ID: 948130591

View in Genome Browser
Species Human (GRCh38)
Location 2:235597675-235597697
Sequence CACACAGACAGGGCCCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 2, 2: 4, 3: 42, 4: 392}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948130591_948130596 12 Left 948130591 2:235597675-235597697 CCCGCTGGGGCCCTGTCTGTGTG 0: 1
1: 2
2: 4
3: 42
4: 392
Right 948130596 2:235597710-235597732 GCTCCCGTGTTTCCTGTGTGTGG 0: 1
1: 7
2: 1
3: 7
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948130591 Original CRISPR CACACAGACAGGGCCCCAGC GGG (reversed) Intronic
900099193 1:953874-953896 CCGACAGACAGGACACCAGCTGG + Exonic
900608234 1:3533296-3533318 CAGACAGGCAGGGCCCAGGCAGG - Intronic
900686169 1:3949020-3949042 CACAAAGACAGGACCCCTGAGGG - Intergenic
902131663 1:14266838-14266860 CACACAGACAGTGGCCCTGGTGG + Intergenic
902602249 1:17547953-17547975 AACATAGAAAGAGCCCCAGCAGG - Intronic
903056841 1:20641959-20641981 CAGGCTGTCAGGGCCCCAGCAGG - Intronic
904042700 1:27593553-27593575 CCCACAGCCACGGCTCCAGCTGG + Intronic
904392600 1:30195879-30195901 TGCACAGACAAGGCCCCAGTGGG - Intergenic
904611843 1:31730193-31730215 CACACAGGCAGGGACCCGGAGGG + Intronic
905769828 1:40630277-40630299 CACACAGACCTTGCCCCGGCTGG - Intronic
905816141 1:40952555-40952577 CACACAGGTCGGGCCCCGGCTGG + Intergenic
906212037 1:44017404-44017426 CACACAGACTGGGGCAGAGCAGG + Intronic
906671751 1:47660996-47661018 AAAACAGTCAGGGCCCCAGCAGG + Intergenic
907188914 1:52632971-52632993 CAGACAGACAAGGCACCAGCCGG - Intergenic
907248859 1:53124662-53124684 CACACACACAGAGCACCTGCCGG + Intronic
907325648 1:53637199-53637221 CACACAGCCAGAGCCCCACAGGG + Intronic
908897462 1:68916412-68916434 CACACAGGCAAGGCTCCAACAGG - Intergenic
911907432 1:103588195-103588217 CACACACACAGGATCCCTGCTGG - Intergenic
912702402 1:111888119-111888141 CCCACAGTTAGGGCTCCAGCTGG - Intronic
912799905 1:112714324-112714346 CACACAGCCCGGGGGCCAGCCGG + Intronic
915091410 1:153428887-153428909 CACACAGACGGGGCACCACCTGG - Intergenic
915270902 1:154752723-154752745 CACACAGACATGCCCCCTGCTGG + Intronic
915658507 1:157381378-157381400 TACACAAATAGGGGCCCAGCAGG - Intergenic
917687223 1:177429409-177429431 CACACACACAAGTCACCAGCAGG + Intergenic
919075604 1:192809040-192809062 CAAACAGCCGGGGCTCCAGCGGG + Exonic
920833293 1:209484630-209484652 CACAGAGATATGCCCCCAGCTGG - Intergenic
921629701 1:217418598-217418620 CACTCACACAGGGCCCGAGATGG + Intergenic
922619427 1:226980933-226980955 CACGGAGCCAGGTCCCCAGCAGG - Intronic
922900809 1:229135091-229135113 CCCACAGGCAGTGCCCCAGTGGG - Intergenic
923082970 1:230677367-230677389 CAGACAGCCTGGGGCCCAGCAGG + Intronic
924439612 1:244075208-244075230 CACACAGGCAGGTTCCCAGGAGG + Intergenic
1062901101 10:1147649-1147671 GACACAGACAGGGACTGAGCAGG - Intergenic
1063787937 10:9407220-9407242 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787943 10:9407247-9407269 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787949 10:9407274-9407296 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787959 10:9407328-9407350 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787974 10:9407409-9407431 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787980 10:9407436-9407458 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063866083 10:10367014-10367036 GACACAGAGAGGGCCCCAAAAGG - Intergenic
1065337455 10:24668290-24668312 CACACAGACAGGGCCCCAGTGGG - Intronic
1065565365 10:27002353-27002375 CACCCAGATGGGGCCCCAGTTGG - Intronic
1065730477 10:28705549-28705571 CACACAGCCAGGGCTGCTGCAGG - Intergenic
1066296548 10:34058901-34058923 CACTCAGACAGGGTACAAGCTGG - Intergenic
1066463643 10:35634287-35634309 CACACAGTCAGGAGCACAGCTGG - Intergenic
1067412321 10:46076040-46076062 GACAAATACAAGGCCCCAGCAGG - Intergenic
1068433068 10:56957866-56957888 CACACAGCCAGTGCCCCAGATGG - Intergenic
1069254609 10:66316679-66316701 CACACAGACAGTGGCCCAGGTGG + Intronic
1069546139 10:69330199-69330221 CACCCAGACAGGGTCCTAGAAGG - Intronic
1069695317 10:70381824-70381846 CACAAAAACAAGGCGCCAGCAGG - Exonic
1071782770 10:88865257-88865279 CACACACACAGAGCTCGAGCAGG + Intergenic
1072157955 10:92741024-92741046 CTCACTAACAGGGCTCCAGCTGG + Intergenic
1072533285 10:96339581-96339603 CACACTGAAAGGGCCTCAGATGG + Intergenic
1072660611 10:97361390-97361412 CAAACAGAGGTGGCCCCAGCTGG + Intronic
1072663953 10:97380669-97380691 CACCCTGACAGGGCCATAGCAGG - Intronic
1073030074 10:100519252-100519274 CACAAAAAAAGGGCCCCCGCTGG + Intronic
1073116218 10:101093402-101093424 CTCCCAGACAGGGCTCCAGGGGG - Intronic
1073452923 10:103620103-103620125 CAGACGGACATGGCCTCAGCGGG + Intronic
1073543264 10:104328963-104328985 CACAAAGCCTGGGCCCCAGCTGG + Intronic
1074306895 10:112287406-112287428 CACACAGAGACTGTCCCAGCAGG + Intronic
1076558067 10:131342950-131342972 CTCACAGGCAAGGCCACAGCAGG + Intergenic
1077155547 11:1089359-1089381 CAGCCAGCCAGGGCCCCGGCAGG - Intergenic
1077334234 11:1996406-1996428 CCCACAGCCAGGTCTCCAGCTGG - Intergenic
1077362680 11:2147683-2147705 CCCACAGCCTGAGCCCCAGCAGG - Exonic
1077408996 11:2394889-2394911 CACACACCCAGGTGCCCAGCAGG - Intronic
1077414156 11:2416750-2416772 CAGGCAGACACAGCCCCAGCAGG - Intronic
1077530835 11:3094022-3094044 CACAGAGACAGGGCCTAGGCTGG + Intronic
1079153405 11:17922292-17922314 CTCACAGAGAGGGCTCTAGCAGG + Intronic
1080245172 11:30171942-30171964 CATACAGAAAGGGGCCAAGCCGG - Intergenic
1080447891 11:32353969-32353991 GCCTCAGACAGGGCCCCAGGAGG - Intergenic
1081525931 11:43927780-43927802 CACACAGTCAGTGCTCAAGCAGG - Intronic
1083201789 11:61125177-61125199 CACGCAGGCAGGGCTGCAGCAGG + Intronic
1083675080 11:64320714-64320736 CACTCAGACAGGCCACCACCTGG - Exonic
1083955145 11:65978755-65978777 CACTCAGAAAGGGCTGCAGCAGG - Intronic
1084643088 11:70437427-70437449 CATGCAGAAAGGGCCCCCGCTGG + Intergenic
1085016644 11:73178240-73178262 CACACCGACTGGGCACCAGGTGG - Intergenic
1085345412 11:75765372-75765394 CACACAGGAAGGGCCCAAGCTGG + Intronic
1085912129 11:80840111-80840133 CACACAGACAGTGGCCTGGCTGG - Intergenic
1086306604 11:85486621-85486643 CACACACACATGGTACCAGCAGG + Intronic
1087042840 11:93818719-93818741 CACACAGAGAGGCCACCAGCAGG - Exonic
1087196106 11:95305655-95305677 CACACACACAAGCCTCCAGCTGG - Intergenic
1088527914 11:110776483-110776505 CACACACACAGGGCACAGGCTGG - Intergenic
1088643069 11:111892756-111892778 CACACAGACACTGTCCCAGCAGG - Intergenic
1089762778 11:120740528-120740550 CACCCATATAGGGCCCCAGCTGG + Intronic
1090666651 11:128918919-128918941 GAAGCAGACAGTGCCCCAGCAGG + Exonic
1202817217 11_KI270721v1_random:51588-51610 CCCACAGCCAGGTCTCCAGCTGG - Intergenic
1091383168 12:76123-76145 CACACACACAAGGCCTCAGCAGG + Intronic
1093027553 12:14258663-14258685 CACACACACAGTGTCCCACCAGG - Intergenic
1101325904 12:103715867-103715889 CACACAGACAGGACCCAACCAGG + Exonic
1101598323 12:106187368-106187390 CACACAGGCAGGACAGCAGCAGG + Intergenic
1101735632 12:107460786-107460808 CACTCAGAGAGGGTCCCAGTGGG + Intronic
1102923231 12:116808488-116808510 AGCAGGGACAGGGCCCCAGCAGG + Intronic
1104993452 12:132640003-132640025 CATACCCACATGGCCCCAGCTGG + Intronic
1105023961 12:132836450-132836472 CACAGTGACAGGCTCCCAGCAGG + Intronic
1105692872 13:22859254-22859276 CTCCCAGACAGGGTCACAGCCGG + Intergenic
1105997814 13:25688798-25688820 CAGACAGAAAGGGCCGAAGCTGG - Intronic
1106102468 13:26706933-26706955 CACACAGACAGTGCCCCAGCTGG - Intergenic
1107134539 13:36929493-36929515 CACACAGACAGGGGTCTTGCTGG - Intergenic
1107708614 13:43131322-43131344 CACAGACTCAGGGCCCCAACTGG - Intergenic
1107835054 13:44406222-44406244 CGCACAGTCTGTGCCCCAGCAGG - Intergenic
1107869801 13:44735837-44735859 CCCAGAGACATGGCCTCAGCAGG - Intergenic
1110106747 13:71686385-71686407 CACACAGACAGATCGCCAGGGGG + Intronic
1110707006 13:78608106-78608128 CATTCAGACTGGGCTCCAGCTGG + Intergenic
1110985086 13:81956813-81956835 CACACACACTGGTCCCCAGTTGG - Intergenic
1111592400 13:90367140-90367162 CACACAGACATGGCCCAAACAGG + Intergenic
1112489236 13:99847370-99847392 CACGCAGACTGAGACCCAGCAGG + Intronic
1113911574 13:113843761-113843783 CAGACAAGCAGGCCCCCAGCGGG - Intronic
1117310470 14:54517786-54517808 AACACAGACTGGGGCCCATCAGG - Intronic
1118063310 14:62164291-62164313 CATGCACACAGGGCCCCAGGAGG + Intergenic
1118348959 14:64960061-64960083 CATACAGACAGAGTCACAGCAGG - Intronic
1118815540 14:69311058-69311080 CACAAAGACAGGACCACTGCTGG - Intronic
1119835711 14:77747560-77747582 CTCCCAGACAGGGTCCCGGCTGG - Intronic
1121420537 14:93810236-93810258 CACAAAGCCAGGCCCTCAGCAGG - Intergenic
1121671592 14:95714355-95714377 AACGCAGACCCGGCCCCAGCTGG + Intergenic
1122262684 14:100532062-100532084 GACACAGACAGGCCCACATCTGG - Intergenic
1122413006 14:101535573-101535595 GACACAGACAGGGGCCCAGGAGG + Intergenic
1122799425 14:104222184-104222206 CACAGAGACAACCCCCCAGCAGG - Intergenic
1123429603 15:20203806-20203828 CTCCCAGACAGGGCGGCAGCTGG + Intergenic
1125085232 15:35721927-35721949 GACACATACAGTGCCCCTGCAGG + Intergenic
1125756262 15:42067178-42067200 CACACACACCTGGCCCCAGGTGG - Intronic
1128243533 15:66117692-66117714 CATACAGACAGAGCAGCAGCAGG + Intronic
1130952490 15:88604127-88604149 CACCCAGGCAGCGCCCAAGCGGG - Intergenic
1132750655 16:1455923-1455945 CACACAGAGAGGGACCCTGAGGG + Intronic
1133736556 16:8620423-8620445 CGCACACACATGGCCTCAGCTGG - Intergenic
1133759304 16:8785646-8785668 CACAGAGACAGGGCGACAGCAGG + Intronic
1133769227 16:8858183-8858205 CACACACACAGGAGCACAGCTGG + Intronic
1138576643 16:57911715-57911737 CACCCAGGCATGGCCCCAGGGGG + Intronic
1139959623 16:70710152-70710174 CACACAGCCAGGGCCACAGAGGG + Intronic
1139968459 16:70758711-70758733 CTCCCAAACAGGGACCCAGCAGG + Intronic
1141143587 16:81513739-81513761 GACACAGGCATGGCCCTAGCTGG + Intronic
1142118758 16:88375558-88375580 CACCCAGACATCGCCCCTGCCGG + Intergenic
1142196330 16:88740909-88740931 CACACGGACAGGGCATGAGCTGG - Intronic
1142280381 16:89144861-89144883 CACAGAAACAGGGCCTGAGCCGG + Intronic
1142496810 17:310376-310398 CACACACACGCGCCCCCAGCAGG - Intronic
1146469856 17:33115421-33115443 CAACCATACAGGGCCCCAGTGGG - Intronic
1147055280 17:37829485-37829507 CACAGACTCAGGGCCCCAGCTGG - Intergenic
1147613346 17:41813847-41813869 CACGTAGACAGGGCCTCCGCAGG - Intronic
1147613566 17:41815201-41815223 TAGACAGACAGGGCCTCCGCAGG - Intronic
1148119253 17:45197977-45197999 CCCGCAGAGAGGGCCCCAGCCGG - Intergenic
1150625235 17:66837006-66837028 CACACAGTCAGGAACCTAGCAGG - Intronic
1152146754 17:78573019-78573041 CACAGAGCCAGGTCCCCAGGGGG + Intronic
1152364812 17:79849514-79849536 CCCACAGGCAGGACCCTAGCTGG + Intergenic
1152392569 17:80011424-80011446 CACACAGACAGGGAGGCTGCAGG - Intronic
1152551003 17:81030188-81030210 CACACAGAAGGGGCACGAGCTGG + Intergenic
1152760043 17:82103057-82103079 CACACAGGCTGGGCTCCAGCAGG - Intronic
1153246142 18:3074264-3074286 CACATACACAGGGCCTGAGCAGG + Intronic
1153534352 18:6084864-6084886 AACACAGAGAGGGCCACTGCAGG + Intronic
1153893578 18:9539829-9539851 CCCACAGGCAGGGGCCCCGCTGG - Intergenic
1157694259 18:49708384-49708406 CAAGGAGACAGGGCCTCAGCAGG - Intergenic
1158613165 18:58961832-58961854 CACTCATGCATGGCCCCAGCTGG - Intronic
1160408140 18:78656727-78656749 CAGACATGCATGGCCCCAGCTGG - Intergenic
1160981300 19:1817797-1817819 CACACAGTCAGGGCCCGGCCAGG + Intronic
1161219517 19:3111935-3111957 CTCTCAGAGAGGGCCACAGCTGG - Intronic
1161509098 19:4660787-4660809 CACACAGACCCAGACCCAGCAGG - Intronic
1161645624 19:5451610-5451632 AACACAGACGGGGCGCCACCTGG + Intergenic
1162079034 19:8208227-8208249 CACACAGACAGGGGCGCGGGGGG - Intronic
1163094104 19:15043168-15043190 CACACAGTGAGGGCCCAAGAAGG - Intergenic
1163800496 19:19362103-19362125 CAGACAGGCAGGGGCCCATCTGG + Intergenic
1163827635 19:19532575-19532597 CACAGAGACAGAGCCTCAGATGG - Intronic
1163845885 19:19637863-19637885 CACTCAGTCGGGGCCCCAACGGG + Intronic
1164052815 19:21597634-21597656 CAGGGAGGCAGGGCCCCAGCAGG - Intergenic
1164989271 19:32672998-32673020 CAGACAGGAAGAGCCCCAGCAGG + Intronic
1165827467 19:38713505-38713527 CACACACCCAGGGCCCCAGGCGG - Intronic
1165902197 19:39174165-39174187 GACAGAGGCAGGGACCCAGCTGG - Intronic
1166121367 19:40689601-40689623 CAGACAGACAGGGCTGCACCCGG + Intronic
1166219108 19:41353841-41353863 CAGACAGCGAGGGCCCCGGCCGG - Exonic
1166413453 19:42573534-42573556 CAAACATAAAGGTCCCCAGCAGG + Intergenic
1166785011 19:45362485-45362507 CACACAGGCAGGGCCGAGGCAGG + Intronic
1167565281 19:50252284-50252306 CACAGAGACAGAACCCCAGGTGG + Intronic
1167717410 19:51152705-51152727 CACACACAGAGGGCCCCAGCAGG + Intronic
1167749487 19:51371234-51371256 CCCACAGACTGAGCCCCTGCTGG + Intergenic
1168231991 19:55038476-55038498 AACACAGACCAGGCCCCAGCAGG - Intergenic
925122050 2:1427174-1427196 CACACAGAAGGGGCCACATCTGG + Intronic
925800340 2:7592605-7592627 CCCACACACAGGGCATCAGCTGG + Intergenic
926272633 2:11378163-11378185 CACACAGAGAGGGCTTCTGCAGG + Intergenic
926593773 2:14767714-14767736 CTCAGGGACAGGGACCCAGCTGG - Intergenic
927617522 2:24614030-24614052 GACAAAGACAGGGCCCAAGAAGG - Intronic
927689803 2:25200433-25200455 AACACGAACAGAGCCCCAGCGGG + Intergenic
927789891 2:26001836-26001858 CAACCAGTCAGGGCTCCAGCTGG - Intergenic
929007797 2:37412377-37412399 CACACAGACAGTGTCACAGCTGG - Intergenic
929598950 2:43193098-43193120 CACACTCACTGGGTCCCAGCTGG + Intergenic
929863911 2:45701690-45701712 CACCCAGGCATGGCCCCAGATGG + Intronic
932988158 2:76752738-76752760 GACACACACAGGGACCCAGGTGG - Intronic
933070926 2:77857282-77857304 CACCTAGACAGTGCCCCAGTGGG - Intergenic
933759946 2:85666192-85666214 CACACACACAGCACCCCAGCTGG - Intronic
933759969 2:85666379-85666401 CACACACACAGTACCCCAGCTGG - Intronic
933759975 2:85666411-85666433 CACACACACAACACCCCAGCTGG - Intronic
933759986 2:85666481-85666503 CACACACACAGCACCCAAGCCGG - Intronic
933800803 2:85958947-85958969 CACACAGACAGTGGCCTGGCTGG - Intergenic
933880490 2:86664425-86664447 CACACAGACAGGTGCCCCTCTGG + Intronic
934648706 2:96074342-96074364 CACAAAGCCAAGGCTCCAGCAGG + Intergenic
935110963 2:100093874-100093896 CACACAGCTAGGGCCACAGGTGG + Intronic
935424420 2:102905041-102905063 CACACAGACTGGGCCCATGTAGG + Intergenic
935893732 2:107710463-107710485 CACACACACAGCCCCCCTGCAGG + Intergenic
935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG + Intergenic
936124014 2:109771288-109771310 CACACAGCTAGGGCCACAGGTGG - Intergenic
936126297 2:109791513-109791535 CACACACAGCGGCCCCCAGCAGG + Intergenic
936218396 2:110579955-110579977 CACACACAGCGGCCCCCAGCAGG - Intergenic
936220675 2:110600176-110600198 CACACAGCTAGGGCCACAGGTGG + Intergenic
937150588 2:119683169-119683191 CCCACAGTGAGGGGCCCAGCAGG - Intronic
937921461 2:127134705-127134727 CACACAGGCAGGAGCACAGCAGG + Intergenic
938420519 2:131142197-131142219 CACACAGGCGGTGCCCCAGAGGG + Intronic
938585861 2:132690131-132690153 CACACAGACAGTGGCCTGGCAGG - Intronic
938786794 2:134637191-134637213 CACACAGACAGTGGCCCTGGTGG - Intronic
938839336 2:135143998-135144020 CAGCCACAGAGGGCCCCAGCGGG - Intronic
938978546 2:136503798-136503820 CACACAGGTAGTGGCCCAGCAGG - Intergenic
939500394 2:142976293-142976315 AACAAAGAAAGGGCCCCAGGTGG - Intronic
939546408 2:143559749-143559771 CACAGAGAGAGGGCCACAGAGGG - Intronic
941355880 2:164490426-164490448 AACACAGCCAGGGACACAGCAGG + Intergenic
943905871 2:193501169-193501191 CACAAAGACAGAGTCCCTGCTGG + Intergenic
944939205 2:204604986-204605008 TACACAAAGAGGGTCCCAGCTGG - Intronic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
946165237 2:217859500-217859522 CACCCAGGCAGGGCTCCAGGAGG + Intronic
946491159 2:220150459-220150481 AACACATTCAGGGCTCCAGCAGG - Intergenic
947625790 2:231617661-231617683 CACACAGGCAGAGGCTCAGCTGG + Intergenic
948130591 2:235597675-235597697 CACACAGACAGGGCCCCAGCGGG - Intronic
948381308 2:237551602-237551624 TACACAGCCATGGCCCCAGGAGG + Intronic
948425726 2:237885713-237885735 CACACAGAGAGGGGCACGGCAGG - Intronic
948665025 2:239529221-239529243 GGCACACACAGGGCCCCAGCAGG - Intergenic
1170625327 20:18025894-18025916 CAGACAGACTGGGCTCCAGCAGG + Intronic
1171035273 20:21708551-21708573 CTCCCAGCCAGGGCCCCTGCAGG - Exonic
1171542700 20:25976679-25976701 CACAGAGACAGGCCACCAGAAGG - Intergenic
1172253610 20:33497511-33497533 AACACAGTCATGGTCCCAGCAGG - Intronic
1172274511 20:33672486-33672508 CAACCCGACAGGGTCCCAGCTGG + Intronic
1172494461 20:35369158-35369180 CAGACAGACAGGCCAGCAGCTGG + Intronic
1173805810 20:45924603-45924625 CACCCAGCCTGGGTCCCAGCTGG - Intergenic
1173872702 20:46351817-46351839 CCCACAGACAGGGACACAGATGG - Intronic
1174188170 20:48721758-48721780 GACACTGCCACGGCCCCAGCGGG - Intronic
1174402638 20:50284112-50284134 CACACACACAGGGCCACCGATGG + Intergenic
1174404510 20:50294695-50294717 CACACAGACAGGCCCAGAGGTGG + Intergenic
1174524836 20:51162661-51162683 CACACAGCCAGTGGCACAGCTGG - Intergenic
1175138052 20:56839759-56839781 CACAGTGTCAGGGCCCCAACAGG - Intergenic
1175169717 20:57071644-57071666 CAGAGAGCCAGGGCGCCAGCAGG - Intergenic
1175267714 20:57712583-57712605 AGCACAGACAGGGCCCCTGACGG + Intergenic
1175285875 20:57836423-57836445 CACCCAGCCTGGGACCCAGCCGG - Intergenic
1175414483 20:58792744-58792766 CACACAGACAGCCCCGAAGCTGG - Intergenic
1175753762 20:61516364-61516386 CACACATACAGAGCCCCCGTCGG + Intronic
1175878061 20:62239620-62239642 CACCCAGCCAGGCCCACAGCAGG - Intronic
1175885685 20:62289171-62289193 CACAGAGACACGACCTCAGCAGG - Intronic
1175999067 20:62824118-62824140 CACAGAGACGGGACCCCAGGAGG - Intronic
1176001247 20:62832262-62832284 AACACAGCCAGGGCCAGAGCCGG - Intronic
1176004438 20:62852549-62852571 CACACAGACAGGATCACGGCAGG + Intronic
1176054649 20:63137967-63137989 CAGACACACAGGGCCACAGAAGG + Intergenic
1176070107 20:63221876-63221898 CAGCCAGACAGAGTCCCAGCAGG + Intergenic
1176119254 20:63446616-63446638 CACAAAGACATGGCCAGAGCTGG + Intronic
1176282013 20:64318666-64318688 CACACACACAAGGCCTCAGCAGG - Intergenic
1176383542 21:6125921-6125943 CACACAGGCATGGCCCAAGCAGG - Intergenic
1176687339 21:9862508-9862530 CACACAGGCAGCGCCTCAGTGGG - Intergenic
1179615341 21:42579807-42579829 CACGGAGACAGGGCCCGAGTGGG - Intronic
1179739928 21:43412317-43412339 CACACAGGCATGGCCCAAGCAGG + Intergenic
1179953352 21:44724011-44724033 CACCCAGGGCGGGCCCCAGCGGG - Intergenic
1180105026 21:45612887-45612909 CAGACACGCAGGCCCCCAGCTGG - Intergenic
1180105074 21:45613123-45613145 CAGACACTCAGGCCCCCAGCTGG - Intergenic
1180159703 21:45993558-45993580 CAGACAGGCGGGGCTCCAGCAGG + Intronic
1181045414 22:20211908-20211930 CAGACAGGCAGGGGCCGAGCAGG - Intergenic
1181783352 22:25208465-25208487 GAAACAGCCAGGGGCCCAGCAGG + Intergenic
1182023152 22:27098027-27098049 CACACTGCCAAGGTCCCAGCAGG + Intergenic
1182308191 22:29386071-29386093 CTCAGACACAGGCCCCCAGCAGG + Intronic
1182369875 22:29803344-29803366 CACACAGCCAGTAGCCCAGCTGG - Intronic
1183206968 22:36426342-36426364 CTCCCACACAGGGACCCAGCTGG + Intergenic
1183265596 22:36823367-36823389 CCCACATCCAGGGCCCCGGCAGG + Intergenic
1183327304 22:37201303-37201325 GACACAGACAGGCACCCAGGAGG - Intergenic
1183418750 22:37697782-37697804 CACTCACACAGAGCCCCAGGGGG - Intronic
1183745870 22:39691358-39691380 CAGACAGACAGGCACACAGCTGG + Intergenic
1184668735 22:46001946-46001968 CAGAAAGACTCGGCCCCAGCAGG + Intergenic
1184901689 22:47450359-47450381 CACACAGGCGGGGTCCCAGCAGG + Intergenic
1185194716 22:49461942-49461964 CACACAGAAGGGGACCCACCAGG + Intronic
950745159 3:15082196-15082218 GACTCACACAGGGCCCTAGCTGG + Intronic
951104831 3:18730576-18730598 CACACAGATATGGCTCCACCTGG + Intergenic
951843342 3:27058665-27058687 CACACAGAGAGGACCAGAGCTGG - Intergenic
953003774 3:38958526-38958548 CTATCAGCCAGGGCCCCAGCAGG - Intergenic
953577322 3:44123413-44123435 CACTCATACAGTGCCCCAACAGG + Intergenic
954215626 3:49122881-49122903 CACACAGGCAGAGCTGCAGCGGG - Exonic
954414929 3:50388651-50388673 CACACTGAGTGAGCCCCAGCTGG - Intronic
954865458 3:53725388-53725410 CACATACACAGGGCTCCAGTAGG + Intronic
955955190 3:64281412-64281434 TCCACAGACAGGGCCCCTGAAGG - Intronic
960986394 3:123284033-123284055 CACACAGACAGTGCCCTAGGAGG - Exonic
961360586 3:126364818-126364840 CAGCCAGCCAGGGCCCCTGCTGG - Intergenic
961369613 3:126421561-126421583 CACAGACACAGGGCCCGGGCAGG - Intronic
961400541 3:126638962-126638984 CACACAGAAAGGTCCCCAGCTGG + Intronic
961646461 3:128395279-128395301 CCCTCAGCCAGGGCCTCAGCAGG + Intronic
962184908 3:133247894-133247916 CACACAGCCATAACCCCAGCAGG - Intronic
962848734 3:139291966-139291988 CATGGAGAAAGGGCCCCAGCTGG - Intronic
963458934 3:145581346-145581368 CACACAGACAAGACCTCATCAGG + Intergenic
965892411 3:173530253-173530275 CACACAGAAAGTGCCCCATAAGG - Intronic
967423052 3:189294819-189294841 CACACACACAGCGCGCAAGCAGG + Intronic
968753449 4:2402192-2402214 CGCACAGACAGCGCTGCAGCTGG + Intronic
969254768 4:5994346-5994368 CCCAGACAAAGGGCCCCAGCAGG - Intergenic
969508891 4:7605894-7605916 CCCACAGACAGTCCCCCAGGTGG + Intronic
969560127 4:7941475-7941497 CACTCAGACAGCACCCCAGCTGG - Intergenic
970057275 4:11989043-11989065 TACCCAGACAGGGCCCCTTCTGG - Intergenic
971526085 4:27620738-27620760 GACATAGACAGGGCTTCAGCAGG + Intergenic
973707245 4:53592800-53592822 CCCACAGCCTGGGCCTCAGCTGG + Intronic
975683162 4:76896516-76896538 GATACAGAAAGGCCCCCAGCTGG + Exonic
976340890 4:83943974-83943996 CTCCCAGACAGGGTCGCAGCCGG + Intergenic
976736522 4:88315660-88315682 CACACAAACAGTGGCCCAGCTGG - Intergenic
977708824 4:100101086-100101108 AGCTCAGACAGAGCCCCAGCAGG - Intergenic
977910011 4:102523442-102523464 CACTCACACAGTGCTCCAGCAGG + Intronic
978376150 4:108077362-108077384 CTCCCAGACAGGGCGGCAGCCGG - Intronic
978560137 4:110024464-110024486 CACACAGACAGACCCCTAGAAGG - Intergenic
980350741 4:131680620-131680642 CACACAGGCAGTGCCTCAGTGGG - Intergenic
980525673 4:133988748-133988770 CACCCACACAGGGTCCCAACTGG - Intergenic
980963953 4:139502623-139502645 CACACAGACAGTGGCAAAGCCGG + Intronic
983254797 4:165385957-165385979 CATAAAGAAAGAGCCCCAGCAGG - Intronic
984768611 4:183419005-183419027 CACACAAACACGGCCTCTGCTGG + Intergenic
984896920 4:184549158-184549180 CAGACAGGAAGGGCACCAGCAGG - Intergenic
985053543 4:186016616-186016638 CAGACAGAGGGGGACCCAGCTGG + Intergenic
985097511 4:186427786-186427808 CACACAGACAGGCCTCCTGACGG + Intronic
985097515 4:186427810-186427832 CACACAGACAGGCCTCCTGATGG + Intronic
985097522 4:186427859-186427881 CACACAGACAGGCCTCCTGACGG + Intronic
985097529 4:186427908-186427930 CACACAGACAGGCCTCCTGACGG + Intronic
985097533 4:186427932-186427954 CACACAGACAGGCCTCCTGATGG + Intronic
985097540 4:186427981-186428003 CACACAGACAGGCCTCCTGATGG + Intronic
985097553 4:186428079-186428101 CACACAGACAGGCCTCCTGACGG + Intronic
985097563 4:186428151-186428173 CACACAGACAGGCCTCCTGACGG + Intronic
985097570 4:186428200-186428222 CACACAGACAGGCCTCCTGATGG + Intronic
985097578 4:186428248-186428270 CACACAGACAGGCCTCCTGACGG + Intronic
985097582 4:186428272-186428294 CACACAGACAGGCCTCCTGATGG + Intronic
985097590 4:186428320-186428342 CACACAGACAGGCCTCCTGACGG + Intronic
985097597 4:186428369-186428391 CACACAGACAGGCCTCCTGATGG + Intronic
985097610 4:186428466-186428488 CACACAGACAGGCCTCCTGACGG + Intronic
985097617 4:186428515-186428537 CACACAGACAGGCCTCCTGATGG + Intronic
985181742 4:187272240-187272262 CACACAGACAGGGTCCCCAATGG + Intergenic
985644194 5:1077391-1077413 CACACGGACAGGACCCATGCGGG + Intronic
986300163 5:6472143-6472165 CACACACACAGTGACACAGCCGG - Intronic
987649123 5:20717987-20718009 TACACAGACAGAACCCCATCAGG - Intergenic
988559863 5:32271111-32271133 CAGAGAGCCAGGGCCCCTGCTGG - Intronic
988973429 5:36492229-36492251 CACACAAAGAGGGGCCCTGCTGG - Intergenic
988992416 5:36684364-36684386 CACAGAGGCAGGGCCTAAGCTGG - Intronic
991402952 5:66273345-66273367 CACACAGAAAGGTTTCCAGCAGG + Intergenic
992010354 5:72519396-72519418 CACACAGTCAGGGCCCCAGGAGG - Intergenic
992944287 5:81794452-81794474 CACAAAGCCTGGACCCCAGCAGG - Intergenic
994019491 5:95006109-95006131 CACACAGACAGTGGCCTGGCTGG + Intronic
994691743 5:103027999-103028021 CATACATAAAGGGCCCAAGCTGG - Intronic
995995237 5:118290653-118290675 CTCACAAAGAGGGCCCCATCAGG - Intergenic
997422952 5:133783669-133783691 CACAAAGAAAAGGGCCCAGCTGG - Intergenic
997729942 5:136162298-136162320 CACACAGACGTGGCCCTGGCTGG + Intronic
999641649 5:153678833-153678855 CAGAGAGCCAGGGGCCCAGCTGG - Intronic
1000329930 5:160198316-160198338 CCCACAGACAATCCCCCAGCAGG + Intronic
1001202108 5:169727609-169727631 CACACAGTGAGTGCCCCAGTAGG + Intronic
1002392771 5:178928763-178928785 CTCACAGGCAGTGCCCCAGTGGG + Intronic
1005915012 6:30344243-30344265 CAGACAAGCAGGGCTCCAGCTGG - Intronic
1006385103 6:33726461-33726483 GACACAGCCAGGGCCCCCCCAGG + Intronic
1007655167 6:43447318-43447340 CACACAGACAGAGGCCATGCTGG + Exonic
1008965559 6:57310847-57310869 CTCCCAGACAGGGCAGCAGCTGG + Intergenic
1010145790 6:72668451-72668473 CACACACACAGAGTCCCAACAGG - Intronic
1011811957 6:91142399-91142421 TACACAGACAGGCCATCAGCAGG - Intergenic
1013455575 6:110326550-110326572 CAATCAGTCAGGGACCCAGCAGG + Intronic
1013911215 6:115278467-115278489 CACCCAGCCAGGCCCCCAGTGGG - Intergenic
1015851133 6:137573916-137573938 CACAGAGGCAGGGCCACAGGAGG + Intergenic
1016082323 6:139871085-139871107 CACACAGAAAGTGCCCCTGAGGG - Intergenic
1018371448 6:163172005-163172027 CAGGTAGACAGGGCCCTAGCTGG - Intronic
1018746730 6:166768159-166768181 AACCCAGAGAGGGCCTCAGCGGG + Intronic
1018892878 6:167995401-167995423 CCCACAGGCAGGGCCTCAGCAGG - Intergenic
1018892891 6:167995443-167995465 CACACAGAGGGGTCCCCAGGCGG + Intergenic
1019223430 6:170492951-170492973 CTCACAAACAGGGCCCCAAGGGG + Intergenic
1019338580 7:496635-496657 GGCCCAGGCAGGGCCCCAGCAGG + Intergenic
1019406023 7:884513-884535 CACAGAGGCAGGGCACCAGGAGG - Intronic
1019442966 7:1056611-1056633 ACCACACACAGGGCCACAGCAGG - Intronic
1020989027 7:15172408-15172430 CCCACAGAGAGGGCCACAACTGG + Intergenic
1022152098 7:27618448-27618470 CACGCAGATAGGGACCCAGAAGG + Intronic
1023225747 7:37967087-37967109 GACAAAGGCAGGGCTCCAGCAGG + Intronic
1023293124 7:38687772-38687794 CAGACACACAGGGTCCAAGCTGG + Intergenic
1023374227 7:39540021-39540043 CACACAGAAAGGGCCTGAGCAGG - Intergenic
1023888571 7:44377135-44377157 CACTCAGAGAGGGACCCAGGAGG - Intergenic
1025765890 7:64449608-64449630 CAGACAGACAGTCACCCAGCTGG + Intergenic
1026853707 7:73739544-73739566 AAGACAGACAGCACCCCAGCAGG - Intergenic
1026938429 7:74272556-74272578 CACACAGCCTGGCCCACAGCAGG - Intergenic
1026965282 7:74435425-74435447 CCCTCAGACAGGGCCCCTGCTGG + Intergenic
1027764773 7:82325859-82325881 CACACAGACAGTGCTCTGGCCGG - Intronic
1028140930 7:87274139-87274161 CACCCACACAGGGTCCCCGCTGG - Intergenic
1034347372 7:150395892-150395914 CAGACAGCCAAGGTCCCAGCAGG + Intronic
1034432280 7:151047052-151047074 CCAACAAGCAGGGCCCCAGCAGG - Intronic
1034451021 7:151137358-151137380 CACAAAGAAATGGCCCCAGGCGG - Intronic
1034879672 7:154753560-154753582 CACACCCAGATGGCCCCAGCTGG - Intronic
1034948398 7:155279599-155279621 CACACAGACAGTGGCCCCTCTGG - Intergenic
1035202884 7:157278331-157278353 CAGACAGACAGGCCCACAGGTGG + Intergenic
1035277907 7:157758845-157758867 CACGCAGGCAGGGCTCCATCCGG - Intronic
1035299314 7:157887005-157887027 CACACAGCCAAGCCCACAGCGGG + Intronic
1035362254 7:158321341-158321363 GACACAGCCAGGACCCCACCTGG + Intronic
1035625425 8:1067365-1067387 CCTACAGGCAGGGCCCCTGCTGG - Intergenic
1035649627 8:1255002-1255024 CACACACACAGCGCCCAAGCAGG - Intergenic
1035649736 8:1255642-1255664 CACACACACAGCGCCCGGGCAGG - Intergenic
1035649808 8:1256087-1256109 CACACACACAGCGCCCGGGCAGG - Intergenic
1035649845 8:1256289-1256311 CACACAGACAGCACCCGGGCAGG - Intergenic
1035840736 8:2809877-2809899 CACTCACACATGGCCCCAGTAGG - Intergenic
1036482995 8:9154199-9154221 CTCCCAGACAGGGTCGCAGCCGG + Exonic
1036685589 8:10907824-10907846 CACTCAGGCAGGGCCTCCGCGGG - Intronic
1037573604 8:20179895-20179917 CACACAGACCTGGCCACAGGAGG + Intronic
1037636081 8:20701970-20701992 CACTCAGACATGGCTCCAGAAGG - Intergenic
1039810982 8:41048091-41048113 CACAGAGGCAGGGACACAGCGGG + Intergenic
1040041313 8:42919099-42919121 CACCCAGACAGGGCGGCTGCCGG + Intronic
1040379888 8:46862351-46862373 CAGACTGGCAGGGCCCAAGCAGG - Intergenic
1041868658 8:62607347-62607369 CACACATAGTTGGCCCCAGCAGG - Intronic
1042452697 8:68967289-68967311 CACACACACACAGCTCCAGCAGG + Intergenic
1043504246 8:80886711-80886733 TACACAGACAGGGTCCAAGCAGG - Intergenic
1047304250 8:123640234-123640256 CAGAAGGACATGGCCCCAGCAGG - Intergenic
1049645957 8:143735691-143735713 CAGGCAGACAGGACACCAGCTGG + Intergenic
1050765435 9:9127249-9127271 CACATAGACAGTGACCCAGCTGG + Intronic
1051837880 9:21361506-21361528 CACACAGACAAGGCCCTGGTGGG + Intergenic
1051845848 9:21450288-21450310 CACACAGACAAGGCCCTGGTGGG - Intergenic
1053246413 9:36538158-36538180 CACACAGGCAGGGCCCCTGCCGG + Intergenic
1054927343 9:70601922-70601944 CACAGCCACAGGGCCCCAGCAGG + Intronic
1055148533 9:72965661-72965683 TATACAGACAGTGGCCCAGCTGG + Intronic
1056642395 9:88382618-88382640 CACCCAGAGAGGCTCCCAGCAGG + Intergenic
1057198437 9:93127789-93127811 CTCCCAGAGAGGGCCCCAGGAGG - Intronic
1059849069 9:118316833-118316855 CACACAGAAAGGGTCCCAATGGG - Intergenic
1059991315 9:119868960-119868982 CACTCTGGCAGGGGCCCAGCAGG + Intergenic
1060938563 9:127530163-127530185 CACCCAGGCCGGGCCACAGCAGG + Intronic
1061264589 9:129497636-129497658 AACCCAGAGAGGGCCCCAGGAGG + Intergenic
1061954817 9:133955922-133955944 CACAAAGGCACGGCCCCTGCTGG + Intronic
1062424084 9:136498088-136498110 CACAGAGACTGGGCCCCAGAGGG - Intronic
1062488686 9:136793634-136793656 CACACAGACACGGCTACAACGGG - Intronic
1062536451 9:137023195-137023217 CACAGAGCCCTGGCCCCAGCTGG + Intronic
1062718886 9:138024440-138024462 CACAAAGACAGGGCGGCGGCTGG - Intronic
1185464410 X:346260-346282 CGCACTGACAGCGCCCCCGCAGG - Exonic
1186474754 X:9848830-9848852 CACTCACGCAGGGCACCAGCTGG - Intronic
1188770632 X:34148911-34148933 CACACAGACAGTGGCCCCTCTGG + Intergenic
1190691046 X:52913458-52913480 CTCACCCACAGGGCCCCTGCCGG + Intergenic
1190694937 X:52942334-52942356 CTCACCCACAGGGCCCCTGCCGG - Intronic
1191052699 X:56211799-56211821 CAGACAGACAGAGCACCAGGTGG - Intergenic
1197495471 X:127173946-127173968 CACGAAGACATGGCCTCAGCCGG + Intergenic
1197769484 X:130081167-130081189 CAGACAGCCAGGGAGCCAGCTGG - Intronic
1198310984 X:135425521-135425543 CACGCAGCAAGGGCCCCATCTGG - Intergenic
1200099230 X:153681367-153681389 CCGACAAACAGGACCCCAGCCGG + Intronic
1200296364 X:154924603-154924625 CACACACACAGAGTCCCTGCTGG - Intronic
1200697090 Y:6370528-6370550 CACACAGACAGGCCACCAAAAGG + Intergenic
1200706475 Y:6447085-6447107 CACACAGACAGGCCACCAAAAGG + Intergenic
1200914368 Y:8558418-8558440 CACACAGACAGCTCACCAGAAGG - Intergenic
1200914633 Y:8560769-8560791 CACACAGACAGGACACCAAAGGG - Intergenic
1200923488 Y:8633776-8633798 CACACAGACAGGCCACCAAAAGG - Intergenic
1200925949 Y:8654855-8654877 CACACAGACAGGACACCAAAAGG - Intergenic
1200932007 Y:8705549-8705571 CACACAGACAGGCCACCAAAAGG + Intergenic
1200961723 Y:9002025-9002047 CACACAGACAGGCCACCAAAAGG - Intergenic
1200962320 Y:9006958-9006980 CACACAGACAGGCCACCAAAAGG - Intergenic
1201027637 Y:9717623-9717645 CACACAGACAGGCCACCAAAAGG - Intergenic
1201037023 Y:9794171-9794193 CACACAGACAGGCCACCAAAAGG - Intergenic
1201628259 Y:16039304-16039326 GAAACAGTGAGGGCCCCAGCTGG - Intergenic
1202178098 Y:22116082-22116104 CACACAGACAGGCCACCAAAAGG + Intergenic
1202180976 Y:22139629-22139651 CACACAGACAGGCCACCAAAAGG + Intergenic
1202210384 Y:22446771-22446793 CACACAGACAGGCCACCAAAAGG - Intergenic
1202213263 Y:22470313-22470335 CACACAGACAGGCCACCAAAAGG - Intergenic