ID: 948127727

View in Genome Browser
Species Human (GRCh38)
Location 2:235576989-235577011
Sequence TTTGGGGTATGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 1, 1: 1, 2: 5, 3: 56, 4: 638}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948127727 Original CRISPR TTTGGGGTATGGAGGGAAGA TGG (reversed) Intronic
900001393 1:16779-16801 TGTGGGGTGTCTAGGGAAGAAGG + Intergenic
900021113 1:187301-187323 TATGGGGTGTCTAGGGAAGAAGG + Intergenic
900388787 1:2424362-2424384 TTTGGGGAATGGGGAGATGATGG - Intergenic
900943170 1:5814293-5814315 GTTGGGGTTTGGGGCGAAGAGGG + Intergenic
900993386 1:6107989-6108011 GATGGGGGATGGAGGGATGAAGG + Intronic
902114143 1:14107080-14107102 TGTGAGGGAGGGAGGGAAGAGGG - Intergenic
902255285 1:15185042-15185064 TTTGGGGTGTGGGGGTCAGATGG - Intronic
902589777 1:17465528-17465550 TATGGGGGATGAATGGAAGATGG + Intergenic
902688858 1:18097035-18097057 ATTGGGTTTTGGAGGGCAGAAGG - Intergenic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
903754959 1:25654135-25654157 GTTGGGGGATGAAGGGATGAAGG - Intronic
904226998 1:29029945-29029967 TCAGGGGTATGGAGAGAAAAAGG + Intronic
904999075 1:34654039-34654061 TTTGGGGTATTGTGGGGAGAGGG - Intergenic
905281071 1:36849793-36849815 GTTGGGGAATAGAGAGAAGATGG + Intronic
905417334 1:37812954-37812976 TTTGGGGAAGGGAGTGCAGAAGG + Exonic
906409839 1:45569595-45569617 ATTGGGGTTGGGAGGGAAGTCGG + Intronic
906702352 1:47869047-47869069 TTTGGGGGAAGGAGGGAGGGAGG - Intronic
906808765 1:48805212-48805234 TTTGGGGTAGGGAGTGCACAGGG + Intronic
907954403 1:59214614-59214636 TTTGGGGGAGTCAGGGAAGAGGG - Intergenic
908215695 1:61949352-61949374 TTTGGGGGGTGGTGGGAAGTGGG + Intronic
909277411 1:73705355-73705377 TTTGGGGGATGGAATGGAGAAGG + Intergenic
909342092 1:74543647-74543669 TTTTGGGTTTGGAGTAAAGAGGG - Intronic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909609489 1:77537472-77537494 TATGGGGAATGGATGCAAGAAGG + Intronic
910122880 1:83809719-83809741 TTTGGGGTAAGGAGGAGAGGGGG + Intergenic
911869144 1:103070535-103070557 TCTGGGGTTAGGATGGAAGAAGG + Intronic
912394867 1:109334525-109334547 CTTGGGGTATGGGGAGATGAAGG + Intronic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912663873 1:111561505-111561527 ATTGGGGGAAGGAGGGAGGAAGG + Intronic
912734011 1:112134017-112134039 TTTGGGGTGTGGAGATGAGAGGG + Intergenic
912954882 1:114148394-114148416 TTTGGGGTGAGTAGGGAAAATGG - Intronic
913199108 1:116482052-116482074 TCTGGGGTGTGAAGGGATGAGGG - Intergenic
915011621 1:152692045-152692067 TTTGAGGAGTGGAGAGAAGAAGG + Intergenic
915420059 1:155773329-155773351 TTGGGGGGATGGTGGGCAGATGG - Intronic
915594905 1:156891203-156891225 TTTGGGGTGGGGAGTGAAAATGG + Intergenic
915655126 1:157353027-157353049 CTTGGGGGATTGAGGGAGGAGGG - Intergenic
916070736 1:161168232-161168254 GGTGGGGTATGAAGAGAAGAGGG - Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
917198727 1:172493646-172493668 TTTGGGACATGGGGGTAAGAGGG + Intergenic
917485156 1:175448861-175448883 TTTTTGGCATGGAGGGAAGCAGG - Intronic
917840496 1:178973681-178973703 TGAGGGGTAAGGAGGGATGAGGG + Intergenic
919548359 1:198951673-198951695 TTTGGGGAATGGAGGGTAGAGGG - Intergenic
919881454 1:201903772-201903794 TTTTGGGAAAGGAAGGAAGAGGG - Intronic
920267329 1:204733811-204733833 TTTGGAGTAAAGAGGGCAGAGGG + Intergenic
920341317 1:205276725-205276747 CTTGGGGTATGGGGGGACCAAGG - Intergenic
920605873 1:207384338-207384360 TTTGGAGTGTCAAGGGAAGAAGG - Intergenic
921158437 1:212455791-212455813 TTTGGGGTGAGGTGGGAGGAAGG + Intergenic
921221727 1:212978458-212978480 TTTGGGGCGTGGAGGGAGGAGGG - Intronic
921363576 1:214353074-214353096 TTGGGGGGATGGAGGGTACAGGG - Exonic
921603542 1:217132930-217132952 TTCGGGGTATGGAAGGGAGGTGG - Intronic
922483488 1:225955770-225955792 TGTGGGGAATGGAGGAAAGGAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923402661 1:233629832-233629854 TCTGGGGCACGGCGGGAAGAGGG + Intronic
923523825 1:234757315-234757337 TTTGGTGTATAAAAGGAAGAAGG + Intergenic
924057658 1:240139744-240139766 TGTAGGGTGTGGTGGGAAGATGG + Intronic
924337912 1:243001584-243001606 TTTGAGATAGGGAGGGAAGTGGG + Intergenic
924374708 1:243393221-243393243 TTTGGGGTAAGGATGGTAGCCGG + Intronic
924411050 1:243806065-243806087 TTTTGGGTGAGAAGGGAAGAAGG - Intronic
924536126 1:244937218-244937240 TGTGGGGGATGGAGGGATGGAGG + Intergenic
924592774 1:245419481-245419503 TTTGGGGGAGGGAGGCAAGAGGG - Intronic
924642822 1:245850049-245850071 CTTGGGGTTTGGGGGGAAAAAGG + Intronic
1063459337 10:6205283-6205305 TTACTGGAATGGAGGGAAGAAGG + Intronic
1064134867 10:12741852-12741874 TTTGGGACAAGGAGGGAGGATGG + Intronic
1064219959 10:13431897-13431919 TTTGGTGGATGGATGGATGATGG + Intergenic
1064474639 10:15674243-15674265 TATGTGGGATGGAGGAAAGAGGG - Intronic
1064646441 10:17464702-17464724 TTTGGGGAATGGAGGGGAAGTGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067061929 10:43082082-43082104 CTTGGGGAATGGAGGGGAGCGGG - Intronic
1068256158 10:54514985-54515007 CTTGGGGGATGGAGCCAAGATGG + Intronic
1068554137 10:58439276-58439298 TCTGGGATATCCAGGGAAGATGG + Intergenic
1069489239 10:68847384-68847406 TTTGGGGATTGGAAGGTAGAAGG + Intronic
1069647055 10:70008066-70008088 TCTGGGGGGTGGAGGCAAGAAGG - Intergenic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1070360714 10:75686000-75686022 TTTGAGGCATGGAGAGACGAAGG + Intronic
1070816419 10:79327514-79327536 TTTGGGGAACGGAGGGATGGGGG + Intergenic
1071110167 10:82146684-82146706 GTTGGGGTATGGAAGGAGGTGGG + Intronic
1071377055 10:85017305-85017327 ATTGGGGAATGAAGAGAAGATGG - Intergenic
1071968180 10:90874075-90874097 TTTGAGGGAGGAAGGGAAGAAGG + Intronic
1072382890 10:94893500-94893522 TTTGGTGAGTGGAGAGAAGAAGG + Intergenic
1072939079 10:99743305-99743327 TTTGGGGCATTGACTGAAGATGG + Exonic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073170975 10:101508551-101508573 TTTGGAGTAGGGTGGGAAGTGGG - Intronic
1073320261 10:102611915-102611937 TTTGGGGGCTGGAAGGGAGAGGG - Intronic
1073434153 10:103506094-103506116 GTTGGGGTAAGGACGGAAAAGGG + Intronic
1073821987 10:107274599-107274621 TTTGGGGAATGGAGCGAGAAAGG + Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1075148053 10:119900026-119900048 TGAGGGGAAGGGAGGGAAGAGGG - Intronic
1076046903 10:127301455-127301477 TTTGGTGGAGGGAGGAAAGAAGG + Intronic
1076508451 10:130994260-130994282 TTTGGGGTGGGGAGGGCAGGGGG + Intergenic
1077542414 11:3153386-3153408 TTTGGGATATGCACGGAACAGGG + Intronic
1077874989 11:6296502-6296524 GGTGGGGTAGGGAGGTAAGAGGG - Intergenic
1078930887 11:15911373-15911395 TTGGAGCCATGGAGGGAAGAAGG + Intergenic
1079142341 11:17820238-17820260 TTTGGGGGAGGGAGGGCAGTGGG - Intronic
1079823337 11:25159834-25159856 TTTGGGAAACGGAGGAAAGATGG - Intergenic
1079975920 11:27091445-27091467 TTTGGGGGAGGGAGGAAGGATGG - Intronic
1080146450 11:28990671-28990693 GGTGGGGGAGGGAGGGAAGAAGG + Intergenic
1080373333 11:31678018-31678040 ATTGGGGGAGGGAGGAAAGAAGG - Intronic
1080479963 11:32637578-32637600 TTTGGGGGCAGGAGGGGAGAGGG - Intronic
1080678457 11:34450018-34450040 TTTGGGATGTGGGGGGAAGCTGG + Intronic
1081139280 11:39477556-39477578 TTTCAGGTAGGGAAGGAAGAAGG + Intergenic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082273774 11:50199892-50199914 TTATGGGTATGGAGCCAAGATGG - Intergenic
1083155433 11:60820106-60820128 TGTGGGGAATGGAGGTAAAAGGG - Intergenic
1083521737 11:63320123-63320145 TTGGGGGGATGGAGCCAAGATGG + Intronic
1083610689 11:64002844-64002866 CTTGGGGTGGGGTGGGAAGAGGG - Intronic
1083719699 11:64598208-64598230 TGTGGGGTCTGGAGGGAGGCAGG + Intronic
1085652692 11:78282687-78282709 TATGGGGTAGGTAGGGAAAATGG - Intronic
1085967109 11:81540403-81540425 TTTGGGGGGTGGAGCCAAGATGG - Intergenic
1086064488 11:82732161-82732183 TTTGGGGTATGGGGTGGGGACGG - Exonic
1086453684 11:86941339-86941361 TTTGTGGGAAGGAGGGTAGAGGG + Intronic
1086719905 11:90106897-90106919 GTTGTGGCATGGAGGGAGGAGGG + Intergenic
1086993714 11:93332909-93332931 TTTGGGGAATGAAGGGGTGAAGG + Intronic
1087624373 11:100580243-100580265 TTAAGGGTGTGTAGGGAAGAAGG - Intergenic
1088005350 11:104933054-104933076 TTTGGGGCATGAAGGGGAAAGGG + Intergenic
1088597990 11:111454212-111454234 TGTGGGGGTCGGAGGGAAGAAGG - Intronic
1089187075 11:116625389-116625411 TTAGGGAGAAGGAGGGAAGAAGG - Intergenic
1089328288 11:117672386-117672408 TTTGGGGAGTGGGGGGAAAATGG - Intronic
1089756323 11:120690155-120690177 TTTAGGGTCTGGAGTGACGAGGG - Intronic
1089771405 11:120805824-120805846 TTTGGGGAAGGAAGGGAGGAGGG + Intronic
1090096966 11:123751955-123751977 TTTGGGTCATGACGGGAAGAAGG - Intergenic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090573831 11:128078159-128078181 TTTGGGGGGTGGAGCCAAGATGG - Intergenic
1090918271 11:131186241-131186263 TTTGGGGGATGGTGGGGGGAAGG - Intergenic
1090947845 11:131447753-131447775 TTGGGGGAAGGGAGAGAAGAGGG + Intronic
1091374482 12:16894-16916 TGTGGGGTGTCTAGGGAAGAAGG + Intergenic
1091880605 12:3974392-3974414 AGTGAGGTATGCAGGGAAGAAGG + Intergenic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1093183258 12:15990597-15990619 TTTGGAGTTTGGAGGGTGGAAGG - Intronic
1094035206 12:26062932-26062954 TTTGGGGTATAGCTGGAAGTTGG - Intronic
1094119893 12:26960652-26960674 TTTGGGGTGTGGATGGAAGGGGG + Intronic
1094497160 12:30995488-30995510 TGTGGGGTGTGGGGGGAATATGG + Exonic
1095252775 12:39998368-39998390 TTTGGGGACTTGAGGGAAAAGGG + Intronic
1096177954 12:49535380-49535402 GTTGGGGGCTGGAGGAAAGATGG + Intergenic
1096635081 12:52953017-52953039 ATTGGGGTGTAGAAGGAAGAGGG + Intergenic
1096760295 12:53836137-53836159 AGTGGGGAATGGAGGGAAGCCGG + Intergenic
1096919104 12:55065191-55065213 ATTGGGGTATCTTGGGAAGAGGG + Intergenic
1097046356 12:56189893-56189915 TTTGGGGTTTTGGGGGACGAGGG - Intergenic
1097260921 12:57719874-57719896 TATTGGGTAGGGCGGGAAGATGG + Intronic
1097926936 12:65139276-65139298 TTTGGGGGATGGAGGGATGGGGG - Intergenic
1098830530 12:75355975-75355997 TTGGGGGTAGGGTGGGGAGAGGG + Intronic
1098957945 12:76706848-76706870 TTTGGGGAGAGGAAGGAAGAAGG + Intergenic
1100677393 12:96882132-96882154 GTAGGGGTTTGGAGAGAAGAGGG + Intergenic
1101252899 12:102952697-102952719 TTTGGGATAAGGAGGGAATGTGG - Intronic
1101682488 12:106983314-106983336 ACTGGTGTCTGGAGGGAAGAGGG - Intronic
1101900934 12:108790620-108790642 TTTGTGGTAGGCAGGGAAGTGGG + Intronic
1102360590 12:112284368-112284390 TGTGGGGTGTGGAGATAAGAGGG + Intronic
1102544199 12:113642775-113642797 TTTGAGGGAGGGAAGGAAGAAGG - Intergenic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1104323581 12:127774625-127774647 CCTGGCGTGTGGAGGGAAGACGG - Intergenic
1104463658 12:128973695-128973717 TTTGGGGGTTGGTGGGGAGAAGG - Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105312885 13:19229017-19229039 TTTGGGGTAGGGAGGTGAGGAGG + Intergenic
1105364646 13:19753674-19753696 TTTGGGGTAGGGAGGTGAGGAGG + Intronic
1105724702 13:23150704-23150726 TTTTGTGTATGGTAGGAAGAAGG + Intergenic
1106295427 13:28409231-28409253 TTTTGAGTGTGGTGGGAAGAGGG - Intronic
1106353512 13:28956944-28956966 GTTGGGGGACAGAGGGAAGAAGG + Intronic
1107205919 13:37788258-37788280 TTTGTGACATGAAGGGAAGAAGG - Intronic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1108321055 13:49290997-49291019 TCTGGGGACTGGAAGGAAGACGG - Intronic
1108394905 13:49982518-49982540 TGTGGGGTATGCAGGGAAGAAGG + Intergenic
1108482310 13:50886426-50886448 GTTCAGGGATGGAGGGAAGAGGG + Intergenic
1109924920 13:69124155-69124177 TTGGGGGAATGGTGGGAGGAGGG + Intergenic
1110000545 13:70193908-70193930 TTGGGGGTATGGGGGGCAAAAGG - Intergenic
1110160628 13:72373972-72373994 TTTTGTGTGTGGAGGGATGATGG + Intergenic
1110321368 13:74163582-74163604 TGTGGGGGTTGGAGGGAAGGTGG + Intergenic
1111527580 13:89492279-89492301 TCTGGGGTCTGGAGGACAGATGG + Intergenic
1111791749 13:92865502-92865524 TGTGGGGAAGGGAGGGGAGATGG + Intronic
1111921339 13:94414692-94414714 TTTGGAGTATGGAGTGGGGATGG - Intergenic
1111941722 13:94615824-94615846 TTTGGGACATGGAGGAAAAAAGG - Intronic
1113263479 13:108592177-108592199 TGTGGGGTATGGAGGGGTGTGGG + Intergenic
1113294337 13:108941335-108941357 TTTGGGGCATGGCAGGAAGTAGG - Intronic
1113330604 13:109323334-109323356 TTTGGGGACTTGGGGGAAGAAGG + Intergenic
1114455303 14:22849864-22849886 TTTGGGGTCTGGAGGGGTGTGGG - Intergenic
1115792810 14:36898664-36898686 ATTGGGGGATGGAGCCAAGATGG - Intronic
1116225145 14:42141040-42141062 ATTGGGGTATGGAAGGTAGTAGG + Intergenic
1116923485 14:50607399-50607421 TGTGGGTTATGGAAGCAAGATGG + Intronic
1118105327 14:62652726-62652748 TTTGGGGTGGGGAGAGATGAGGG - Intergenic
1118774087 14:68962529-68962551 GCTGGGGTGTGGAGGGAGGAGGG - Intronic
1118837305 14:69485936-69485958 TGGGAGGTATTGAGGGAAGAGGG + Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119315793 14:73693312-73693334 TTTGGGGTATGTAGTTAGGAGGG - Intronic
1119471697 14:74904427-74904449 TTCGGGCCATGGTGGGAAGAGGG - Exonic
1119663852 14:76470278-76470300 TTTGGTTTGTGGAGGGAAAAAGG - Intronic
1120038379 14:79724428-79724450 TGTGGGGCAGGGAGAGAAGAGGG - Intronic
1120602147 14:86523986-86524008 TTTGGGGTGTGGGGGGAGGAGGG + Intergenic
1121596241 14:95165381-95165403 ATTGGACAATGGAGGGAAGATGG - Intergenic
1121975092 14:98396098-98396120 TTGGGGGTGGGGAGTGAAGAGGG - Intergenic
1122316498 14:100828523-100828545 GGAGGGGTATGGAGGGAGGAAGG - Intergenic
1122491777 14:102122114-102122136 TTTGGAGTGAGGAGGGAAGTAGG + Intronic
1122625276 14:103082337-103082359 GTTGGGGTATTGATGGTAGATGG + Intergenic
1122779959 14:104139349-104139371 CTTGGGGCTTGGAGGGAAGCAGG + Intronic
1122864033 14:104595514-104595536 TGTGGGGCATGGGGGGCAGAGGG - Intronic
1122864065 14:104595629-104595651 TGTGGGGCATGGGGGGCAGAGGG - Intronic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1123758372 15:23414523-23414545 TTTGGGGTGAGGTGGGGAGATGG - Intergenic
1124550066 15:30672026-30672048 TTAGGGATATTGGGGGAAGAGGG + Intronic
1125100650 15:35908377-35908399 TTTCAGGTATGGAGGCAAGCTGG + Intergenic
1125202083 15:37108955-37108977 TATGGGGTGTGGAGGGGAAAGGG + Intergenic
1125300714 15:38252015-38252037 TTTGGGAAATGAAGGGAGGAGGG + Intergenic
1125301194 15:38254352-38254374 TTTGGGGTGGGGAGGGAGTAAGG - Intronic
1125434495 15:39630525-39630547 GGTGGGGCATGGAGGGAACAGGG + Intronic
1126326469 15:47483124-47483146 TTGGGGGCATGGAGGGAATTTGG + Intronic
1126419044 15:48452134-48452156 TTTGGGGTATGCAGCCAAGATGG + Intronic
1126825372 15:52543043-52543065 GGTGGGGTATGAAGGGAAGAGGG - Intergenic
1128557456 15:68641434-68641456 TTTGGGGGAGAGAGGAAAGAAGG + Intronic
1128611741 15:69079359-69079381 TGAGAGGTCTGGAGGGAAGAGGG + Intergenic
1129273660 15:74432449-74432471 TCTGGGTTAGGGAGGGGAGAAGG - Intronic
1130414015 15:83673064-83673086 TTTGGTGCATGGAGCAAAGAAGG + Intronic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131159974 15:90099333-90099355 TTTTCGGTATTGGGGGAAGAGGG - Intronic
1131360686 15:91788194-91788216 TTCGGGGGGTGGAGGGAAGTGGG - Intergenic
1131446577 15:92503090-92503112 TCTGTGGGATGGGGGGAAGATGG - Intergenic
1132019729 15:98350131-98350153 GGTGGGATATGGAGGAAAGAGGG + Intergenic
1132108358 15:99082986-99083008 TTTGGGGTATGGTGTGAGGTAGG - Intergenic
1132322776 15:100938560-100938582 TGTGGGGGAAGGAGGGAGGATGG - Intronic
1132454779 16:16462-16484 TGTGGGGTGTCTAGGGAAGAAGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133211899 16:4267957-4267979 TTTGGGGAAGGGAGGGAGGCAGG - Intronic
1133605048 16:7378695-7378717 TTTGGCGGATGCAGGGAAAAAGG - Intronic
1133895887 16:9928547-9928569 TTTGGGGTCTGGAGAGATGAGGG - Intronic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1134457966 16:14408358-14408380 TTTGGGGTGAGGTGGGGAGATGG + Intergenic
1134656327 16:15950376-15950398 TTTGGGGGAACCAGGGAAGAAGG + Intronic
1134836319 16:17364080-17364102 TTTGAGGTATTGGGGGAGGAAGG + Intronic
1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG + Intronic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136548216 16:30967080-30967102 TGTGGGGTAGGGTGGGGAGAGGG + Intronic
1136668721 16:31836941-31836963 TTTGTGGAATGGAGGGGAGGGGG + Intergenic
1136673313 16:31876986-31877008 TTTGGGGTTGGGATGGAAGGAGG + Intronic
1136928391 16:34396361-34396383 TTTGGTGGATGGATGGATGATGG - Intergenic
1136976183 16:35015443-35015465 TTTGGTGGATGGATGGATGATGG + Intergenic
1137351141 16:47714775-47714797 TTTGGGGTATGGGAGAAAAAGGG - Intergenic
1137826044 16:51496191-51496213 TTTGGTGTGGGGAGGGAGGACGG + Intergenic
1138239503 16:55415688-55415710 CTTGGAGGATGGAGGGCAGATGG + Intronic
1138722439 16:59097559-59097581 TTTGACGAATGGAGAGAAGAAGG + Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139344043 16:66290502-66290524 TTTGGGGTCCTGAGGGGAGATGG - Intergenic
1139897735 16:70301057-70301079 ATTGGGGAATAGAGGGAACAGGG + Intronic
1140104162 16:71944013-71944035 TTTTGGGTATGGAGAGGAAATGG - Exonic
1140890203 16:79278655-79278677 TTTGGGGTTTCGTGGGTAGAAGG + Intergenic
1141113075 16:81286357-81286379 CTTGGGGTATGGAGGGGTGGAGG - Intronic
1142285232 16:89168903-89168925 TGTGGGGCGTGGAGGGCAGAAGG - Intergenic
1142399740 16:89852594-89852616 TCTGGGGGGTGGAGGGAGGATGG - Intronic
1143362726 17:6384697-6384719 TGTGGGATGTGGAGGGAGGAAGG - Intergenic
1143431967 17:6894270-6894292 TTTGGGGTCTTCAGGGAGGACGG - Intronic
1143671369 17:8398136-8398158 ATAGGGGTGTGGGGGGAAGATGG - Intergenic
1143801370 17:9384929-9384951 TTTTTGGTATGGAGAGAAAAGGG - Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144249694 17:13403256-13403278 TTTGAGGAAGTGAGGGAAGAGGG - Intergenic
1144511820 17:15883532-15883554 ATTGGGGTATTCAGAGAAGAAGG + Intergenic
1145123307 17:20279842-20279864 GTTGGGATATGGAGAGGAGAAGG + Intronic
1145742274 17:27285325-27285347 TTGGGGGTAAGGAGAGGAGAGGG + Intergenic
1145772598 17:27504409-27504431 GTTGGGATATGGGGGGGAGAAGG + Intronic
1146125839 17:30230711-30230733 GGTGGGGCATGGAGGGGAGAAGG + Intronic
1146147649 17:30435481-30435503 TTTGGGGTGTGGTGTGAGGAAGG - Intronic
1146285052 17:31568669-31568691 CTTGGGGTAAGAAGGCAAGAGGG - Intergenic
1147169204 17:38608412-38608434 TTTGGGGAAGAGAGGGCAGAAGG - Intergenic
1147178633 17:38671936-38671958 GTTGAGGTATGAAGGGAAGCTGG - Exonic
1147261841 17:39213409-39213431 TTTGGGGCCTGGAGAGAAGGTGG + Intronic
1147555110 17:41473713-41473735 TCTGGGGTATGTCGTGAAGATGG + Intergenic
1148157569 17:45432504-45432526 TCTGGGGGCTGGAGGGAAGCAGG - Intronic
1148384243 17:47222856-47222878 TTTGGGGGTTGGTGGGGAGAAGG - Intronic
1148439370 17:47703636-47703658 TTCGGTTTAAGGAGGGAAGATGG - Intronic
1148805247 17:50260694-50260716 TGTGGGCCTTGGAGGGAAGAAGG - Intergenic
1148862660 17:50612726-50612748 TTCGGGGCAGGGAGGGAGGAAGG - Intronic
1148896568 17:50842459-50842481 TTTGGGGGATGGAGAGATGCTGG + Intergenic
1148969822 17:51470066-51470088 TTTGGGGGGTGGGGGGAGGAAGG - Intergenic
1149059928 17:52409847-52409869 TTTGGGGGAAGGAGCCAAGATGG - Intergenic
1149896582 17:60433086-60433108 TCTGGGGTCTGGAGGGCAGTGGG + Intergenic
1149999382 17:61423957-61423979 TGTGGGGTACAGAGGGAATATGG + Intergenic
1150078990 17:62219727-62219749 TTTGTGAGATGGAGGGAAAATGG - Intergenic
1150228804 17:63538692-63538714 GTTGGGGATTGGATGGAAGAGGG + Intronic
1150831550 17:68525212-68525234 TTTGGGAGATGGAGGCAAGAGGG + Intronic
1151717904 17:75840701-75840723 GTTGGGGGATGGAGGGCAAAAGG + Intronic
1152100986 17:78301700-78301722 TCTGGGCTATGCCGGGAAGAGGG - Intergenic
1152210664 17:79001447-79001469 TGTGGGGTCTGGAGGTAAAATGG - Intronic
1153002929 18:472817-472839 TTTGAGGGAGGGAGGGAATAAGG + Intronic
1154030112 18:10746151-10746173 TTTGTGGTATGGAGAATAGATGG - Intronic
1155219420 18:23671059-23671081 TTTGCGGGATGGAGGGGAGAAGG - Intergenic
1155891895 18:31280453-31280475 TATGGGGTATGAAAGAAAGAGGG - Intergenic
1156350078 18:36296291-36296313 TTTGGGGGAGGAAGGGCAGATGG - Intergenic
1157481406 18:48056717-48056739 TTTGGTGTAAGGAGTGAGGAAGG - Intronic
1157639679 18:49202035-49202057 TGTTGGGTAAGAAGGGAAGATGG - Intronic
1157687602 18:49655176-49655198 TTTGGAATATAGAGGGCAGAAGG + Intergenic
1157979322 18:52362793-52362815 TTTGGTTTATGGAGGGAGGAGGG - Intronic
1158471755 18:57743333-57743355 TGTGGGGAAGGGAGGGAAGTAGG - Intronic
1158661366 18:59391325-59391347 AATGGGGTAGGGAGAGAAGAAGG - Intergenic
1159568236 18:70081158-70081180 TTTGGGGACTTGAGGGAAAAGGG + Intronic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1160319261 18:77875102-77875124 TTTGGGGGTGGGAGGGCAGACGG - Intergenic
1161664260 19:5565354-5565376 TGTGGGGGATGCAGGGAAGGTGG - Intergenic
1161894904 19:7072988-7073010 TTTGGACTTGGGAGGGAAGAGGG + Intronic
1163038106 19:14583299-14583321 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163038795 19:14587556-14587578 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163039541 19:14592223-14592245 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163054237 19:14706360-14706382 GTTGAGGGGTGGAGGGAAGATGG - Intronic
1163108577 19:15142580-15142602 TTTGGTGTGTGGAAGGAAGATGG + Intergenic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163590403 19:18190575-18190597 ATTGGGGGAAGGAAGGAAGAAGG + Intergenic
1165662538 19:37594419-37594441 TTTGGGATAGGGAGGCTAGAAGG - Intronic
1165922122 19:39305661-39305683 TTGGGGGGATGGAGGGACTACGG + Intergenic
1166023360 19:40054220-40054242 TGTGGGTGAGGGAGGGAAGATGG + Intronic
1167166522 19:47803131-47803153 CCTGGAGAATGGAGGGAAGAGGG + Intronic
1167269908 19:48500882-48500904 TGAGGGGTATGGAGGGCAAACGG + Intronic
1167454877 19:49592790-49592812 TTTGGGGGGTGGAGAGAAGAGGG - Intronic
1167635610 19:50653438-50653460 TTTGAGGGATGGAGGGAGGCCGG + Intronic
1167956891 19:53073121-53073143 GTTGGGGACTGGAGGGAATAGGG - Intronic
1167991566 19:53365505-53365527 TTTGGGTTTTGGAGGCGAGATGG - Intergenic
1168438277 19:56340027-56340049 TTTTGGGTTTGGATGGAGGAGGG - Intronic
925120769 2:1416010-1416032 CTTGGGGCATGGATGGAAGCTGG - Intronic
925291327 2:2750430-2750452 TGTGGTGTATGGGGGGATGATGG + Intergenic
925291524 2:2751461-2751483 AGAGGGGTCTGGAGGGAAGAGGG - Intergenic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
925981202 2:9178882-9178904 TTTGGGGTGCTGAGGGGAGAAGG + Intergenic
926112400 2:10191720-10191742 TGCGGGGTCTGGAGGGAACACGG + Intronic
927024873 2:19056792-19056814 AGTGGAGTATGGAGAGAAGAAGG + Intergenic
927589332 2:24339566-24339588 GGTGGGGTAGGGAGGAAAGAGGG + Intronic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
927939420 2:27094409-27094431 TTTGGGGACTGGAGGGTAGCTGG - Intronic
928572451 2:32623038-32623060 TTTGGGGTATGGAGACAACCAGG - Intergenic
929171615 2:38937950-38937972 TTTGTGATATGAAGGGAAGGAGG - Intronic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
930769533 2:55117819-55117841 TTTGGGGTAGGGAAGGGAGTTGG + Intergenic
930837860 2:55814029-55814051 TTTGGGGGGTGGAGCAAAGATGG + Intergenic
931090674 2:58882715-58882737 GTTGGGGGATGGGGGGAAAAGGG + Intergenic
931854620 2:66288965-66288987 TTGGGGGGATTGAGGGGAGATGG - Intergenic
932010397 2:67971958-67971980 TTTAGGATGTGGAGAGAAGAAGG - Intergenic
933583647 2:84155795-84155817 TTTTGAGTATAGAGTGAAGAAGG + Intergenic
934040524 2:88124378-88124400 TTTGGGGGTTGGAGGGTGGAGGG + Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935436742 2:103043840-103043862 TTGGGGACATGGGGGGAAGAGGG + Intergenic
935618692 2:105110563-105110585 TGTGGGATCTGCAGGGAAGAAGG + Intergenic
935723599 2:106001585-106001607 TTTTGTGTATGAAGTGAAGAAGG + Intergenic
936568331 2:113596635-113596657 TGTGGGGTGTCTAGGGAAGAAGG - Intergenic
936971090 2:118177058-118177080 TCTGGGGTAGGGAGGGGAAATGG - Intergenic
937092801 2:119217747-119217769 TTTGGGGCCTCCAGGGAAGAGGG - Intergenic
937416993 2:121723320-121723342 TTTGGGATGAGGAGGGAAGACGG + Intergenic
937437331 2:121891223-121891245 TTTGGTATCTGAAGGGAAGAGGG + Intergenic
937926627 2:127172692-127172714 TTTGTTGTTTGGAGGGATGATGG + Intergenic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
940589932 2:155710077-155710099 TTTGGGGTAAGGAAGACAGAGGG + Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
940864408 2:158803729-158803751 TTTGGGGTCTGGATGGAAGGTGG + Intronic
941114323 2:161454277-161454299 TGGGAGGGATGGAGGGAAGAAGG - Intronic
942002193 2:171659043-171659065 TTTGGGGTATGGTGTGAGGTAGG + Intergenic
942245293 2:174002639-174002661 GCTAGGGTTTGGAGGGAAGAAGG + Intergenic
942255521 2:174093205-174093227 TTGGGGATTTGGTGGGAAGATGG + Intronic
943360385 2:186911817-186911839 TTTGGGTTCTGGGGTGAAGAAGG - Intergenic
944207840 2:197175560-197175582 TTTGGGGGAGGGAGGGAGAAGGG - Intronic
944486829 2:200215686-200215708 AGTGGGGAAGGGAGGGAAGAGGG - Intergenic
944732321 2:202529336-202529358 ATTTGGGTATGGAGGGAGGGTGG - Intronic
944996185 2:205296722-205296744 TTTTGGGAATGGAGGGTAGTAGG + Intronic
945042092 2:205751055-205751077 TTTGTTTTATGGAGAGAAGAAGG + Intronic
945694065 2:213080347-213080369 TTTGGGATATGGAGGCACAAAGG + Intronic
946037831 2:216757869-216757891 TTTGGGGGCTGGGGAGAAGATGG + Intergenic
946075604 2:217071152-217071174 TTTGTGGTCTGGAGGGGAGGTGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946204666 2:218095329-218095351 TTTTGGTGATGCAGGGAAGAAGG - Intergenic
946333228 2:219022031-219022053 TTTGGGGTATCCGGGGCAGAGGG + Intronic
946353240 2:219169113-219169135 TTTGGGGCATGGAGAAGAGAAGG + Intronic
947190253 2:227497159-227497181 TGTGGGGTGGGGGGGGAAGAGGG - Intronic
947266581 2:228288977-228288999 TTTGAGGAATGGAGGAGAGAAGG + Intergenic
947751670 2:232535785-232535807 TCTGGGGTCTGGAGGGAGGGAGG - Exonic
947755501 2:232561063-232561085 CTTGGAGTTTGGAGGAAAGAAGG + Intronic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948686926 2:239675695-239675717 TTTGGGGAGTGGGTGGAAGATGG - Intergenic
948712545 2:239833923-239833945 TCTGCGGTAGGGAGGGAAGGAGG - Intergenic
948885712 2:240882988-240883010 TTTGGGAGATGCAGTGAAGAAGG - Intergenic
1168869826 20:1118738-1118760 TTCGGCGTCTGGAGGAAAGAAGG - Exonic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1169700736 20:8443845-8443867 ATTGGGGTAGGGGTGGAAGAAGG - Intronic
1170508428 20:17052895-17052917 TTTGGGGGTGGGAGGGTAGAAGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171308592 20:24127298-24127320 TTTGAGGAAAGGAGGGAGGAGGG + Intergenic
1172188153 20:33044327-33044349 CTTGGGATCTGGAGGGAAGCTGG + Intergenic
1172449007 20:35008722-35008744 TTTGGTGTGTGATGGGAAGAGGG - Exonic
1172850547 20:37959852-37959874 TTTGGGGGGTGGAGGGTGGAGGG + Intergenic
1172879261 20:38188113-38188135 TGTGGGGGATGGAGGGTGGATGG - Intergenic
1174281779 20:49445011-49445033 TCTGGGGAAAGGTGGGAAGAGGG - Intronic
1174411692 20:50340669-50340691 TTTGTGGTGAGAAGGGAAGAAGG + Intergenic
1174467391 20:50728793-50728815 TTGGGGGTGGGGAGGGATGATGG + Intergenic
1176949722 21:15030726-15030748 TAGGTGGTAAGGAGGGAAGAAGG + Intronic
1178899106 21:36584624-36584646 TTTGGCGTATTAAGGGAATAAGG - Intergenic
1179082447 21:38184469-38184491 TTTGATGTGTGGAGTGAAGAAGG - Intronic
1179383484 21:40920753-40920775 TTTGGATTTTGGAGGGAAGATGG + Intergenic
1179832439 21:44005832-44005854 TGTGGGGTAAGGAGGGAGGAGGG - Intergenic
1179925617 21:44532504-44532526 TTTGGGGTATGGTGGGAGAGAGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182151248 22:28028607-28028629 CTTGAGGTAGGAAGGGAAGAAGG + Intronic
1183265057 22:36819686-36819708 TTTGGGTGCTGGAGGGAAGCAGG - Intergenic
1183390017 22:37540391-37540413 TTTGGGTTTTGGGGGGAAGTAGG - Intergenic
1183484920 22:38083624-38083646 TTTGAGGTTTGGAGGGCAGAAGG - Intronic
1183966570 22:41446206-41446228 AGTGGGGTCTGGAGGGAAGCTGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184121217 22:42451745-42451767 AATGGGGAATGAAGGGAAGAGGG - Intergenic
1184924195 22:47625930-47625952 GTGGGAGTATGGAGGGCAGAGGG - Intergenic
1185104385 22:48859028-48859050 TTGGGGGTAGGAAGGAAAGATGG - Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949119397 3:367785-367807 TTTGGGGTGTGGAGGGCAAGGGG - Intronic
949863837 3:8530910-8530932 TGTGGAGTGTGGAGGGAAGCAGG - Intronic
949975140 3:9449697-9449719 TGTGGGATATGGAGGGGAGGAGG + Intronic
950551350 3:13668044-13668066 TTTGGGGTAGGGAGTGCAGCAGG + Intergenic
950595427 3:13976444-13976466 TCTGGGGGAGGTAGGGAAGATGG - Intronic
950628652 3:14267017-14267039 TTTGAGGAGTGGAGGGAGGAAGG + Intergenic
950903411 3:16516477-16516499 GATGGGGTCTGGTGGGAAGAAGG - Intergenic
951073973 3:18366831-18366853 TTTGGGGTCTAGAGCCAAGAAGG - Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
952551327 3:34481396-34481418 TTTGTGGGAGGGAAGGAAGAAGG - Intergenic
952701839 3:36336661-36336683 TTTGGGGAATTGAGGGCAGCTGG + Intergenic
952943849 3:38462955-38462977 GTTGGGGTGTGGAGGTAGGAAGG - Intronic
953272555 3:41459624-41459646 TTTAGGTTAAGGAGGGAAGTAGG + Intronic
953759297 3:45674253-45674275 CGTGGGGTGGGGAGGGAAGAGGG - Intronic
954648127 3:52143800-52143822 TTTAAGGTATGAAGGGAAGAAGG - Intronic
956560731 3:70571370-70571392 TTGGGGGCATGGAGAGAGGAGGG - Intergenic
957962555 3:87276684-87276706 TTTGGGGTAAAAAAGGAAGACGG - Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958093138 3:88903355-88903377 TTTGGGGTATGGTGTAAGGAAGG + Intergenic
958769803 3:98412562-98412584 GTTGTGGGATGGAGGGAAGGGGG + Intergenic
959095684 3:101952942-101952964 GTTGGGGTCTAGGGGGAAGAAGG - Intergenic
959780157 3:110221873-110221895 TTTAGGGTATGCAGGGTAAATGG + Intergenic
960214471 3:115014272-115014294 TTTGGGGTAGGGGGAGAAGTGGG + Intronic
960523066 3:118678261-118678283 TTTGGGGTTTGGAGGGTGTAGGG - Intergenic
962246678 3:133801159-133801181 TTTGGGGAGCGGATGGAAGAAGG + Intronic
962304821 3:134276633-134276655 TTTGGGCTAGGGAGAGAAGCTGG - Intergenic
962421751 3:135235002-135235024 TTCCAGGTATGGAGAGAAGAGGG - Intronic
963192454 3:142487843-142487865 TTTTGTTTATGGTGGGAAGAAGG + Intronic
963263711 3:143218137-143218159 TTAGGGGTGGGGAGGGAGGAGGG + Intergenic
963272964 3:143303384-143303406 TTTGAGGGAAGGAGGGAAGGAGG + Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963689193 3:148477389-148477411 TATGGAATCTGGAGGGAAGAGGG + Intergenic
964284819 3:155106656-155106678 TTGGGGGGATGGTGGGAGGAGGG + Intronic
964302440 3:155304037-155304059 TTTGGGGAATGGGGGTGAGAAGG - Intergenic
964691669 3:159456598-159456620 TTTGGGGGACAGAAGGAAGAGGG + Intronic
964908785 3:161752003-161752025 TTTGGGTTATGGTGGGAATATGG - Intergenic
965110957 3:164421623-164421645 TTTGGGGGATGGAGGGTAATGGG - Intergenic
965355620 3:167669493-167669515 TTGGGAGGATGGAGGGAGGAGGG + Intergenic
965692671 3:171374215-171374237 ATTGGGGTAAGGAGGATAGAGGG - Intronic
965993020 3:174844187-174844209 TTTTGTATATGGTGGGAAGAAGG + Intronic
966028629 3:175317561-175317583 ATTGGGATATGGAGAGAAGTAGG - Intronic
966039900 3:175470235-175470257 CCTGGGGTATGGAGGGAACGGGG + Intronic
966585923 3:181624294-181624316 TTTGTGGGATGGAAGGAAGGGGG + Intergenic
967142345 3:186571244-186571266 TTTGGGGGATGAGGGAAAGAAGG + Intronic
967338207 3:188368014-188368036 TGTGGGGAAGGGAGGGCAGATGG - Intronic
967493117 3:190115843-190115865 TTAGGTATTTGGAGGGAAGATGG + Intronic
967955890 3:194876918-194876940 CTTGGGGGATGCAGGGAAGCTGG + Intergenic
968238763 3:197055704-197055726 TCTGTGGTGTGGGGGGAAGAGGG + Intronic
968259192 3:197305760-197305782 TTTGGAGGAGTGAGGGAAGATGG - Intergenic
968676381 4:1883080-1883102 TTTGGGATAAGGAGAGATGAGGG + Intronic
970228035 4:13880122-13880144 TTTGAGGAATGAAGGGGAGAGGG + Intergenic
970423165 4:15923872-15923894 TTTTAGGTATGGAGGCAACATGG - Intergenic
970959429 4:21855812-21855834 TGTGGAAGATGGAGGGAAGAAGG - Intronic
971778411 4:30998371-30998393 GTTGAGGAATGGAGGGAGGAAGG + Intronic
971999288 4:34009353-34009375 TTTGGGGGATTGAGGGGACAGGG + Intergenic
972455083 4:39246364-39246386 TTTGGGGGGTGGAGCTAAGATGG + Intronic
973532435 4:51846145-51846167 TTTGGGGAATGGAGGGAGGTGGG - Intronic
973877939 4:55240509-55240531 TTTTGGGAATGGTGTGAAGAAGG - Intergenic
974281588 4:59801930-59801952 GTTGGGGGATGGAGAGAAGCAGG + Intergenic
975448947 4:74501756-74501778 TTTGTGGTTTAGAGGAAAGATGG + Intergenic
976124707 4:81820960-81820982 TATGGATTTTGGAGGGAAGAGGG - Intronic
976162150 4:82213855-82213877 TGTGGGGCAGGGAGGGAAGCAGG - Intergenic
976626675 4:87191757-87191779 TATGGGGGAAGGAGGGAAGGCGG - Intronic
976687885 4:87836024-87836046 TTGGGGGTATAGAGGGGACAAGG + Intronic
976713995 4:88103708-88103730 TGTGGGGAATGGAGAGATGATGG - Intronic
977027445 4:91836802-91836824 TTTGGGGAAGGGAGGGAGGATGG + Intergenic
977507225 4:97917143-97917165 TTCCAGGTATGAAGGGAAGATGG + Intronic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978113932 4:104996407-104996429 ACTAGGGTATTGAGGGAAGAAGG + Intergenic
980370594 4:131864469-131864491 CTTGGGGCATGGAGGGAAAGGGG + Intergenic
980836730 4:138203108-138203130 ATTGGGGTGGGGAGGGAAGAAGG - Intronic
981332832 4:143532669-143532691 TTTGGGGGGTGGAGGGAATAAGG - Intronic
982314084 4:154013605-154013627 TTTTGTGTATGGTGTGAAGAAGG + Intergenic
982808912 4:159802173-159802195 TTTGGGAAATGGAGGGATCAGGG - Intergenic
983116250 4:163820051-163820073 ATTGGGCTATGGAAGAAAGAAGG - Intronic
983537612 4:168874908-168874930 TTAGGGGTATGGAGGAGAGCGGG + Intronic
984151495 4:176138557-176138579 TTTGGTGATGGGAGGGAAGATGG - Intronic
986756378 5:10840137-10840159 TTTGGAAAGTGGAGGGAAGAAGG + Intergenic
986885526 5:12229656-12229678 GTTGAGGTAGGTAGGGAAGAGGG + Intergenic
987029098 5:13959621-13959643 CTTGGGGTAAGGAATGAAGAGGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987734219 5:21818519-21818541 TCTGGGGGAAGGAGGGAAGAAGG - Intronic
988460169 5:31428238-31428260 ATTGGGGGATGCAGGTAAGATGG + Intronic
989177678 5:38544563-38544585 TTTGGGGGAGGGAGGCAAGCAGG - Intronic
989188460 5:38646844-38646866 TTTAGGGAATTGAGGGAAGCAGG + Intergenic
989200706 5:38760088-38760110 TTTGGGGACTTGGGGGAAGAGGG + Intergenic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
990114999 5:52379341-52379363 TGTGGGGTTGGGGGGGAAGAGGG - Intergenic
990552028 5:56891194-56891216 TTTGGGGAAAAGAAGGAAGAGGG + Intronic
990700325 5:58467956-58467978 AGTTGGGTATGGAAGGAAGAGGG - Intergenic
991354581 5:65754672-65754694 TATGGGGTGTGGGAGGAAGAGGG - Intronic
992786198 5:80173044-80173066 TTTGGGGGATGGAGGAATGGGGG - Intronic
993762845 5:91818277-91818299 TTTTAGGTATGGAGGTAAGGAGG + Intergenic
994302425 5:98161182-98161204 TGAGGGGTATGAAGGGATGAAGG - Intergenic
994624352 5:102199612-102199634 TGTGTTGTGTGGAGGGAAGAGGG + Intergenic
997107538 5:131037439-131037461 TTTGGAGTATGGTGTGAAGTAGG - Intergenic
997468252 5:134102328-134102350 TTTGGGGTGGGGGGGGTAGAGGG - Intergenic
997750023 5:136335568-136335590 TTTGGCATCTGGATGGAAGATGG - Intronic
998292624 5:140929064-140929086 TCTGAGGTATGGAAGTAAGATGG + Exonic
998471865 5:142389874-142389896 TGTGGGGAATGCAGGGAAGCAGG + Intergenic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
998629051 5:143878304-143878326 ATTGGGGTGTGGTGGGGAGATGG - Intergenic
998817750 5:146031101-146031123 TTTGGGCCCTGTAGGGAAGAAGG + Intronic
999143535 5:149378294-149378316 CTTGGGGGATGGCTGGAAGAGGG - Intronic
999324952 5:150638078-150638100 TTTGGGGTATGGGGGTAGGTAGG + Intronic
999559140 5:152780962-152780984 TTTGGGGTATGAATGAAAGAGGG - Intergenic
999620803 5:153471273-153471295 GTTGGGGGGTGGAGGGCAGAAGG - Intergenic
1001256550 5:170187724-170187746 TGTGAGGTTTGGAGGGAAGGGGG + Intergenic
1001577239 5:172772093-172772115 TTTGGCGTTTGGAGGGGTGAGGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002108436 5:176891840-176891862 TTAGTGGTATGGCAGGAAGAAGG - Intronic
1002135559 5:177105583-177105605 TTTGCTGAATGAAGGGAAGAAGG + Intergenic
1002876612 6:1216107-1216129 CTTGGGTTTGGGAGGGAAGAGGG - Intergenic
1003047985 6:2752487-2752509 TATGGGGTATGAAAGAAAGATGG + Intergenic
1003583760 6:7367152-7367174 GAAGGGGGATGGAGGGAAGAGGG - Intronic
1003885246 6:10515785-10515807 GTAGGGGTATGGAGGGAAAGGGG - Intronic
1003998824 6:11573281-11573303 TTTGGGGAATGGTGTGAAGCAGG + Intronic
1004094419 6:12538625-12538647 TTAAGGGTATGGAGGGCAAAGGG + Intergenic
1004515365 6:16317810-16317832 TTAGGGGGATGGATGGAGGAAGG - Intronic
1004632414 6:17434633-17434655 TCAGGGGTATGGAGGGAAATGGG - Intronic
1004732942 6:18375906-18375928 TTTGGGGATTGGAGTGACGATGG + Intergenic
1005001311 6:21244521-21244543 TTAGGGAGATGGAGGGGAGAGGG - Intergenic
1005283873 6:24303390-24303412 TTTTGGGAATGGAGGGGAGCAGG - Intronic
1005301592 6:24476376-24476398 TGAGGGGCATGGAGGGAAGGAGG - Intronic
1005329551 6:24736374-24736396 TTTCAGGAATGAAGGGAAGAAGG - Intergenic
1005367039 6:25089009-25089031 TTTGGGGTAGGGGGAGAACAAGG + Intergenic
1006058861 6:31404683-31404705 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006071346 6:31499568-31499590 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006909012 6:37551873-37551895 TTTGGGGTATGGTAGAAGGAAGG + Intergenic
1007450838 6:41939702-41939724 CTTGGGCTAAGGGGGGAAGAGGG + Intronic
1008115998 6:47551017-47551039 TTTGGGGCCTCGGGGGAAGAGGG + Intronic
1008124238 6:47650564-47650586 AATGGGGTATGGAGGGGAGGAGG + Intergenic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1008504362 6:52215115-52215137 TGTGGGGTAAGGTGGGAATAAGG + Intergenic
1008576002 6:52860823-52860845 TTTGGGGGGTGGAGCCAAGATGG + Intronic
1008949188 6:57136571-57136593 TTTGGGGAAGGAAGGGAAAAAGG + Intronic
1009892028 6:69696494-69696516 TTTAGGGGTTGGAGGGAGGAAGG - Intronic
1010772143 6:79844388-79844410 TTTGAGTTAAGAAGGGAAGAGGG - Intergenic
1011303152 6:85897090-85897112 TTTGGGGGGTGGAGACAAGATGG - Intergenic
1011364019 6:86560673-86560695 TTTGGGCTCTGGAGGGAAAGTGG - Intergenic
1011524736 6:88252281-88252303 TTGGGTGAATGGATGGAAGAAGG + Intergenic
1011870637 6:91887760-91887782 TTTGCTATATGGAGGGATGAGGG - Intergenic
1011913366 6:92470065-92470087 ATTGGGGAATGCAGGGAAGATGG + Intergenic
1012069661 6:94597599-94597621 TGAGGGGCATGGAGGGAAAAGGG - Intergenic
1012073483 6:94653894-94653916 TTTGGGAGATGGTGGCAAGAGGG + Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013029579 6:106320195-106320217 TTTGGAGTTGGGAGGGATGATGG - Intronic
1013110755 6:107063015-107063037 TTTGTGGTAAGGAGAGAAGTTGG - Intergenic
1013195239 6:107838867-107838889 TTGGGAGGATGAAGGGAAGAAGG + Intergenic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1013631456 6:111989933-111989955 TATGGGGTATTGGGGGAAGAGGG + Intergenic
1014877560 6:126679406-126679428 TTTGGGGTTTGGGGGGGGGAGGG + Intergenic
1015320797 6:131871706-131871728 TTTGAGGGATGGATGGATGATGG + Intronic
1015645203 6:135379916-135379938 GTTGGGGGAGGGAGGGAGGAAGG - Intronic
1016292171 6:142538036-142538058 GTTGGGGCATGGGCGGAAGATGG - Intergenic
1016467621 6:144342070-144342092 TTTGGGCTATGGATAAAAGATGG + Intronic
1016532557 6:145074975-145074997 ATTGGGGAAGGGAGGGAGGAAGG + Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1016653324 6:146487958-146487980 TTTGGGGTGGGGAGGGACGGAGG + Intergenic
1017085161 6:150706899-150706921 TTTGGTGAGGGGAGGGAAGAAGG - Intronic
1017503536 6:155046983-155047005 TTTGGGGTAAGGAAGCGAGAGGG + Intronic
1018037554 6:159894181-159894203 TGTGGAGTAGGAAGGGAAGAGGG + Intergenic
1018265917 6:162024170-162024192 GTTGGGGGAGGGAGGGAGGAAGG - Intronic
1018605308 6:165591477-165591499 CTTGGGTTTTGAAGGGAAGATGG - Intronic
1019657283 7:2202620-2202642 TTTGGGGCATGGGAGGAGGAGGG - Intronic
1019703802 7:2487997-2488019 TCTGGGGGAAGGAGGGGAGAGGG + Intergenic
1020342517 7:7127469-7127491 TTTGGTATATGGTAGGAAGAGGG + Intergenic
1020766799 7:12332039-12332061 TTTGGGGAAGGTAGGGAAGAGGG + Intronic
1020897093 7:13953707-13953729 TGTGGGGGATGCAGGGTAGAAGG - Intronic
1022142844 7:27508181-27508203 TTTTGGGTTAGGAGAGAAGATGG - Intergenic
1022379905 7:29850344-29850366 TTTGGAGTATGAAGGAAAAACGG + Intronic
1022435763 7:30383361-30383383 TTTGGGGCAAAGAGGGAAGGGGG - Intronic
1022879894 7:34575795-34575817 TTTGGGGGATGGAGCCAAGACGG + Intergenic
1023156121 7:37254162-37254184 TTTCGGGGATGGAGGAAGGAGGG - Intronic
1023168031 7:37362610-37362632 TTTGAGGGAGGGAGGGAAGAAGG - Intronic
1024300516 7:47884167-47884189 TTTGGGGGTTGGGGGGAAGGCGG + Intronic
1024636229 7:51292710-51292732 TCTGGAGTGTGGAGGGAGGAGGG - Intronic
1024954802 7:54906157-54906179 ATTGGGGTGTGGTGGGAACAGGG + Intergenic
1025108498 7:56193032-56193054 TTTGGGATGAGCAGGGAAGATGG + Intergenic
1025159861 7:56647108-56647130 TTTTGGGTATGCAGTGGAGAGGG - Intergenic
1025262934 7:57432905-57432927 TTTTGTTTATGGAGGGCAGAAGG - Intergenic
1025726858 7:64072228-64072250 TTTTGGGTATGCAGTGGAGAGGG + Intronic
1026323602 7:69288621-69288643 TTTGGGGTGGAGAGGGAAGTGGG - Intergenic
1027601604 7:80246975-80246997 TTTGGGCCATGAAGGGAAGGAGG - Intergenic
1027725644 7:81802185-81802207 TTAGGGGTAAGGAGGAGAGAAGG + Intergenic
1027971264 7:85084757-85084779 TTTGGAGTGTGGAGGGTGGAAGG - Intronic
1029206142 7:98870261-98870283 TTTGGGGTGGGGAGGGATGCGGG - Intronic
1029465319 7:100721212-100721234 TTTGGGGGTTGAGGGGAAGAAGG + Intronic
1029805916 7:102995997-102996019 TTTAGGGTTTGGTGGGAAAATGG + Intronic
1029919053 7:104242919-104242941 TTTGGGGAGGGGAAGGAAGATGG + Intergenic
1030107122 7:105996584-105996606 TTTTGGATATGGTGGGGAGAAGG + Intronic
1031435135 7:121724320-121724342 TTTGAGGAGTTGAGGGAAGAAGG - Intergenic
1031945589 7:127836327-127836349 TTTGGGGTTTGGGGGTAGGATGG + Intronic
1032581671 7:133108780-133108802 TTTGGGAAATGGCAGGAAGATGG - Intergenic
1032664478 7:134021903-134021925 TTTGGGGTATTGGGGACAGAGGG + Intronic
1033009395 7:137604227-137604249 TTTAGAGTAGGCAGGGAAGAGGG - Intronic
1033921017 7:146391833-146391855 TTTGGAGGATAGAGGGTAGAAGG + Intronic
1033928913 7:146499587-146499609 TTCGGGGTGTGGGGGGAGGAAGG - Intronic
1034426416 7:151016562-151016584 TCTGGGGTGTGGCGGGAGGAGGG - Intronic
1035326276 7:158068030-158068052 TATGGGGAAAGGAGGGAGGAAGG + Intronic
1035334916 7:158121627-158121649 ATTGGAGCATGGAGGGCAGAGGG - Intronic
1035598385 8:879730-879752 TTTGGGGTATAGAGTGATAAAGG - Intergenic
1035616227 8:1003776-1003798 TCTGGGGTATGGGGGGACCAAGG - Intergenic
1035673719 8:1439751-1439773 TCTGGGGGATGGTGGGGAGAGGG - Intergenic
1036447840 8:8838473-8838495 TGTGGGGTATAGGGGGAAGAAGG - Intronic
1036547348 8:9784690-9784712 TTTGGGGTCTGAGGAGAAGATGG + Intergenic
1036636652 8:10555211-10555233 TTCGGGGCATGATGGGAAGAGGG + Intergenic
1036776681 8:11617666-11617688 TTGGGGGTGTGGGAGGAAGAGGG - Intergenic
1037478683 8:19283511-19283533 TTTGGGGTATGAAATCAAGACGG - Intergenic
1037493613 8:19418742-19418764 TTTCTGGTTTGTAGGGAAGAAGG - Exonic
1037874367 8:22533158-22533180 TTTTCTGTATGGAGGGAAGTAGG - Intronic
1038066094 8:23965302-23965324 TTTGGGGTGGGGAAGGTAGAGGG - Intergenic
1038271766 8:26081403-26081425 TTTGGGGACTGGAGGGAGGAGGG - Intergenic
1038693289 8:29782585-29782607 TTTGGTGCAAGGGGGGAAGAGGG - Intergenic
1039232049 8:35459130-35459152 TTTGTGGTATGAGGGGAAGAAGG + Intronic
1039253541 8:35693021-35693043 TTTGGGGCATGGGGGAGAGATGG - Intronic
1040087212 8:43356663-43356685 TTTGGTGTATGGATGGGTGAAGG + Intergenic
1040879380 8:52189116-52189138 TTGGGGGCAAGGAGGGGAGATGG - Intronic
1041001082 8:53454256-53454278 GTTGGGTTATGGGGGGATGAGGG + Intergenic
1041106305 8:54447301-54447323 TTTGGGGCATGGAGGAAGCAGGG + Intergenic
1042040347 8:64582127-64582149 TTTGGGGTGGGGAGGGAGGGAGG + Exonic
1042706697 8:71670823-71670845 TTTGTGGTAGGCAGAGAAGATGG + Intergenic
1043284946 8:78516537-78516559 TTTGCAGCACGGAGGGAAGAAGG + Intronic
1043287402 8:78550818-78550840 TTTGGGGTCTTGAGGGAGAAAGG - Intronic
1044561293 8:93614885-93614907 TTTGGGATGTGAAGAGAAGAGGG - Intergenic
1044794365 8:95881615-95881637 TTGGGGGTAGGGAGGAAAAAGGG + Intergenic
1044975349 8:97659266-97659288 TATGGGGGAAGGAAGGAAGAGGG - Intronic
1045385007 8:101664108-101664130 TTTGGTGTAAGGAGTGGAGAAGG + Intronic
1046081646 8:109376630-109376652 TTTGGGGGGTGGAGTCAAGACGG - Intronic
1046478505 8:114782199-114782221 TTTGGGGGAAAGAGAGAAGATGG + Intergenic
1046832973 8:118767028-118767050 TCTGGGGTTTTGAGGGAGGAAGG - Intergenic
1047463948 8:125094133-125094155 TATTGGGTATGAAGGGGAGAAGG + Intronic
1047550577 8:125868421-125868443 TGTGGGGTATGGACCTAAGAGGG - Intergenic
1048632383 8:136258056-136258078 TTTGGGTTCTGGAAGGAACATGG - Intergenic
1049072354 8:140365917-140365939 TTTGGAGGGTGGAGGGTAGAAGG - Intronic
1049463559 8:142740974-142740996 CGTGGGGTATGGAAGGCAGAGGG + Exonic
1049884199 9:16890-16912 TGTGGGGTGTCTAGGGAAGAAGG + Intergenic
1050190906 9:3024973-3024995 TTAGGGGAATGGAGGGAGTATGG - Intergenic
1050307172 9:4316572-4316594 TTTGGGGTATGGGTGGAAACCGG - Intronic
1052733396 9:32315651-32315673 GTTGGGGGAAGAAGGGAAGAAGG + Intergenic
1052821228 9:33139190-33139212 GTTGAGGTAGGGAGGGAGGATGG + Intronic
1053025557 9:34725750-34725772 TTTGGGGAAAGTGGGGAAGAGGG + Exonic
1055447988 9:76402102-76402124 TTCCGGGTACAGAGGGAAGAAGG + Intergenic
1056124644 9:83523137-83523159 TTTGGTGAATGGATGGAGGATGG + Intronic
1056204742 9:84309164-84309186 TGTTGGGTAGGGAGGGTAGATGG + Intronic
1056255455 9:84794997-84795019 TTTGGGGGGTGGAGGGCACAGGG - Intronic
1056322024 9:85444276-85444298 AAAGAGGTATGGAGGGAAGAAGG - Intergenic
1056920111 9:90780058-90780080 GTAGGGGTTTGGTGGGAAGAGGG - Intergenic
1057271886 9:93656167-93656189 TTTGTGATGTGGAGGGAAGGAGG + Intronic
1057672680 9:97107850-97107872 TGTGGGGCATAGGGGGAAGAGGG + Intergenic
1058094697 9:100846508-100846530 TCTGGGGAAAGGATGGAAGAGGG - Intergenic
1058227813 9:102388237-102388259 TTTAGGGGATGGATGGGAGAGGG + Intergenic
1058466727 9:105236352-105236374 TTTGGGGGATGGAGAGAAGACGG + Intergenic
1059099505 9:111456078-111456100 TTTGGTATATGGAGGGATGTAGG + Intronic
1059354243 9:113687113-113687135 GGTGGGGAAGGGAGGGAAGAGGG + Intergenic
1059354307 9:113687345-113687367 GGTGGGGAAAGGAGGGAAGAGGG + Intergenic
1059518094 9:114914316-114914338 TTTGGGGTATGCAGAGAAGCTGG - Intronic
1059613535 9:115924582-115924604 ATTGGGGAAAGGAGGAAAGAAGG + Intergenic
1059861678 9:118470506-118470528 TTTGGGGGATTCTGGGAAGATGG + Intergenic
1060786766 9:126457224-126457246 TGTTGGTGATGGAGGGAAGAAGG - Intronic
1060850901 9:126874518-126874540 TTTGGGGTATGCTGTGAAGAAGG + Intronic
1061261374 9:129482651-129482673 TTTGAGTTATGGAGGGGGGAGGG + Intergenic
1061296871 9:129681679-129681701 TTTGGGGGGTGGAGGGAGGGCGG - Intronic
1061895605 9:133645649-133645671 GTAGGGGTGTCGAGGGAAGAAGG + Intronic
1185772955 X:2779551-2779573 TTTGGTGTCTGCGGGGAAGAAGG - Intronic
1186398933 X:9238789-9238811 TTTTGGGTAGAGGGGGAAGATGG + Intergenic
1186538422 X:10373812-10373834 TCTGGGTCATGGAGAGAAGATGG + Intergenic
1187258548 X:17663193-17663215 TTCGTGGCATGGAGGGGAGAGGG + Intronic
1188598234 X:31927564-31927586 TTTTATGTATGGAGGGAAGGTGG - Intronic
1189406321 X:40728319-40728341 TCTGGGGTATGAAGGGAAACTGG - Intronic
1190245085 X:48685663-48685685 CTTGGGGTGTGGAGAGGAGATGG + Intronic
1190322691 X:49187911-49187933 GTAGGGGTCTGGAGGGGAGAAGG + Exonic
1190390640 X:49928015-49928037 TTTGGGGAATGAAGAGAAGTGGG + Intronic
1191214941 X:57924102-57924124 ATTGGGGAATGGAGGGAGTATGG + Intergenic
1192071354 X:67943678-67943700 TTTGAGGAATTGAGAGAAGAAGG + Intergenic
1192133605 X:68575897-68575919 TTTGGGGTAAGGGGGTAATATGG + Intergenic
1192488036 X:71547802-71547824 TTGGGGGGAGGGGGGGAAGAAGG - Intronic
1192583968 X:72306087-72306109 TTCGGGGAATTGAGGCAAGAGGG - Intronic
1192848171 X:74926196-74926218 TTTGGGGAATAAAGGAAAGAAGG + Intergenic
1193177155 X:78408030-78408052 TGTGAGGTATGGAGGGAACTAGG - Intergenic
1193304831 X:79936231-79936253 TTTGGGGAAGGGAGGGAAAAGGG - Intergenic
1194190907 X:90836227-90836249 TTTGGGGAGTGGAGCCAAGATGG + Intergenic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194523032 X:94942304-94942326 TTTGGGGGCTGGAGCCAAGATGG + Intergenic
1194544434 X:95215055-95215077 TGTGGTGTGGGGAGGGAAGAGGG + Intergenic
1195261148 X:103132537-103132559 TTTGAGGAATTGAGAGAAGAAGG + Intergenic
1195740545 X:108060888-108060910 CCAGGGGTATGGAGGGAACAGGG - Intronic
1195792822 X:108607482-108607504 CTTGGGGTATGGGGGGAGGGTGG - Intronic
1196031313 X:111097299-111097321 GGTGGGGGATGGTGGGAAGAGGG + Intronic
1199223581 X:145344886-145344908 ATTGGAGGATGGAGGGTAGAAGG + Intergenic
1199896088 X:152129273-152129295 TGTGGGGGATGTAGGGGAGATGG - Intergenic
1200296081 X:154921875-154921897 GTTGGGGGGTGGGGGGAAGAGGG + Intronic
1200537568 Y:4418644-4418666 TTTGGGGAGTGGAGCCAAGATGG + Intergenic
1201933565 Y:19380957-19380979 TGTTGGGGTTGGAGGGAAGATGG - Intergenic