ID: 948125779

View in Genome Browser
Species Human (GRCh38)
Location 2:235563920-235563942
Sequence CATGGCTATCAGTGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948125773_948125779 7 Left 948125773 2:235563890-235563912 CCAGCAGGTTAAGAAGCTTGCTC 0: 1
1: 0
2: 1
3: 19
4: 139
Right 948125779 2:235563920-235563942 CATGGCTATCAGTGGGAAGCTGG 0: 1
1: 0
2: 2
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948125779 Original CRISPR CATGGCTATCAGTGGGAAGC TGG Intronic
902795825 1:18799876-18799898 CATGGCTGGGACTGGGAAGCTGG + Intergenic
904368928 1:30036153-30036175 CATGGCACTGGGTGGGAAGCAGG - Intergenic
905895426 1:41542847-41542869 AATGGCTATCAGTGGGATGCAGG + Intronic
907074689 1:51567500-51567522 CATGTCTAGCAGTGGGGAACTGG + Intergenic
907175601 1:52519341-52519363 CATGGTTGTCAGTGGGGAGGAGG + Intronic
907334471 1:53691296-53691318 GATGGGGATCAGTGGGCAGCAGG - Intronic
907506127 1:54919515-54919537 CCTGTCTCTCACTGGGAAGCAGG + Intergenic
907764064 1:57390806-57390828 CATGGCTAACATTTGTAAGCAGG - Intronic
908342106 1:63192190-63192212 CATGCCAATCAGTGGTAAGCAGG + Intergenic
909605936 1:77508384-77508406 CATGGTTACCAGAGTGAAGCTGG - Intronic
912209496 1:107543002-107543024 CATGGGAATCATTAGGAAGCAGG + Intergenic
913053109 1:115134094-115134116 CCTGGCTCAGAGTGGGAAGCAGG + Intergenic
917158949 1:172035672-172035694 CATGGCAATCAGTTGGTTGCTGG + Intronic
920406564 1:205717996-205718018 CATGGCTTTCATTGGGAAAGGGG + Exonic
921466171 1:215490829-215490851 AGTTGCTATCAGTTGGAAGCAGG - Intergenic
922141478 1:222892272-222892294 GATGGCTATTTCTGGGAAGCTGG + Intronic
922483123 1:225952904-225952926 CATGGAGATCAGTGGGAGCCCGG - Intergenic
923264189 1:232297687-232297709 CATCTCTATCAGTAGGAAGATGG - Intergenic
923359749 1:233199309-233199331 CATGGCTTACAGTTGAAAGCTGG + Intronic
1063077392 10:2730869-2730891 CATGGCTGTCAGTGGAGAGAGGG + Intergenic
1065658072 10:27973675-27973697 AATGGCCATCAGTGGGAGACTGG - Intronic
1068092344 10:52448129-52448151 GGTAGCTATTAGTGGGAAGCAGG - Intergenic
1068531716 10:58196204-58196226 CTTGGCAACCAGTGGGAAGATGG + Exonic
1069729736 10:70602861-70602883 GAGGGCTGTCAGTGGGGAGCCGG - Intergenic
1073594721 10:104788278-104788300 AATGTCTGTCAGTGGGAAACTGG + Intronic
1074009682 10:109465243-109465265 CATGGCTAGAGGTGGGGAGCTGG + Intergenic
1074336391 10:112580674-112580696 AATGGCTAACTGTGGGAGGCAGG + Intronic
1075079191 10:119371287-119371309 CGTGGCCATCCGAGGGAAGCTGG + Intronic
1076047060 10:127302451-127302473 CATAGCTTTCACTGGGATGCAGG - Intronic
1078426132 11:11252825-11252847 CTTGGCTATCAGTGTGGGGCAGG + Intergenic
1079795573 11:24798709-24798731 AATGGCAAGCAGGGGGAAGCAGG - Intronic
1082941446 11:58709571-58709593 CAGGTTTCTCAGTGGGAAGCAGG - Exonic
1082982993 11:59141349-59141371 AATGCCTATCAGTGGTAGGCTGG - Intergenic
1083938382 11:65882195-65882217 TATGGCTATCGGAGGGCAGCTGG + Exonic
1085061892 11:73454841-73454863 AGTGGCTCTCAGTGGGAAGAGGG - Intronic
1088662197 11:112058799-112058821 AATGGCTATCATTTTGAAGCAGG - Intronic
1091797763 12:3306981-3307003 GATGACTATCAGTGGGAAACAGG + Intergenic
1093300835 12:17452369-17452391 AGTGGCTGTCAGTGGGAAGGGGG + Intergenic
1100664351 12:96735139-96735161 CATGTCTTTCAATGGGAAGTTGG - Intronic
1102497519 12:113329839-113329861 CTTGGCTGTCAGTGGGAGGAAGG - Intronic
1103611554 12:122127244-122127266 CTTGCCTTTCAGTGGGAAGTTGG + Exonic
1104717774 12:131027733-131027755 CATGGCTGGCAGGGGGATGCAGG - Intronic
1105690750 13:22837148-22837170 CTTGGCAACCAGTGGGAAGATGG + Intergenic
1106124006 13:26885328-26885350 CATGCCCATCAGTGGGAGGAGGG + Intergenic
1106465422 13:30009805-30009827 CATGGCCATCTGGAGGAAGCGGG + Intergenic
1106510286 13:30407278-30407300 AAGGGGTATCAGTGGAAAGCTGG - Intergenic
1113232636 13:108231466-108231488 AATGGCTATAGGTGGGAAGTAGG + Exonic
1115352283 14:32408148-32408170 CATGGCTAGCAGCGGGGAGTGGG + Intronic
1115435077 14:33362965-33362987 CATGGTTCACAGTGGGAAGGTGG - Intronic
1117195461 14:53335901-53335923 CATAGTTATCAATGGGAATCAGG - Intergenic
1118818048 14:69326546-69326568 CATGGATATCAGAGGAGAGCTGG + Intronic
1120740600 14:88105537-88105559 CATGGCTATCTTTGGGACCCAGG + Intergenic
1125787779 15:42337236-42337258 AATGCCTATCAGTGGTAAACTGG + Intronic
1126675085 15:51154020-51154042 CATGTCCATCAGTGGGAGGGTGG + Intergenic
1127265206 15:57355413-57355435 CCTGGCTAGCGGTGGGCAGCTGG - Intergenic
1127519631 15:59730526-59730548 CATGGCTATCTCTGGATAGCAGG - Intergenic
1127543251 15:59964374-59964396 AATGGCTATCAATAGGAAGAGGG + Intergenic
1128300219 15:66561998-66562020 CATGGCAAAGAGGGGGAAGCTGG - Intronic
1129288648 15:74546197-74546219 CAAAGCAATCAGTGGGAGGCGGG - Intronic
1129828792 15:78653479-78653501 CCTGGCTGTCAGTGGACAGCTGG - Intronic
1133343657 16:5055542-5055564 CAAGGCCCTCAGTGGGAGGCGGG - Intronic
1135459068 16:22625618-22625640 CATGCCTATCAATAGGAAACTGG - Intergenic
1137548172 16:49418368-49418390 CATGGCTGGCAGTGAGGAGCGGG + Intergenic
1138626969 16:58260155-58260177 CCTCCTTATCAGTGGGAAGCAGG + Intronic
1140144503 16:72293295-72293317 AATGGCCATCAGTAGGATGCTGG + Intergenic
1142279858 16:89142175-89142197 CAGGGCTATCACTGAGAAGCAGG + Intronic
1143185933 17:5010309-5010331 AATGTCCATCAGTGGGAAGCTGG - Intronic
1144379811 17:14683489-14683511 TGTGACTTTCAGTGGGAAGCTGG - Intergenic
1145291689 17:21551557-21551579 CATAGCGATCACTGGGAACCTGG - Exonic
1147418575 17:40310751-40310773 AATGGCTATCAGTAGCAAGCAGG + Intronic
1152623311 17:81376947-81376969 AATGTCCATCAGTGGGAGGCTGG + Intergenic
1152703567 17:81831833-81831855 CATGGGTATCAGTAGGGAGTGGG - Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1155844839 18:30693190-30693212 TATGGCTATCAGTGGAAGACTGG - Intergenic
1157201926 18:45667012-45667034 CATGGCTGCCAGTGGGAAAAGGG + Exonic
1157691982 18:49691358-49691380 GATGGCAATCACTGGGGAGCGGG - Intergenic
1159888054 18:73928118-73928140 CTGGGCTCTCAGTGGGAAGCAGG + Intergenic
1162348544 19:10135593-10135615 CATCACTCTCAGTGGGAAGACGG - Intronic
1163219835 19:15910702-15910724 CTTGGCAACCAGTGGGAAGATGG + Intergenic
1166794711 19:45419517-45419539 CATGGCTCGCGGTGGGAAGCAGG + Intronic
925847217 2:8044751-8044773 CATGGCTTTCAGGATGAAGCCGG + Intergenic
927145494 2:20162784-20162806 CAGAGGTGTCAGTGGGAAGCAGG + Intergenic
927577633 2:24212686-24212708 CATGGGTTTCAGCAGGAAGCTGG + Exonic
928575992 2:32655593-32655615 CATTGGTATGAGTGAGAAGCTGG - Intronic
929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG + Intergenic
929825289 2:45305297-45305319 CATGGCAAGCAGTAGGCAGCAGG - Intergenic
929913430 2:46113660-46113682 CCTGGCTTGCAGTGGGAAGGGGG + Intronic
931038733 2:58273207-58273229 CTTGGCAATCAGTGGGATGATGG + Intergenic
934774132 2:96926574-96926596 CGTGGATATGAATGGGAAGCGGG - Intronic
935303896 2:101718544-101718566 CAGGGCTGACAGTGGGAAGGTGG + Intronic
937531360 2:122831258-122831280 CATGAGTATCAGTGAGAAGGAGG - Intergenic
937851478 2:126639965-126639987 CAGGCCTATCAGTGGCAAGTAGG - Intergenic
940258927 2:151760530-151760552 CAGGGTTATCTGTGGGGAGCCGG + Intergenic
940928128 2:159391585-159391607 GATTGCTACCAGTGGGAAGTTGG - Intronic
943452560 2:188063025-188063047 TATGACTATGAGTGAGAAGCAGG - Intergenic
943801130 2:192059390-192059412 CATGGGGATAAGAGGGAAGCTGG + Intronic
945022486 2:205587832-205587854 CAGGGCTATAAATGGGAAGCTGG - Intronic
947639713 2:231700232-231700254 GATGGATCTCAGTGGGAGGCTGG + Intergenic
948125779 2:235563920-235563942 CATGGCTATCAGTGGGAAGCTGG + Intronic
948575061 2:238944439-238944461 CATGGCAATGAGTGGCAAGTTGG + Intergenic
948974974 2:241458400-241458422 CAGGGCTACCCGTGGGATGCTGG + Intronic
1168780544 20:485605-485627 AATAGCTATCAGTAGGAAACTGG - Intronic
1169169439 20:3452816-3452838 AATGGCTCTCATTGGGACGCAGG + Intergenic
1169415926 20:5416214-5416236 CATGGATAACAGTGCGAAGGGGG + Intergenic
1170605175 20:17870235-17870257 CGTGGCTGGCCGTGGGAAGCTGG - Intergenic
1170934130 20:20795270-20795292 CATGGCTGTGTGTGAGAAGCAGG + Intergenic
1173459971 20:43235466-43235488 CGTGGCTAGCAGTGTGATGCTGG - Intergenic
1173649710 20:44655386-44655408 CCTGGTTTTCAGTGGGCAGCTGG - Intergenic
1174546789 20:51331630-51331652 CATGCATATCTGTGGGAAGCTGG - Intergenic
1178555372 21:33586363-33586385 CATGGTTACCTATGGGAAGCGGG + Intronic
1178581894 21:33845014-33845036 CATGACTCTCAGTGGGCAGCGGG - Intronic
1179171441 21:38975933-38975955 CATGGAAATCACTTGGAAGCAGG + Intergenic
1181005947 22:20013586-20013608 CATGGCCACCAGAGGGCAGCTGG - Intronic
1183829239 22:40409220-40409242 CATGGCCAGGAGTGGGGAGCAGG - Intronic
1185400133 22:50611303-50611325 CATGGAGCTCAGGGGGAAGCAGG + Exonic
949926957 3:9049167-9049189 CATAGCTGTCAATGGGAAGGTGG - Intronic
950129524 3:10532434-10532456 CATGCCCATCAGTGGAAACCAGG - Intronic
951469683 3:23042810-23042832 AATGTCTATCAGTAGGAAGTTGG + Intergenic
952834915 3:37594295-37594317 CATCTCTGTCTGTGGGAAGCAGG + Intronic
953265108 3:41379536-41379558 CATGGCCATCACTGGGATACCGG + Intronic
954393357 3:50279130-50279152 CATGGCAAGCAGTGGGCAGTCGG - Exonic
957681374 3:83440111-83440133 CAGGGCTATCAGATGGTAGCAGG - Intergenic
959130944 3:102355363-102355385 CCTGGTTATCAGAGGGAAACAGG + Intronic
959136090 3:102423020-102423042 CAAGTCTGTCAGTGGGAAGAAGG + Intronic
960872294 3:122261934-122261956 CATGGCGATCAGGGAGGAGCTGG - Exonic
962851407 3:139310953-139310975 CATGGCCAGTAGTGGGAAGCAGG + Intronic
967008263 3:185406038-185406060 CAGGGCTGTCAGTGGGAATGAGG + Intronic
967322487 3:188208350-188208372 CATCCCTAGCAGTGGGCAGCAGG - Intronic
970513699 4:16806147-16806169 CATGGCCATCAGTTGGTACCTGG - Intronic
971189006 4:24409046-24409068 TAAGGCTAACACTGGGAAGCTGG + Intergenic
971381146 4:26099075-26099097 CCTGGGTAGCAGTGAGAAGCAGG + Intergenic
972203883 4:36747872-36747894 CATGAATGGCAGTGGGAAGCAGG + Intergenic
978402832 4:108349241-108349263 CATGCCCATCAGTGGTAGGCTGG - Intergenic
978671686 4:111255564-111255586 CAAGTCTATCAGTGGTCAGCAGG - Intergenic
979716481 4:123844687-123844709 AGTGGCTCTCAGTGGGAAGGGGG + Intergenic
980495449 4:133584376-133584398 AGTGGCTCTCAGTGGGAAGGAGG - Intergenic
981078650 4:140616657-140616679 CATGTCTTTCATTGAGAAGCAGG + Intergenic
985728883 5:1533657-1533679 AATACTTATCAGTGGGAAGCTGG + Intergenic
989250115 5:39303791-39303813 CATGACTATCTTTGGGATGCGGG - Intronic
989677245 5:43986192-43986214 CATTGCTATCAGTGGGCTGGAGG - Intergenic
991036367 5:62131698-62131720 CCTGGCTAGCAGAGGGAAGTGGG - Intergenic
995006632 5:107204533-107204555 CATGCTTCTCACTGGGAAGCTGG + Intergenic
997980564 5:138465388-138465410 CATGGCCATATATGGGAAGCAGG - Intergenic
1001098153 5:168792203-168792225 CATGGAGGTCAGTGGGCAGCTGG - Intronic
1001483480 5:172104073-172104095 CATGGCACACAGTAGGAAGCTGG + Intronic
1003860458 6:10317998-10318020 CATGGCCATGCGAGGGAAGCAGG - Intergenic
1005855074 6:29854344-29854366 AATGCCTATCAGTAGGGAGCTGG - Intergenic
1012986748 6:105884033-105884055 CATGACTATCAGGGAGCAGCTGG + Intergenic
1013239679 6:108232506-108232528 CTTGGCTATCAGTGATAATCAGG - Intronic
1014344227 6:120247371-120247393 CATGGCAATCATTTGGAAGAAGG - Intergenic
1019565558 7:1677203-1677225 AATGGCTGTCAAAGGGAAGCAGG - Intergenic
1019648790 7:2145088-2145110 CAGGGCTCTCAGTGGGCAGCGGG - Intronic
1021933875 7:25610193-25610215 CATGGCTAGCAGTTGGAGGGAGG + Intergenic
1022276732 7:28862620-28862642 CATGCCTATAGGAGGGAAGCAGG + Intergenic
1022468758 7:30668879-30668901 CATGGCTAGGGGTGGGGAGCAGG - Intronic
1027479535 7:78678364-78678386 GATGACTTTGAGTGGGAAGCAGG - Intronic
1027708326 7:81564678-81564700 CATGGCTATCACTGGTACCCTGG + Intergenic
1028512969 7:91645152-91645174 CATGGCTATCATTGGGAACCAGG - Intergenic
1028709791 7:93893877-93893899 CAAGGCTCTCAATGGGAAGTAGG - Intronic
1028917150 7:96271797-96271819 CATGTCTATTAATGGGAAGGGGG + Intronic
1029593283 7:101521431-101521453 CATGGCAATTGGTGGGAAGGTGG + Intronic
1031936406 7:127739667-127739689 CATGGCTGTCCCTGGGAATCAGG - Intronic
1032964195 7:137076815-137076837 CATGTCTACCAGTGGGCATCAGG + Intergenic
1033885755 7:145943008-145943030 CATTGCTTTCAGTGGTAAACAGG - Intergenic
1035992326 8:4506311-4506333 CGTGGGTTTCAGTGGGTAGCTGG - Intronic
1040038212 8:42891847-42891869 AGTGGTTATCAGTGAGAAGCTGG + Intronic
1045058074 8:98386319-98386341 AATGCCTATCAGTAGGAAACTGG + Intergenic
1047411372 8:124627285-124627307 GCTGGCTATCAGTGAGAAACTGG + Intronic
1049971632 9:826707-826729 CCTGTCAATCAGTGGGGAGCGGG + Intergenic
1050395066 9:5186783-5186805 CATGGATGCCACTGGGAAGCAGG - Intergenic
1052712150 9:32069982-32070004 GATGGCTCTCAGTGGGATGGGGG - Intergenic
1053256923 9:36625505-36625527 CATGCCTATCCCTGGGAAGGAGG - Intronic
1053257276 9:36628294-36628316 CATGCCTATCCCTGGGAAGGAGG + Intronic
1058377194 9:104336489-104336511 CATGGTTATCAGGTGGGAGCTGG - Intergenic
1059303206 9:113332167-113332189 CAGGGCTGTAAGTGTGAAGCAGG - Intronic
1059418311 9:114175486-114175508 CGTGGCTAGCACTGGGCAGCCGG + Intronic
1059429129 9:114239655-114239677 AATGGCCCTCACTGGGAAGCAGG + Intronic
1186561466 X:10618091-10618113 TCTGGCTATCAGTGGCAGGCAGG + Intronic
1193178862 X:78429762-78429784 AAGGGCTATCATTGGGAAGAAGG + Intergenic
1197655510 X:129112389-129112411 CATGGCTTTCAGTGTATAGCTGG - Intergenic
1201329404 Y:12801848-12801870 CATAGCTAACACTTGGAAGCAGG - Intronic