Intergenic
962069561 3:132019038-132019060 ATCACTCTTCACATATGGCATGG + Intronic
962388261 3:134950660-134950682 CTCACTCATCACCAAAGGGATGG + Intronic
963492813 3:146022298-146022320 CGCAATCATGACAGAAGGCAAGG - Intergenic
966976819 3:185092256-185092278 CTTGCTGCTTACAGAAGGCAAGG + Intronic
967396163 3:189011498-189011520 CTCAATCATGGCAGAAGGCAAGG + Intronic
967807611 3:193729472-193729494 CTCACTCAGGACAGAGGGCAGGG + Intergenic
970861751 4:20712276-20712298 ATCTCTACTCACAGAAGGGAAGG - Intronic
973552165 4:52047124-52047146 CACAATCCTGGCAGAAGGCAAGG + Intergenic
974352841 4:60772598-60772620 CACACTCATGGCAGAAGGCAAGG + Intergenic
976216017 4:82716258-82716280 CTCCTTCCACACAGAAGGGAGGG + Intronic
976480658 4:85540909-85540931 CTTACTCCTTACAAAAGGGAAGG + Intronic
976514233 4:85945996-85946018 CACAATCCTGGCAGAAGGCAAGG + Intronic
978873142 4:113605136-113605158 TTGACTCATCACAGAAGACAGGG + Intronic
979097964 4:116574599-116574621 CACAATCATGACAGAAGGCAAGG + Intergenic
981542103 4:145856413-145856435 TTCACTCCTCAGAGCAGGAATGG - Intronic
982617076 4:157652344-157652366 CTCACTTATCACAAAGGGCATGG + Intergenic
982672666 4:158340364-158340386 CACAATCATGACAGAAGGCAAGG - Intronic
983162749 4:164437410-164437432 CTCACTCATCACCGAGGGGATGG - Intergenic
984074415 4:175157145-175157167 CTCACTTCTCCCAGAAGGTGGGG + Intergenic
984517146 4:180754314-180754336 CTCAATCATGGCAGAAGGCAAGG + Intergenic
986419487 5:7564466-7564488 TTCACTCCTCACAGGAGGCCTGG + Intronic
986782354 5:11078140-11078162 ATCACCTCTCACAGAAGGCTAGG - Intronic
986873594 5:12079909-12079931 CACAATCATCGCAGAAGGCAAGG + Intergenic
987208712 5:15656401-15656423 CACAATCATCACAGAAGGCAAGG + Intronic
988013976 5:25529558-25529580 CACAATCATGACAGAAGGCAAGG - Intergenic
988085004 5:26463679-26463701 CTCAGTCTATACAGAAGGCATGG - Intergenic
988543906 5:32138857-32138879 CTCACCCTTCACTGAAAGCATGG - Intronic
988842594 5:35097586-35097608 CCCACTCCTCACAGCCAGCATGG - Intronic
988865626 5:35331321-35331343 CACAATCGTGACAGAAGGCAAGG - Intergenic
990513705 5:56512825-56512847 TTCACTCCTCCAAGAAGGAAAGG + Intronic
992264426 5:75004392-75004414 CTCACTCATCACCAAAGGGATGG + Intergenic
992596153 5:78349255-78349277 CTCTCTGTTCACATAAGGCAGGG + Intergenic
993073206 5:83191784-83191806 CTCAATCATGGCAGAAGGCAAGG - Intronic
994865081 5:105258291-105258313 CTCACTCTTTACTGCAGGCAGGG + Intergenic
995585458 5:113643692-113643714 CTCAGTCAGCACTGAAGGCAGGG + Intergenic
996223612 5:120962584-120962606 ATCACTTCCCACAAAAGGCAAGG - Intergenic
997850875 5:137331711-137331733 CTCACTCATCACCGAGGGGATGG + Intronic
998565145 5:143210199-143210221 CACAATCCTGGCAGAAGGCAAGG + Intronic
998640575 5:144005867-144005889 CACAATCATGACAGAAGGCAGGG - Intergenic
999358041 5:150955510-150955532 GTCACCCCTCCCACAAGGCAAGG - Intergenic
1000506835 5:162130873-162130895 CTGAGTCCCCATAGAAGGCATGG + Intronic
1000730382 5:164827896-164827918 TTCACTACTCACGAAAGGCAAGG + Intergenic
1002192100 5:177483643-177483665 CTCACACATGAGAGAAGGCATGG + Exonic
1004086935 6:12458768-12458790 CTGACTCCTCTCAGCAGGCTTGG + Intergenic
1005416139 6:25602243-25602265 CTCACTCAACAAAGGAGGCATGG + Intronic
1007234564 6:40381154-40381176 CTCTCTCCCCAAGGAAGGCAAGG - Intergenic
1007848675 6:44782291-44782313 CGCACTCCAGAGAGAAGGCAAGG - Intergenic
1008728578 6:54452441-54452463 CACAATCCTGGCAGAAGGCAAGG + Intergenic
1009634827 6:66252341-66252363 CACAATCATCACAGAAGGCAAGG + Intergenic
1010416768 6:75620457-75620479 CTGTCTCCTCACAGAATGGAAGG + Intronic
1010809860 6:80289127-80289149 CTCTTTCCTCACAAAAAGCAAGG - Intronic
1013126388 6:107188688-107188710 CTCACTCGTCACCAAGGGCATGG - Intronic
1015190314 6:130465087-130465109 CTCACTCATCACTGCAGGGAGGG + Intergenic
1016139611 6:140593096-140593118 CACACTCATGGCAGAAGGCAAGG - Intergenic
1016385426 6:143526202-143526224 CTCACTCCTCAGAGATTGCTGGG - Intergenic
1017292949 6:152762560-152762582 CACAATCATGACAGAAGGCAAGG + Intergenic
1017412109 6:154178829-154178851 CTCTCTCCTCAGAGAAAGCCTGG + Intronic
1018028926 6:159826813-159826835 CTCACTCATCACCCAAGGGATGG + Intergenic
1018135168 6:160771936-160771958 TTCCCTCCTCACAGAAGCAAAGG - Intergenic
1018433099 6:163738359-163738381 ATAACTCCTCACAGCAGGCCAGG + Intergenic
1019950312 7:4366968-4366990 CTGACTCCTCCCAGAATGCTGGG + Intergenic
1023475325 7:40571996-40572018 CTCACTCCTCACTAATTGCAGGG + Intronic
1024306132 7:47931098-47931120 CCCACTTCTCCCAGAAGGTACGG - Exonic
1025780945 7:64601314-64601336 CACAATCCTCCCAGAAAGCAGGG - Intergenic
1026436792 7:70406226-70406248 CTCCCTCCTCTCAGAGGACATGG + Intronic
1026544502 7:71310087-71310109 CACAATCATGACAGAAGGCAAGG - Intronic
1028326190 7:89528005-89528027 CACAATCATGACAGAAGGCAAGG + Intergenic
1030165852 7:106554228-106554250 CTCACTCCTCACAGAGGAGTTGG + Intergenic
1031443408 7:121821512-121821534 CTCACTCATCACCAAAGGGATGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032092372 7:128917381-128917403 CTCACTCCTGACAGTGGCCAGGG + Intergenic
1032348731 7:131140473-131140495 CTCACTCATCACAGCAAGAAAGG - Intronic
1033225132 7:139555298-139555320 CACAATCATGACAGAAGGCAAGG - Intergenic
1033828310 7:145219627-145219649 CTCACTCATCACCAAAGGGATGG - Intergenic
1034764018 7:153700666-153700688 CTCACACCTCACAGGCTGCAAGG + Intergenic
1035433017 7:158836532-158836554 CTCACTCATCACCGAGGGGATGG - Intergenic
1035619355 8:1025843-1025865 CTCAGTACACACAGAAGCCAGGG - Intergenic
1036690941 8:10944414-10944436 CTCCCAGCACACAGAAGGCAAGG + Intronic
1037402857 8:18510280-18510302 CCCTCTCCCCACAAAAGGCAGGG + Intergenic
1039000279 8:32972467-32972489 CTCACTCATCACCAAAGGGATGG - Intergenic
1039791099 8:40876084-40876106 CTCACTCCTTAGTGAAAGCAGGG + Intronic
1041308471 8:56489041-56489063 CTCACTCATCACCAAGGGCATGG - Intergenic
1042606081 8:70548100-70548122 TTTACTCCTGTCAGAAGGCAAGG - Intergenic
1043678372 8:82990507-82990529 TTCACTCCTTACAGACAGCAAGG + Intergenic
1043747661 8:83896461-83896483 CTAACATCTTACAGAAGGCAGGG + Intergenic
1046492345 8:114968762-114968784 CACAATCATGACAGAAGGCAAGG - Intergenic
1046764077 8:118050959-118050981 ATCACACCTCACAGAAAGAATGG + Intronic
1048852557 8:138658770-138658792 CTCACTAATCAGATAAGGCATGG - Intronic
1049001464 8:139827978-139828000 CTCACTCATCACTGAGGGAAAGG + Intronic
1049124828 8:140777414-140777436 CTCACTCATCACCAAAGGAACGG + Intronic
1049270229 8:141691623-141691645 ATCATCCCTCAAAGAAGGCAGGG - Intergenic
1050361936 9:4838376-4838398 CTTACGCCCCACATAAGGCAGGG - Intronic
1050500428 9:6292780-6292802 AACACTCCTCACAGAAGGAAGGG - Intergenic
1050656100 9:7830608-7830630 CACAATCATGACAGAAGGCAAGG + Intronic
1052975357 9:34406073-34406095 TTCACCCCTCAGAGCAGGCAGGG + Intronic
1053141489 9:35685331-35685353 CTCACTCCCCACAGGTGGCCAGG - Exonic
1053457883 9:38245143-38245165 CTCACTCAGTACAGAAGGCTTGG + Intergenic
1053817540 9:41928430-41928452 CTCACTCCCCAGAGAGGGCGGGG - Intronic
1054107796 9:61072102-61072124 CTCACTCCCCAGAGAGGGCGGGG - Intergenic
1054613061 9:67259023-67259045 CTCACTCCCCAGAGAGGGCGGGG + Intergenic
1055800604 9:80032107-80032129 CTCACTCATCAAAAAAGGAATGG + Intergenic
1056213739 9:84389198-84389220 CTCTCTCTTCAAAGAAGGGAAGG - Intergenic
1056220041 9:84442918-84442940 TTCACTCGTTACAGAAAGCAAGG - Intergenic
1056802153 9:89699818-89699840 CTCACTCCTGATGGAAGCCAAGG + Intergenic
1056912716 9:90718022-90718044 CACACTGCTCACAGAAGTCCAGG + Intergenic
1057415373 9:94857487-94857509 ATCTCTCCTCCCAGAAGACAAGG - Intronic
1057789062 9:98110656-98110678 CTCACTCCCCACAGGGAGCAGGG + Intronic
1057905943 9:98983526-98983548 CTCAGTCCTCACAGCAGCCCTGG - Intronic
1058822782 9:108747890-108747912 GTCTCTCCTTACAGAAGGCCTGG - Intergenic
1060549599 9:124478629-124478651 CTCCCTCCTCCCAGAGGGCCTGG - Intergenic
1060622526 9:125081032-125081054 CACAATCATGACAGAAGGCAAGG - Intronic
1061918966 9:133771858-133771880 ATCAATCCTCACAGAAAACATGG + Intronic
1062124244 9:134850630-134850652 ATCACACCTCCCAGGAGGCATGG + Intergenic
1185826985 X:3261013-3261035 CACAATCATGACAGAAGGCAAGG - Intergenic
1186038928 X:5455201-5455223 CACAATCCTGACAGAAAGCAAGG - Intergenic
1186170373 X:6870507-6870529 CACAATCATGACAGAAGGCAAGG - Intergenic
1188029773 X:25251446-25251468 CACAATCATGACAGAAGGCAAGG - Intergenic
1188502281 X:30840686-30840708 CACAATCATCACAGAAGGCAAGG - Intronic
1189285506 X:39849555-39849577 CTCACTTATCACTGAAGGGATGG - Intergenic
1189748971 X:44199163-44199185 CTCACTCATCACTGAGGGGATGG - Intronic
1191212583 X:57904167-57904189 CTGACTCCTTACAGAATGCAAGG - Intergenic
1192337538 X:70234761-70234783 GTCAATACTCACAGATGGCAAGG - Exonic
1192783403 X:74316250-74316272 CTCTCTCTTCAAAGAAGGGAAGG - Intergenic
1193761357 X:85470232-85470254 CACAATCATGACAGAAGGCAAGG - Intergenic
1193870129 X:86787029-86787051 CACAATCATGACAGAAGGCAAGG - Intronic
1195233957 X:102878636-102878658 CTCACTCATCACAGCAAGGATGG + Intergenic
1196567799 X:117229495-117229517 CTCAATCATGACAGAAGGCAAGG + Intergenic
1197350916 X:125382269-125382291 CTCACTCATCACAAAAGGGATGG + Intergenic
1198996649 X:142580328-142580350 CACAATCATGACAGAAGGCAAGG - Intergenic
1199547797 X:149025625-149025647 CTCCCTCCTCGCAAAAAGCATGG + Intergenic
1199871053 X:151899369-151899391 TTCCGTCCTCACAGAAGGGAAGG - Intergenic
1200104531 X:153705067-153705089 CTCACACACCTCAGAAGGCAAGG + Intronic
1201251918 Y:12067335-12067357 CACAATCATGACAGAAGGCAAGG + Intergenic