ID: 948125704

View in Genome Browser
Species Human (GRCh38)
Location 2:235563425-235563447
Sequence CTGCCTGGGCAGAGGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 386}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948125704_948125711 9 Left 948125704 2:235563425-235563447 CCCACTTTCCTCTGCCCAGGCAG 0: 1
1: 0
2: 4
3: 36
4: 386
Right 948125711 2:235563457-235563479 TGCCTCGGCTCCTTCTGTGGAGG 0: 1
1: 0
2: 0
3: 46
4: 922
948125704_948125709 -6 Left 948125704 2:235563425-235563447 CCCACTTTCCTCTGCCCAGGCAG 0: 1
1: 0
2: 4
3: 36
4: 386
Right 948125709 2:235563442-235563464 AGGCAGAAACTAAGATGCCTCGG 0: 1
1: 0
2: 0
3: 28
4: 231
948125704_948125714 28 Left 948125704 2:235563425-235563447 CCCACTTTCCTCTGCCCAGGCAG 0: 1
1: 0
2: 4
3: 36
4: 386
Right 948125714 2:235563476-235563498 GAGGAAAGTAATGTGTTAATTGG 0: 1
1: 0
2: 2
3: 25
4: 289
948125704_948125710 6 Left 948125704 2:235563425-235563447 CCCACTTTCCTCTGCCCAGGCAG 0: 1
1: 0
2: 4
3: 36
4: 386
Right 948125710 2:235563454-235563476 AGATGCCTCGGCTCCTTCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948125704 Original CRISPR CTGCCTGGGCAGAGGAAAGT GGG (reversed) Intronic
900366120 1:2312640-2312662 CTTCCTGGCCAGAAGGAAGTGGG - Intergenic
900370201 1:2328864-2328886 CTGCCTGGGCCGAGGAACTGGGG + Intronic
901258488 1:7853753-7853775 CAGCTTGGGCAGAGTACAGTTGG - Intergenic
901613116 1:10515039-10515061 CTGCCTGGTCACAGAAGAGTGGG + Intronic
901829877 1:11885880-11885902 CTACCTGGGCAAAGGAGACTTGG - Intergenic
901835081 1:11918938-11918960 CTGCATGGACAGAAGTAAGTGGG + Intergenic
903010463 1:20326402-20326424 CTGCCTTGGCAGAGGAATGAAGG - Intronic
903186410 1:21631862-21631884 GGGCCTGGGCTGAGGACAGTGGG - Intronic
904003908 1:27353475-27353497 CAGCCTGGGCACCGGTAAGTGGG + Exonic
904872438 1:33627238-33627260 CTGCATGGGCACAGGAAACCAGG + Intronic
905617386 1:39410313-39410335 CTGCCTGGGGAAAGGAGAGGAGG + Intronic
906078716 1:43069830-43069852 CTGAATGTGCAGAGGAATGTAGG + Intergenic
906150167 1:43582963-43582985 CTGTGTGGGCAGATGAAGGTTGG + Intronic
907274852 1:53311352-53311374 CTGCCAGGGGACAAGAAAGTGGG - Intronic
909548138 1:76869083-76869105 CTGCCTGGTGGGAGGAAACTGGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
910876614 1:91884938-91884960 CGGCGAGGGCAGAGGATAGTAGG - Intronic
914855213 1:151345798-151345820 CTGCCTTGTCAGAAGATAGTTGG - Intronic
915300857 1:154950901-154950923 GGGCCTGGGCAGAGGGAAGATGG - Intronic
915768241 1:158388987-158389009 CTGGCTGAACAGAAGAAAGTTGG + Intergenic
916752962 1:167740321-167740343 ATGGCTGGACAGAAGAAAGTGGG - Intronic
917060591 1:171033169-171033191 CTCCCTGGGCAGGGGAAGGGTGG - Intronic
917356466 1:174131355-174131377 CTCCCTGGGCAGGGGAAGGATGG - Intergenic
918106417 1:181419208-181419230 CTGGCTGGGCAGGGGGAAGAGGG - Intronic
918218651 1:182415650-182415672 CTGCCTGGTCAGAGGGAGGAGGG + Intergenic
919586651 1:199448025-199448047 CTTCCTGGGCAGGGGAAGGGCGG - Intergenic
919883380 1:201915554-201915576 CCGGCTGGGAAGAGGAAAGGAGG + Intronic
919946247 1:202320899-202320921 CTGCCTAGGCTGAGGTAGGTAGG + Intergenic
920226068 1:204440183-204440205 CGGCCGGGGCAGAGGTCAGTTGG - Exonic
920599936 1:207313994-207314016 CTTGCTGAGCAGAGGAAACTAGG - Intergenic
921298009 1:213722738-213722760 CTGCCTGCCCAGAGGAGAGTGGG + Intergenic
921466904 1:215499221-215499243 CTGAATGGGAAGAGGAAAGAGGG + Intergenic
921582817 1:216914813-216914835 CTGTCTGGGCGGAGGACAGAGGG + Intronic
922473641 1:225891152-225891174 CTGTCTGGGCTGAGGAGGGTGGG + Intronic
922606620 1:226893768-226893790 CAACCTGGGCAGAGAAAAGCGGG - Intronic
923104072 1:230840989-230841011 CTGTGTGGGCAGTGGAGAGTAGG - Intronic
1062855811 10:778974-778996 CTACCTGGGGAGAGGTGAGTGGG + Intergenic
1062886088 10:1017186-1017208 CTGTCTGGGAAGAGGAAAGCTGG + Exonic
1063184518 10:3638712-3638734 CTGCCTGGGTGGAGGAAACCAGG + Intergenic
1065113054 10:22458852-22458874 CTAGCTGGGCATAGGAAAGCTGG + Intergenic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1069371882 10:67756667-67756689 TTGCAGGGGCTGAGGAAAGTGGG + Intergenic
1069987231 10:72292707-72292729 TTGGCAGGGCAGAGGACAGTGGG - Intergenic
1070048498 10:72863118-72863140 CATCTTAGGCAGAGGAAAGTGGG - Intronic
1070324415 10:75378521-75378543 CTGCCTGGGCTGAGGGAGGGAGG - Intergenic
1070684354 10:78469884-78469906 GTGCTGGGGAAGAGGAAAGTAGG - Intergenic
1071671625 10:87614349-87614371 CTGCCTGGCCAGAGCAGAGGTGG - Intergenic
1071677312 10:87666822-87666844 CTGCATGGTCACAGCAAAGTAGG - Intronic
1071998209 10:91167633-91167655 CTGCATGGGGAGGGGAAATTAGG + Intronic
1073323330 10:102628605-102628627 CTGGGGGAGCAGAGGAAAGTAGG + Intronic
1074003328 10:109393713-109393735 CTCCCTGGGCAGGGGAAGGGGGG + Intergenic
1074536850 10:114334228-114334250 CTGCCTGGGCAGAGAAAAGCTGG + Intronic
1074619006 10:115098290-115098312 CAGTCAGGGCAGAGGAAAGGAGG - Intronic
1074981019 10:118620081-118620103 CTACCTGGGCACAGGAATTTGGG - Intergenic
1075074513 10:119341962-119341984 CTGCAAGGGGAGAGAAAAGTGGG - Intronic
1075994744 10:126868218-126868240 CTGGCAGGGCAGGGGAAAGCAGG - Intergenic
1076273060 10:129173146-129173168 ATTCCTGGGCAGAGAAAAGGAGG - Intergenic
1076510740 10:131012178-131012200 CTGCCTGGGTTGAGGACAGCAGG + Intergenic
1076723545 10:132403160-132403182 GTGCCTGGCCAGAGGAGAATGGG + Intronic
1077250988 11:1560589-1560611 CTGACTGGACAGGGGAAAGCAGG + Intronic
1078407353 11:11082010-11082032 CTGCCCAGGAAGAGGCAAGTTGG - Intergenic
1078445186 11:11398923-11398945 CAGCCAGGGCAGAGGATAGCAGG + Intronic
1078527072 11:12109682-12109704 CTACCTAGGCAGAGGAAAACAGG - Intronic
1078594536 11:12674821-12674843 CTCCCTGGGCCGAGGTAAGTTGG + Exonic
1080384967 11:31805670-31805692 GGGTCTGGGCAGAGGAAAGCAGG + Intronic
1080914408 11:36641171-36641193 CTGGCTGAACAGAAGAAAGTTGG - Intronic
1082185195 11:49171186-49171208 CTGAGTGGGCAGAGGTTAGTTGG - Exonic
1082834686 11:57642939-57642961 CTGTCTGGGCAGGAGAAAGGAGG - Intergenic
1083280355 11:61623087-61623109 CTGCCTTGGGGGAGAAAAGTGGG - Intergenic
1083880049 11:65543883-65543905 CTGCATGAGCAGAAGAAAGTGGG - Intronic
1084091005 11:66879379-66879401 CTTCCTTTGCAGAGGAATGTTGG - Intronic
1084170055 11:67396718-67396740 CTGCCTGGGCTGGGGGAAGCAGG + Intronic
1084804219 11:71567530-71567552 CTGCCGGGGAAGAGCAGAGTGGG + Intronic
1084806213 11:71581040-71581062 CTGCCGGGGAAGAGCAGAGTGGG - Intronic
1085646921 11:78230261-78230283 ATGCCGGGGTAGAGGGAAGTTGG - Intronic
1086681137 11:89674156-89674178 CTGAGTGGGCAGAGGTTAGTTGG + Intergenic
1087010029 11:93504641-93504663 CTTCCTGGGCAGATGATAGCAGG - Intronic
1087242743 11:95797827-95797849 CTGACTGGGCAGAGGGTGGTCGG + Intronic
1087842504 11:102934941-102934963 CAGCCTGGGGAGAGCAAAGCAGG - Intergenic
1087897647 11:103604799-103604821 CTGCCTGGACAGAGAAAAGAGGG - Intergenic
1088641982 11:111881398-111881420 CTGCCTGTGGAAAGGCAAGTGGG + Intronic
1089119099 11:116119242-116119264 CTGCCTGGGAAGAGGAATTTCGG - Intergenic
1089136857 11:116256202-116256224 GTTACTGGGCAGATGAAAGTTGG - Intergenic
1089524833 11:119090054-119090076 CTGCCAGAGAAGAGGTAAGTGGG + Exonic
1090816087 11:130297419-130297441 CTGCTTGTGCAGAGGTAAGTTGG - Intronic
1090886490 11:130881444-130881466 CAGCCTTGCCAGAGGAGAGTTGG - Intronic
1091232356 11:133996936-133996958 CAGCCTGGGCAAAGGAAGTTAGG - Intergenic
1092000797 12:5030367-5030389 CTTCCTGGGCAGAAATAAGTTGG - Intergenic
1092257232 12:6933961-6933983 CTGCCCAGGCAGAGGAGAATGGG + Exonic
1093016367 12:14158805-14158827 GTGACTTGGCAGAGAAAAGTTGG + Intergenic
1093191206 12:16077293-16077315 CTTCTTGGGCAGATGAGAGTTGG + Intergenic
1094329181 12:29273553-29273575 CTCCCTGGGCAGGGGAAGGGTGG - Intronic
1096019143 12:48307647-48307669 CTGCCTGGACAGAGAAAGGTAGG - Intergenic
1096967329 12:55638648-55638670 GTCCCTGGGCTGAGGGAAGTGGG - Intergenic
1097861105 12:64519458-64519480 TTGCCTGGACAGAGGAGAGGAGG + Intergenic
1100941067 12:99723253-99723275 CTCCCTGGGCAGGGGAAGGGTGG + Intronic
1101338929 12:103823943-103823965 CTGACTGGGCAGAAGGAAGTTGG - Intronic
1101716868 12:107319531-107319553 CCGCCTGGGCCGCGGCAAGTCGG + Exonic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1102803684 12:115760407-115760429 CCGCCTGCGCAGAGGAAAACTGG + Intergenic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1103578034 12:121893290-121893312 CTCCCTGCGCAGTGGACAGTAGG + Intronic
1104803797 12:131572217-131572239 CTGCCTGGGGAGGTGACAGTCGG + Intergenic
1106301351 13:28469069-28469091 CTGCCTGGGAAGAGGGGAGGAGG - Intronic
1106863787 13:33940947-33940969 ATGCCTGGGCAGATAAAAATGGG + Intronic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1107966077 13:45599257-45599279 CTGCCTGGGGCAGGGAAAGTTGG + Intronic
1107986673 13:45782183-45782205 CAGCCTGCGCAGAGGAAATATGG + Exonic
1108300823 13:49073957-49073979 CTGCCTTGACAGATGAAAATAGG - Intronic
1108925127 13:55732999-55733021 CTGCCTAGGATGAAGAAAGTTGG + Intergenic
1109929262 13:69192951-69192973 CTGGCTGGGCAGTGGAAAATAGG - Intergenic
1110790520 13:79582079-79582101 CTCCCTGGGCAGGGGAAGGGCGG - Intergenic
1113015173 13:105821083-105821105 CTGCCTTAGCAGAGGCAAGCAGG + Intergenic
1113595817 13:111531003-111531025 GTCCCTGGGCAGAGGGAAGCAGG - Intergenic
1114183328 14:20382872-20382894 CTGGCTGGGCAGAGCAGCGTAGG - Intronic
1114443553 14:22770504-22770526 CAGGCTGGGCACAGGAAGGTTGG - Exonic
1114705945 14:24726767-24726789 CTCCCTGGGCAGGGGAAGGGTGG + Intergenic
1115523803 14:34259329-34259351 CTGTCTGCAAAGAGGAAAGTGGG + Intronic
1117114185 14:52492808-52492830 CTGACTGGGCCGAGGAGGGTTGG - Intronic
1118600644 14:67469616-67469638 CTTCCTGGAAGGAGGAAAGTGGG + Intronic
1118728034 14:68644298-68644320 CTGCCTGGGCACCAGAAAGGGGG - Intronic
1118771229 14:68944010-68944032 CTGCCTGGGCACAGCTGAGTGGG - Intronic
1119087908 14:71754029-71754051 CAGCCTGAGGAGAGGACAGTGGG - Intergenic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1119965040 14:78905175-78905197 CAGGCTGGGCAAAGGAAAGGAGG - Intronic
1121242226 14:92439231-92439253 CTGCCAGGGCAGAGGCCAGGCGG - Intronic
1121616753 14:95319041-95319063 CTGCCTGGGCACAGGACACTGGG - Intronic
1121780342 14:96618058-96618080 CTACCTGGGAAGAGGAGAGCAGG + Intergenic
1122838893 14:104444975-104444997 TTCCCTGTGCAGAGGAAAGCCGG + Intergenic
1124376495 15:29132251-29132273 CTGCCTGGGGAGGGGACAGCTGG + Intronic
1125755357 15:42060571-42060593 CTGCCTGGGCACAGAAAGATGGG - Intergenic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1126686601 15:51253604-51253626 CTGACTGGGCAGAGGATAGTAGG - Intronic
1127958355 15:63872193-63872215 CTGGCTGGGGAGAGGGAAGAAGG + Intergenic
1128356981 15:66935034-66935056 ATGGCTGTGCAGAGGAGAGTGGG - Intergenic
1130090883 15:80820245-80820267 CAGACTGGTCAGAGGAAAGTGGG + Intronic
1131057067 15:89381321-89381343 CTGCATGGGCAAAGCAGAGTAGG + Intergenic
1131712192 15:95068035-95068057 CTGCATGGGCAGAAGATAATTGG - Intergenic
1132702564 16:1228394-1228416 CTGCCTGGGCAGGGGAGGGCCGG + Exonic
1132709194 16:1258925-1258947 CTGCCTGGGCAGGGGAGGGCCGG - Exonic
1132804529 16:1769410-1769432 CTCCCTGGGCAGGGGACAGCTGG - Exonic
1133333430 16:4990676-4990698 CTGCCTGGGCCCAGGTCAGTGGG + Intronic
1133923797 16:10178541-10178563 CTGTCTGGGAAGAAGAGAGTAGG - Intronic
1134222155 16:12363234-12363256 CAGCCAGGGCAGAAGAAAGAAGG + Intronic
1137310363 16:47250885-47250907 ATGCCAGGGCTGAGGAAAGAAGG + Intronic
1137522266 16:49204447-49204469 CTGCCTGGTCACAGGAGAGATGG + Intergenic
1138102886 16:54268657-54268679 CGGACTGGGCAGAGGAGAGCTGG + Intronic
1138397904 16:56720368-56720390 TTGCCTGGGAAGAGGAATGAAGG - Intronic
1138988475 16:62361422-62361444 CAGCCTGGGCAGAAGAAAGAAGG + Intergenic
1139510988 16:67428515-67428537 CTGGCAGGGCAGAGGAATGAAGG - Intergenic
1141064464 16:80902685-80902707 CTGCAAGGGCAGAGGAGAGCAGG + Intergenic
1141132050 16:81444068-81444090 CTCCCTGGGCAGAAGAAAGAAGG + Intergenic
1142348807 16:89570643-89570665 CAGCCTGGGAGGAGGCAAGTGGG + Intergenic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1143719993 17:8802794-8802816 CTGCCTGGGCTGAGTGAGGTGGG + Exonic
1143959415 17:10702683-10702705 CTAACTGGCCAGAGGAAACTGGG + Intronic
1144308749 17:13993077-13993099 CTTCCGGGGCAGAGTAAAGAAGG + Intergenic
1144614154 17:16752775-16752797 CTGCCAGGCCAGAAGACAGTAGG - Intronic
1144898556 17:18562892-18562914 CTGCCAGGCCAGAAGACAGTAGG + Intergenic
1144965560 17:19075325-19075347 CTGCCTGCCCAGGAGAAAGTCGG - Intergenic
1144982407 17:19176858-19176880 CTGCCTGCCCAGGAGAAAGTCGG + Intergenic
1144985816 17:19201381-19201403 CTGCCTGCCCAGGAGAAAGTCGG - Intergenic
1145052652 17:19675539-19675561 CTGCCTGGAGAGAGGAAAAAAGG - Exonic
1145133820 17:20382827-20382849 CTGCCAGGCCAGAAGACAGTAGG - Intergenic
1145305181 17:21670182-21670204 CCGCCTGGTCAGAGGAACTTGGG + Intergenic
1145347556 17:22050485-22050507 CTCCCTGGGAAGAGGAAGGGAGG + Intergenic
1145398287 17:22512636-22512658 CTGCGGGGGCTGGGGAAAGTGGG - Intergenic
1145416028 17:22714843-22714865 CTCCCTGGGAAGAGGAAGGGAGG - Intergenic
1146545708 17:33736253-33736275 CTGCCATTGCTGAGGAAAGTGGG + Intronic
1147845944 17:43403906-43403928 CTCCCAGGGCAGAGGATAGGAGG + Intergenic
1149377966 17:56064626-56064648 CTGCCTGGGTGGGGGAAAGGTGG - Intergenic
1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG + Intronic
1149645100 17:58235089-58235111 CTGCCTTGGCAGGGTAATGTAGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1150953491 17:69828203-69828225 ATGACTGGGCTGAGGAAAATAGG - Intergenic
1151010233 17:70484673-70484695 CTGCCTGCTCAGTGGAGAGTGGG + Intergenic
1151275764 17:73033006-73033028 CTGCCTGGTCCGTGGAAAGATGG - Intronic
1151824759 17:76518072-76518094 CTGCCTGGGAAGGGGGAGGTGGG - Intergenic
1151946352 17:77321997-77322019 CAGCCTGGGCAGACCACAGTGGG + Intronic
1152278362 17:79371226-79371248 GTGCCCAGGCAGAGCAAAGTGGG - Intronic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1153313952 18:3703910-3703932 CTGCCTGTGAAGGGGAACGTGGG - Intronic
1153838770 18:8987777-8987799 CTACCTGGGTAGAGAAAAGAGGG - Intergenic
1154057733 18:11027374-11027396 TTGCCTGGTCAGAGCAAAGGGGG + Intronic
1154491702 18:14927132-14927154 GTGCATAGGCAGAGGAAATTAGG + Intergenic
1154503205 18:15006702-15006724 CTCCCTGGGAAGAGGAAGGGAGG - Intergenic
1156494697 18:37518089-37518111 TGGCCTGGACAGAGGAAAGAGGG - Intronic
1156887819 18:42156093-42156115 CTGCATGTGCTAAGGAAAGTTGG + Intergenic
1157121686 18:44917338-44917360 CTGCCTGGGGAGAGGCAGTTTGG + Intronic
1157985976 18:52437731-52437753 TTGCCTGGGAAGAGACAAGTGGG - Intronic
1158548000 18:58412021-58412043 CTACCTGGTCATAGGAAATTAGG + Intergenic
1159312378 18:66725942-66725964 CTGGGTGGGTAGAGGAGAGTTGG + Intergenic
1159839946 18:73387407-73387429 AAGCCTGGGGAGAAGAAAGTAGG + Intergenic
1160434257 18:78833250-78833272 CTACCTGGCCAGAGGGAAGTGGG + Intergenic
1160468814 18:79107746-79107768 ATGCCTGGGCTGAGGAAAGGCGG + Intronic
1161118540 19:2512698-2512720 CTGCCAGGGCAGAGGGAGGAGGG - Exonic
1161455000 19:4365663-4365685 CTGCCAGGGCAGAGGAGTGCAGG - Intronic
1163708599 19:18832316-18832338 CTGGCTAGGAAGAGTAAAGTCGG - Exonic
1164163884 19:22650813-22650835 CTCCCTGGGCAGGGGAAGGGCGG - Intronic
1164509111 19:28883015-28883037 CTGCCTGGGAAGTGAACAGTGGG + Intergenic
1164617713 19:29676770-29676792 CTGCCTGGGCAGAGGGCACAGGG + Intergenic
1165389515 19:35530223-35530245 GTGGCTGGGCAGAGAAGAGTGGG + Intergenic
1166324837 19:42042756-42042778 CTGGGTGGGCAGAAGAAAGCAGG + Intronic
1167529041 19:50003385-50003407 CTGCCTTTGCAGATGAAAGGTGG - Intronic
1167936878 19:52916115-52916137 CAGCCTGGGCAACGGAAACTAGG + Intergenic
1168251451 19:55144630-55144652 CTGCCTGCGCAGCGGCAGGTGGG - Intronic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
928024024 2:27725109-27725131 GTGCCTGGGGAGAGGAATGTGGG + Intergenic
928340824 2:30441743-30441765 GTGCATGGGCAGAGGAATATTGG + Intergenic
928400119 2:30971708-30971730 GTGACTGTGCAGAGGAAAGAGGG - Intronic
928435027 2:31249348-31249370 CTGCATGGGCAGAGGTAACCTGG - Intronic
929607554 2:43245012-43245034 CTGCCCAGGCAGAGGAGAGGAGG - Intronic
929887410 2:45891389-45891411 CTGCCATGCCACAGGAAAGTCGG + Intronic
930054539 2:47241823-47241845 GTGACTGGGAAGAGGAAGGTTGG + Intergenic
931582556 2:63792764-63792786 GTGGCTGGGCAAAGGAATGTAGG + Intronic
931851397 2:66254856-66254878 CTCCCAGAGAAGAGGAAAGTGGG - Intergenic
932883471 2:75525967-75525989 CTGCCTTGGGATAGGAAGGTAGG - Intronic
933007199 2:77010704-77010726 CATCCTGGGCAGAGAAAAGAAGG - Intronic
933511983 2:83251827-83251849 ATGCCTGGACTGAGAAAAGTTGG - Intergenic
936290771 2:111222338-111222360 CTGCCAGGGCAAGGGAAGGTAGG - Intergenic
936935283 2:117833957-117833979 TTGCCAGGGCAGAGGTATGTAGG + Intergenic
937893990 2:126963510-126963532 CTCCCTGGGCAGGGGAAGGGTGG - Intergenic
938502385 2:131836863-131836885 CTCCCTGGGAAGAGGAAGGGAGG - Intergenic
938696760 2:133841756-133841778 CTGCAAGGGGAGAGGAAAGCAGG + Intergenic
939109700 2:137992314-137992336 CTCCCTGGGCAGGGGAAGGGAGG + Intronic
939624261 2:144457533-144457555 GTGCCTGGGCAGAAGAGAGAAGG + Intronic
942450475 2:176105626-176105648 TTGCCTGGGCGGAGGAATCTTGG + Intronic
942483864 2:176419160-176419182 CTGGGTGGGTAGAGGAGAGTAGG - Intergenic
942490032 2:176480791-176480813 ATGGCTGTGCAGAGGAAGGTTGG + Intergenic
945439782 2:209864755-209864777 CTCCCTGGGCAGGGGAAGGGTGG - Intronic
946427406 2:219606607-219606629 CTTCCTGGTCAGTGGAAAGTAGG + Intronic
947138896 2:227002448-227002470 CTGCTTGGGCAGTGGTCAGTGGG - Intergenic
947531231 2:230909816-230909838 CTGTCTGGGCAGTGGAAAAAAGG + Exonic
948125704 2:235563425-235563447 CTGCCTGGGCAGAGGAAAGTGGG - Intronic
948591813 2:239055243-239055265 CTTCCAGGGCAGCGGAAGGTGGG + Intronic
949031010 2:241797556-241797578 CTTCCTGGGCAGGGGCCAGTGGG + Intronic
1168932598 20:1636119-1636141 CAGCCTGGGGAGAGGGGAGTGGG + Intronic
1168992105 20:2103496-2103518 ATGCCTGGGCCCAGGAAAGGAGG - Intronic
1169743564 20:8920316-8920338 CTCCCTGTGCAGAGCAAAGGTGG - Intronic
1170022428 20:11851070-11851092 CTCCTTGGGCAGGGAAAAGTGGG + Intergenic
1171455841 20:25271708-25271730 CTGCCTGGTGACAGGGAAGTTGG + Intronic
1171519335 20:25764234-25764256 CTCCCTGGGAAGAGGAAGGGAGG - Intronic
1171522696 20:25787655-25787677 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171530441 20:25849624-25849646 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171554131 20:26068228-26068250 CTGTCTGGTCAGAGGAACTTGGG - Intergenic
1171557586 20:26092257-26092279 CTCCCTGGGAAGAGGAAGGGAGG + Intergenic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1172449558 20:35012370-35012392 CTGCGTGTGCACAGGAAACTGGG - Intronic
1172593110 20:36131466-36131488 ATGCATGGACAGAGGACAGTTGG - Intronic
1173228325 20:41175002-41175024 GAGCCAGGGCAGAGGAATGTAGG + Exonic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174217667 20:48929595-48929617 CTGCCAGGGCAGTGAACAGTGGG + Intronic
1174740362 20:53007270-53007292 GTGCATGGACAGAGGAAGGTTGG + Intronic
1174750911 20:53110697-53110719 CAGCCATGGCAGAGAAAAGTTGG + Intronic
1175402544 20:58708724-58708746 GGGCCTGGGCAGAGGCAAGGAGG - Intronic
1175900134 20:62356749-62356771 CTTCCTGGGCACAGGGCAGTGGG + Intronic
1176222396 20:63975829-63975851 CGGCCTGGGGAGAGGAAAGAGGG + Exonic
1176653479 21:9570515-9570537 CTCCCTGGGAAGAGGAAGGGAGG - Intergenic
1177754904 21:25334753-25334775 CAGCCTGGGCAGTGGAGACTGGG + Intergenic
1179126934 21:38599136-38599158 CTGCCTGGGGACAGGTAAGAAGG + Intronic
1179198103 21:39184056-39184078 CTACCTGGGCAGTCGAAATTTGG - Intergenic
1179474314 21:41633495-41633517 CTGCTGGGGAAGAGGAAAGAGGG + Intergenic
1179554275 21:42162614-42162636 ATGGCTGGGCAGAGGTGAGTGGG + Intergenic
1180630910 22:17229397-17229419 CTCACTGGGAAGGGGAAAGTTGG - Intergenic
1181236440 22:21450336-21450358 CTGCCTGAGGTGGGGAAAGTTGG - Exonic
1181527871 22:23500465-23500487 CTGGGTGGGGAGAGGGAAGTGGG + Intergenic
1182279813 22:29211754-29211776 CAATCTGGGCAGAGGACAGTCGG - Intronic
1182527744 22:30932031-30932053 CTACTGGGGCAGAAGAAAGTGGG + Intronic
1182702219 22:32249663-32249685 ATGCCTGTGTAAAGGAAAGTTGG - Intronic
1182753122 22:32657587-32657609 CTGCCCGGGCAGAGCAGAGTGGG + Intronic
1183160622 22:36110629-36110651 CTGCCTGGGCAGAGGTGGGAGGG - Intergenic
1183315058 22:37132465-37132487 CAGCCTGGACAGAGGAGAGGAGG + Exonic
1183318580 22:37149959-37149981 CTTCCTGTGCAGAGGATAGAGGG + Exonic
1183489476 22:38108940-38108962 GTGCGTGGGCACAGGAGAGTGGG + Intronic
1185132191 22:49045522-49045544 GTGCCTGAGCAGAGGACTGTTGG - Intergenic
950090167 3:10289509-10289531 GAGCCTGGGCAGAGGAGAGAGGG - Intronic
950114840 3:10444160-10444182 CTGCCTGGCCAGAGATGAGTGGG - Intronic
950640974 3:14347766-14347788 CTGCATTGGGAAAGGAAAGTGGG - Intergenic
950976550 3:17252364-17252386 CTGTCGGGGCAGAGGAAAACTGG - Intronic
951539145 3:23765778-23765800 CTCCCGGGGCAGAGGAAATAAGG + Intergenic
951608185 3:24460707-24460729 CTGCCTGGTCATAGAAAAGATGG + Intronic
953925844 3:46982063-46982085 CTGCCTGGGAAGAGGAAGCTAGG + Intronic
954109531 3:48426410-48426432 TGGCCTGGGCACAGGCAAGTAGG - Intronic
954297716 3:49683451-49683473 ATGCGTGGGCAGAGGAATGTGGG + Exonic
955640570 3:61078554-61078576 CTGCATGGGTAGATGAAAGCAGG - Intronic
955989953 3:64615951-64615973 CTGCCTGGACTGAAGTAAGTTGG - Exonic
956456536 3:69426562-69426584 CTGTCCTGGCAGAGGAAAGGAGG + Intronic
958511063 3:95049528-95049550 GTGCCAGGGCAGAGAAAAATTGG + Intergenic
960534414 3:118800864-118800886 CTACCTGAGTAGAGGCAAGTAGG + Intergenic
960947289 3:122975313-122975335 CAGCCTTGGCAGAGGAAGGAAGG + Intronic
961446964 3:126985436-126985458 CTGGCTGTGCAGAGGGCAGTAGG - Intergenic
961533424 3:127554499-127554521 GTTCCAGGGCAGAGGAGAGTTGG - Intergenic
962946641 3:140176961-140176983 CTGCTTGGGCAGAGAAAAGGGGG + Intronic
962968000 3:140371873-140371895 CTGCCTGGGAAGGGAAATGTAGG - Intronic
963546091 3:146660127-146660149 CTTCCAGGGCAGAGGAGATTAGG + Intergenic
964455548 3:156861583-156861605 CTGCTTGGGCATAGGAACATGGG + Intronic
964622652 3:158732410-158732432 CTGCATGGACGCAGGAAAGTTGG + Exonic
964849639 3:161081323-161081345 CTGCCTGCACAGAAGAAAGCGGG + Intergenic
966878157 3:184335292-184335314 TTGCCTGGGCAGGGGGAAGGGGG + Exonic
968657418 4:1784740-1784762 CTGCCTGGGCATGGAAAACTGGG - Intergenic
968986809 4:3880125-3880147 CAGCCTGGGCAGAGGCCAGAGGG - Intergenic
969276698 4:6140535-6140557 CTGCAGGGTCAGAGGGAAGTCGG + Intronic
969523851 4:7694129-7694151 CTGCAGGGGCAGAGGAAGGATGG + Intronic
970375404 4:15452006-15452028 TTCCTTGGGCAGAGCAAAGTAGG - Intergenic
970666528 4:18343098-18343120 CTCCCTGGGCAGGGGAAGGGCGG - Intergenic
971195831 4:24471281-24471303 GTGTCTGGGCTGGGGAAAGTTGG - Intergenic
972334908 4:38099067-38099089 CTGCCTGGGCTGCTGACAGTAGG + Intronic
975742825 4:77446797-77446819 CTGCCCAGGGATAGGAAAGTTGG + Intergenic
977306560 4:95330543-95330565 CTGTCTGTACATAGGAAAGTTGG + Intronic
978704096 4:111684493-111684515 CTGCGTGGGCAGACCTAAGTGGG + Intergenic
978823702 4:112994755-112994777 CTACTGGGGCAGAGGAAAGAAGG - Intronic
982305861 4:153929874-153929896 CTGCCTGGGAGAAGGAAAGGGGG + Intergenic
983700866 4:170591883-170591905 ATGTCTGGGAAGAGGAAAGGAGG + Intergenic
984215737 4:176910899-176910921 CCTCCTGGGCAGAGGAAGGGCGG + Intergenic
984938905 4:184914366-184914388 CTTCCTGGGCAGGGGACAATTGG - Intergenic
985170890 4:187148845-187148867 CAGCCTTGGCAGATTAAAGTGGG + Intergenic
985578532 5:684807-684829 CGGCCTGGGCTGAGAAGAGTGGG - Intronic
985593452 5:776923-776945 CGGCCTGGGCTGAGAAGAGTGGG - Intergenic
985817992 5:2140771-2140793 ACGCCTGGGAAGAGGAAAGGTGG + Intergenic
985821301 5:2161781-2161803 CTGCCTGGGTACAGGAATATAGG - Intergenic
986157239 5:5188535-5188557 TTGACTGGGCAAAGGAGAGTGGG + Intronic
986938867 5:12925207-12925229 CTGGCTGGGCAAGTGAAAGTGGG + Intergenic
991958694 5:72020618-72020640 GTGCTTAGGCAGAGGAAGGTGGG + Intergenic
992993498 5:82309470-82309492 CTGCCTGGGTGGAGGAGAATTGG + Intronic
993161347 5:84296198-84296220 TTCCCTGGGGAGAGGAAAGAGGG - Intronic
993430544 5:87827297-87827319 CTGCCAGGAGAGAGGAAAGCTGG - Intergenic
994981680 5:106882729-106882751 TTTCCTGGGCAAAGAAAAGTTGG + Intergenic
995362112 5:111309263-111309285 CTGCCTGGGCTGAGAGATGTAGG + Intronic
996965932 5:129306916-129306938 CTCCCTGGGCAGGGGAAGGGCGG - Intergenic
997249954 5:132380916-132380938 TTGCCTGGGGAGAGGGGAGTGGG + Intronic
997635897 5:135405396-135405418 CTGCCTGGCCAGAAGATATTAGG - Intergenic
1000391602 5:160728518-160728540 CTCCATGGGAAGAGGAAAGTGGG + Intronic
1002276031 5:178104901-178104923 CTGCCTTGGCAGAAGATATTGGG + Intergenic
1002447173 5:179296655-179296677 CGGCCTGGGCAGAGGGCAGGAGG + Intronic
1002869012 6:1148741-1148763 CTGCCTGCGCCGAGGAAGGTTGG - Intergenic
1002939968 6:1707529-1707551 CTGCCTGGGAGGAGGAAGGTGGG - Intronic
1002939988 6:1707591-1707613 CTGCCTGGGAGGAGGAAGGTGGG - Intronic
1002940008 6:1707653-1707675 CTGCCTGGGAGGAGGAAGGTGGG - Intronic
1004297029 6:14422381-14422403 CTTCCTTGGTAGAGGAAAGCTGG + Intergenic
1005973935 6:30782942-30782964 TTGCCAGGGCTAAGGAAAGTGGG - Intergenic
1005993322 6:30916864-30916886 CTCTCTGGGCACAGGAAAGGTGG + Exonic
1006109297 6:31735101-31735123 CTCCCTGGGCCCAGGGAAGTCGG - Intronic
1006117693 6:31784106-31784128 CTGGCTGAGGAGAGGAAACTGGG - Intronic
1007178511 6:39912371-39912393 AGGCCTGGGCAGGGGAGAGTGGG + Exonic
1007234130 6:40378313-40378335 CTGCCAGAGCAGAAGACAGTTGG + Intergenic
1007264046 6:40584145-40584167 CTCCCTGGACAGGGGGAAGTTGG + Intronic
1007349784 6:41261750-41261772 CTTCCTGGCCAGAAGAAAATGGG + Intergenic
1007581679 6:42963721-42963743 GTGCCTGGGCAGAGGCTTGTGGG - Exonic
1007765610 6:44158154-44158176 CTGCCTCTGCACTGGAAAGTGGG - Intergenic
1007821563 6:44564125-44564147 GGGCCTGGGCAGAGTAAAGATGG + Intergenic
1008042349 6:46815676-46815698 CTGCCTGGACAGAGCAGTGTAGG - Intronic
1008741548 6:54615019-54615041 CTTCCTGGGCAGGGGAAGGTTGG + Intergenic
1009922862 6:70084574-70084596 CGGGCTGAGCAGAGGAAAATAGG - Intronic
1010718991 6:79261778-79261800 CTCCCTGGGCAGGGGAAAGGCGG - Intergenic
1010819565 6:80397044-80397066 TTGCCTGGGCACAGGTAAGCGGG - Intergenic
1012063047 6:94511799-94511821 CTGCCTGGGCTGGGGAAGGGCGG + Intergenic
1012873471 6:104698335-104698357 TTGCCTGTGGAGTGGAAAGTAGG - Intergenic
1015654203 6:135498111-135498133 CTGACTGGGCAAAGGAAAACTGG + Intergenic
1016839455 6:148511673-148511695 GAATCTGGGCAGAGGAAAGTAGG + Intronic
1017047976 6:150364995-150365017 CTGGCTGGGGAATGGAAAGTGGG - Intergenic
1017573683 6:155777451-155777473 CTTCCTGGGTAGTGGAAAGATGG - Intergenic
1018305677 6:162452798-162452820 CTACGTGGACAGAGGGAAGTGGG + Intronic
1018629617 6:165810677-165810699 CATCCTGGGGAGAGGAAGGTAGG - Intronic
1019328883 7:453014-453036 ATGCCTGGGCAGAGGGAACAGGG + Intergenic
1019921491 7:4166199-4166221 CTGCCTGGGCAAAGGCAGGGAGG + Intronic
1023834738 7:44061474-44061496 CTGCCTGGGCTATGGGAAGTGGG + Exonic
1024675755 7:51636625-51636647 CTGGCTGTGCAGAGGAGAGGAGG + Intergenic
1025279818 7:57619174-57619196 CTCCCTGGGAAGAGGAAGGGAGG - Intergenic
1025304914 7:57846327-57846349 CTCCCTGGGAAGAGGAAGGGAGG + Intergenic
1025812644 7:64884929-64884951 CTGCCTGAGCAGAGGAAAATGGG - Intronic
1026933295 7:74237299-74237321 CTTCTTGGGCAGAGGAGAGCGGG - Intronic
1028922408 7:96322287-96322309 CGGCGTGGGCAGAGGTAACTTGG + Intergenic
1029519211 7:101049464-101049486 CTGCCTGGGCACAGTAATGCAGG - Intronic
1030017012 7:105232989-105233011 CAGCCTAGGCAAAGGAAAGGAGG + Intronic
1030665958 7:112278904-112278926 TTGCCAGGGCTGGGGAAAGTGGG - Intronic
1030939804 7:115631982-115632004 CTGACTGGGAAGAGGAATCTTGG - Intergenic
1031135755 7:117882429-117882451 GTGCTGGGGCAGAGGGAAGTGGG + Intergenic
1032155648 7:129465451-129465473 CTGCCTGGGGCGGGGAAAGATGG + Intronic
1032308054 7:130755206-130755228 ATCCATGAGCAGAGGAAAGTTGG - Intergenic
1033599562 7:142878894-142878916 ATTCCTGGGCATATGAAAGTTGG + Intronic
1033659414 7:143393406-143393428 CTGCCTGAGAAGAGAAAAGATGG + Intronic
1033781864 7:144680361-144680383 CAGCCTGAGCAGAGGAGAGAAGG + Intronic
1033917024 7:146338692-146338714 CTGACTGGGCAGTGGAACATGGG - Intronic
1034433794 7:151053599-151053621 CCTCCTGGGCAGAGGAAGGGAGG + Intergenic
1034971072 7:155419369-155419391 CTGCCTGGGGAGAGAAACATAGG + Intergenic
1035395059 7:158529363-158529385 CTGTGTCGGCAGAGGAAGGTGGG + Intronic
1037116538 8:15236104-15236126 TTCCCTGGGCAAAGGGAAGTAGG - Intronic
1037889884 8:22618499-22618521 GTGCTGGGGCAGAGGAAAGAAGG - Intronic
1039475796 8:37838875-37838897 GGGCCTGGGAAGAGGAAAGCTGG + Intronic
1039718249 8:40134114-40134136 ACGCGTGGGCAGAGGAAAGAGGG - Intergenic
1040101625 8:43511641-43511663 GGGCCTGGTCAGAGGAAAATTGG + Intergenic
1040795064 8:51281440-51281462 CTGCCTAGGGAGAGCAAAGTTGG + Intergenic
1040900267 8:52410865-52410887 CAGCCAGGGCTGAGGAAGGTAGG + Intronic
1041312994 8:56535543-56535565 TTGCCTGTGCAAAGGAAACTTGG - Intergenic
1042188135 8:66157195-66157217 CTGCCTAGGGAGAGGAGGGTGGG + Intronic
1042451466 8:68951948-68951970 CTGCCTGGGCAGCAGAGAGAGGG + Intergenic
1047618198 8:126580553-126580575 GGACCTGGGAAGAGGAAAGTGGG + Intergenic
1048184441 8:132226726-132226748 CTGACTGAGCAGAAGAAAATGGG + Intronic
1048874276 8:138824759-138824781 CTGGCTAGACACAGGAAAGTTGG - Intronic
1049592184 8:143467771-143467793 CTGCCTGGGCAGAGGGCGGGAGG - Intronic
1050643004 9:7688733-7688755 GTGCCAGGGCAGAGGATAGTGGG + Intergenic
1051003650 9:12315430-12315452 CTGCCAGGGCAGGGGAAGGGCGG - Intergenic
1051069094 9:13140981-13141003 CTGCCTTGGCAAGGGAAAGCTGG - Intronic
1051203580 9:14659938-14659960 CTTCCTGGGGACAGGAAAGATGG - Intronic
1051690296 9:19705477-19705499 CTTCCTGGACAGAGTAATGTTGG - Intronic
1053145426 9:35708481-35708503 CAGCCTGGGAAGAGAAAAGGGGG + Exonic
1054736955 9:68763209-68763231 CAGCCTGTGCAGAGGAAAAGAGG + Intronic
1055542272 9:77323706-77323728 ATGCCTGGGAATGGGAAAGTGGG - Intronic
1056488902 9:87085861-87085883 CTGGCTAGGCAGAGGACTGTGGG + Intergenic
1056640939 9:88369978-88370000 CTGCCTGGGCAGGAGAAAGTTGG + Intergenic
1057455186 9:95202267-95202289 ATGCCAGGGCAGAGGGAACTGGG + Intronic
1057455616 9:95207177-95207199 CTGCCTTGGGAGGGGCAAGTGGG + Intronic
1057466059 9:95315800-95315822 CAGCCTGGCCAGTAGAAAGTTGG - Intronic
1058866713 9:109167409-109167431 CTGCCTGCGTGGAGGGAAGTCGG - Intergenic
1060815991 9:126635436-126635458 CTGCCTGGGCAAAGGCATGGAGG + Intronic
1062541109 9:137041961-137041983 CTGCCTGGGGACGGGGAAGTGGG + Intronic
1203631199 Un_KI270750v1:73962-73984 CTCCCTGGGAAGAGGAAGGGAGG - Intergenic
1188371897 X:29379353-29379375 CTGCCAGGCCAGGAGAAAGTGGG - Intronic
1189251008 X:39600719-39600741 CGGCCTGGGCAGGGGAAGGAGGG + Intergenic
1192605253 X:72509703-72509725 TTGCCGGGGCAGAGGAGAGGGGG + Intronic
1193719536 X:84971559-84971581 CTCCCTGGGCAGGGGAAGGGTGG - Intergenic
1195928179 X:110047171-110047193 GTGGGTGGGGAGAGGAAAGTGGG + Intronic
1200818207 Y:7555293-7555315 CTCCCTGGGCAGGGGAAGGTTGG + Intergenic
1201901443 Y:19048607-19048629 CTGCCTGGGCAAAGGTAAGATGG - Intergenic
1202092603 Y:21209314-21209336 CTGACTTGACAGAGCAAAGTGGG - Intergenic
1202149285 Y:21830144-21830166 CTCCCTAAGCAGAGGAAACTGGG - Intergenic