ID: 948131691

View in Genome Browser
Species Human (GRCh38)
Location 2:235605514-235605536
Sequence AGGGAGAAGATAAATGATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 1, 2: 3, 3: 34, 4: 471}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948131691_948131696 1 Left 948131691 2:235605514-235605536 CCGGCATCATTTATCTTCTCCCT 0: 1
1: 1
2: 3
3: 34
4: 471
Right 948131696 2:235605538-235605560 CCTTGTTGCCAAGGCACGTGTGG 0: 1
1: 0
2: 1
3: 8
4: 217
948131691_948131700 16 Left 948131691 2:235605514-235605536 CCGGCATCATTTATCTTCTCCCT 0: 1
1: 1
2: 3
3: 34
4: 471
Right 948131700 2:235605553-235605575 ACGTGTGGGTCCCTAACGGCTGG 0: 1
1: 0
2: 1
3: 2
4: 31
948131691_948131697 2 Left 948131691 2:235605514-235605536 CCGGCATCATTTATCTTCTCCCT 0: 1
1: 1
2: 3
3: 34
4: 471
Right 948131697 2:235605539-235605561 CTTGTTGCCAAGGCACGTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 109
948131691_948131699 12 Left 948131691 2:235605514-235605536 CCGGCATCATTTATCTTCTCCCT 0: 1
1: 1
2: 3
3: 34
4: 471
Right 948131699 2:235605549-235605571 AGGCACGTGTGGGTCCCTAACGG 0: 1
1: 0
2: 1
3: 3
4: 67
948131691_948131692 -8 Left 948131691 2:235605514-235605536 CCGGCATCATTTATCTTCTCCCT 0: 1
1: 1
2: 3
3: 34
4: 471
Right 948131692 2:235605529-235605551 TTCTCCCTACCTTGTTGCCAAGG 0: 1
1: 2
2: 1
3: 23
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948131691 Original CRISPR AGGGAGAAGATAAATGATGC CGG (reversed) Intronic
900499095 1:2991071-2991093 AGGGAGATGCTAATTGAAGCAGG - Intergenic
903527432 1:24002513-24002535 ATGAAGAAGATAAAAGAGGCCGG + Intergenic
905641164 1:39591002-39591024 AGGGAGAAGATGGAAGATCCCGG + Intergenic
905998221 1:42400758-42400780 AGGCAGCAGATAAATGAATCTGG + Intronic
906059330 1:42938185-42938207 AGGGAGCAGCTAAATGAACCAGG - Intronic
906734682 1:48114423-48114445 AGGGAGAGGACAAATGGTGTAGG - Intergenic
908097690 1:60757571-60757593 AGGGAGAGTATAAATGAGACAGG - Intergenic
908239757 1:62178928-62178950 AGGGCTAAGAAAAATGAAGCTGG - Intergenic
908253721 1:62285388-62285410 AGGGTGCGGATAAATGCTGCAGG - Intronic
909589769 1:77334077-77334099 AGGTAGAAGAAAAATGATCCAGG - Intronic
909969619 1:81966028-81966050 AGGGAAAAGATAAAGGAGGTGGG - Intronic
910800167 1:91137515-91137537 AGAGAGGAGATTCATGATGCAGG - Intergenic
911185899 1:94904794-94904816 AATGAGAAGACAAATGATACTGG - Intronic
911540451 1:99151506-99151528 AGGGAGAAAAGAAATAATCCAGG + Intergenic
911772922 1:101770164-101770186 AGGAAGAAAATAAATTAAGCAGG - Intergenic
913687275 1:121244472-121244494 AGGAACAAGGTAAATGATTCAGG - Intronic
914039136 1:144032117-144032139 AGGAACAAGGTAAATGATTCAGG - Intergenic
914834213 1:151193970-151193992 AGGGAGAGGCTAAATTATGAAGG - Intronic
915581463 1:156815547-156815569 AGGATGAAGAAACATGATGCAGG + Intronic
915822670 1:159042070-159042092 AGGTAGAAGACATATGATCCTGG - Intronic
916116760 1:161491382-161491404 AGGGCTAAGAAAAATGAAGCTGG + Intergenic
916807018 1:168269197-168269219 AGGGAGAAGAACGATGCTGCTGG - Intergenic
917098589 1:171424081-171424103 AGAGAGAAGATAAATTTGGCTGG + Intergenic
918231342 1:182535564-182535586 AGAGAAAATAAAAATGATGCAGG - Intronic
918953059 1:191165358-191165380 GGGGAGCAGATAAATGGTCCAGG + Intergenic
919321629 1:196048051-196048073 AGAGAGGAGAAAAATGAGGCAGG + Intergenic
919596072 1:199563720-199563742 AGGCAGAAGAAAAATGATATAGG + Intergenic
920073056 1:203316987-203317009 AGGCAGTAGATAAGTGAGGCTGG + Intergenic
920474604 1:206262993-206263015 AGGAACAAGGTAAATGATTCAGG - Intronic
922518018 1:226223095-226223117 GGGGTGAAGATAAAGGATCCAGG - Intergenic
1063698029 10:8356541-8356563 AGGGAGAAAATAAATTAAGAAGG - Intergenic
1064278405 10:13928833-13928855 AGGGAGAGGAAAAAGGAAGCTGG - Intronic
1064815299 10:19254199-19254221 AAGGAGCTGATAAATGATACAGG + Intronic
1064937366 10:20692991-20693013 TGGGAGAAGAAAAATAACGCCGG - Intergenic
1064940483 10:20729433-20729455 AGGCAGAAGGAAAATGATACTGG + Intergenic
1065239083 10:23687224-23687246 AAGGAGGAGTTTAATGATGCTGG - Intergenic
1066486541 10:35851424-35851446 AGGGAGGTGATAAAGGATACAGG + Intergenic
1066792425 10:39080704-39080726 AGGGCTAAGAAAAATGAAGCTGG - Intergenic
1067095868 10:43299414-43299436 AGGGCTAAGAAAAATGAAGCTGG - Intergenic
1067677639 10:48398619-48398641 AGGGTTATTATAAATGATGCTGG - Intronic
1068785468 10:60967930-60967952 AGGGAGAAGTTCCATTATGCTGG + Intronic
1068890137 10:62140196-62140218 AGAGAGAAGAAAAATGATACAGG - Intergenic
1069595915 10:69670122-69670144 AGGGAGAAGGTTGATGAGGCAGG - Intergenic
1069775944 10:70927197-70927219 AGGAAGAAGATTCATGAGGCAGG + Intergenic
1070506376 10:77116942-77116964 AGGGAGAGGCCAAATCATGCAGG - Intronic
1070763510 10:79042237-79042259 AGAGAGAAGGAAAATGATACAGG + Intergenic
1071035755 10:81242765-81242787 GGAGAGAAGAAAAATGATACAGG + Intergenic
1071278835 10:84081181-84081203 AGGCAGAAGGAAAATGATACAGG - Intergenic
1073263524 10:102208675-102208697 ATGGAGGAGATAAGTGAGGCAGG - Intergenic
1073782519 10:106854995-106855017 AGAGAGAAGGAAAATGATACAGG - Intronic
1073851529 10:107624610-107624632 AGGCAGAAGACAAAAAATGCTGG - Intergenic
1073944353 10:108732521-108732543 AGGGTTAAGAAAAATGAAGCTGG + Intergenic
1077455610 11:2677425-2677447 GGGGAGATGATAATTGATGCAGG + Intronic
1077470984 11:2760446-2760468 AGTGAGGAGATGAATGAAGCGGG + Intronic
1080004579 11:27393251-27393273 AGGGAGAAGAATCAGGATGCAGG + Intronic
1080308050 11:30858089-30858111 AGGGAGAAAACAAATGAAACAGG - Intronic
1080432127 11:32208991-32209013 AGGGAGAAGAGAGAAGAAGCGGG + Intergenic
1080514718 11:33009633-33009655 GGGGAAAAAAAAAATGATGCAGG + Intergenic
1082143564 11:48638625-48638647 AGGGAGAAGAAAAGAGATGTTGG - Intergenic
1082245103 11:49912335-49912357 AAGGAGAAATTAAATGCTGCTGG + Intergenic
1082693025 11:56328304-56328326 AGGGCTAAGAAAAATGAAGCTGG - Intergenic
1082693891 11:56336734-56336756 AGGTTGAAGATAAAAGAAGCTGG + Intergenic
1083210194 11:61179358-61179380 AGACAGAAGATAACAGATGCTGG - Intergenic
1083316175 11:61816198-61816220 AGGGAGGAGAGCAAGGATGCAGG - Intronic
1085750348 11:79155758-79155780 AGGAAGAAGAGAAAGGAGGCAGG - Intronic
1085915371 11:80881179-80881201 AGTCAGAAAATAAAAGATGCTGG + Intergenic
1086065280 11:82737191-82737213 AGGGAAAGGACAAATGATGCTGG - Intergenic
1086270398 11:85056958-85056980 AGGTAGAAGGAAAATGATACTGG + Intronic
1086778368 11:90869376-90869398 AGAGCTAAGATAAATGATGAAGG + Intergenic
1087004394 11:93454847-93454869 AGTGAGAAAATAAAAGATGCTGG + Intergenic
1087409793 11:97777143-97777165 AGGGAGATCATGCATGATGCAGG - Intergenic
1088389967 11:109303344-109303366 AGGGAGAACATAGATGAAGAGGG - Intergenic
1088602540 11:111494090-111494112 AGGGAGAAGATACAAGCGGCTGG + Intronic
1089100357 11:115957945-115957967 AGGGAGTAAATAAATGGTGCAGG - Intergenic
1091088252 11:132744759-132744781 AGGGAGCAAATAAATGCTGAGGG + Intronic
1091127447 11:133113407-133113429 AGGGAGAAGAACAAGGAAGCAGG + Intronic
1091307576 11:134546564-134546586 AGAGAGATAAAAAATGATGCAGG + Intergenic
1092112976 12:5977050-5977072 ACTGAGAAGATAAATGATAATGG - Intronic
1092599668 12:10045766-10045788 AGGGAGTAGGTAAGTGATTCTGG - Intronic
1093105662 12:15083425-15083447 AGAAAGAAGAAAAATGATACAGG + Intergenic
1093106418 12:15093069-15093091 GTGGAGAAGAGAAATTATGCTGG - Intergenic
1093227682 12:16505090-16505112 AGTGAGAATATAAAGGAAGCAGG - Intronic
1093262445 12:16955638-16955660 AGACAGAACCTAAATGATGCAGG + Intergenic
1093348790 12:18071323-18071345 AGGGCTAAGAAAAATGAAGCTGG + Intergenic
1093619669 12:21274039-21274061 AGGGAGAAAATATATGATTTTGG + Intronic
1093970943 12:25375448-25375470 AGGGGGAGGATAAATTTTGCAGG + Intergenic
1096059366 12:48683470-48683492 AGTGAGGAGATAAGAGATGCTGG - Intergenic
1097290365 12:57909254-57909276 AGGGAGAAAAGAACTGATGTCGG + Intergenic
1097502669 12:60425559-60425581 TGTGAGCAGAAAAATGATGCAGG - Intergenic
1098959761 12:76727662-76727684 AGGGAGAGGATAAAATATTCAGG - Intergenic
1099096015 12:78375676-78375698 AGGCAGATGAGAAGTGATGCTGG - Intergenic
1099514353 12:83578353-83578375 AGGTAGAGGTTATATGATGCAGG - Intergenic
1102397979 12:112603787-112603809 AGGGCGAAGAAAAATGAGACTGG - Intronic
1103151879 12:118647965-118647987 AAGGAGAAGATAATAGATGTTGG + Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1104992201 12:132632019-132632041 AGGGACATGATAAATGTTGGTGG + Intronic
1105549413 13:21379267-21379289 AGGAAAAAGAAAAATGATTCTGG - Intronic
1106007626 13:25785837-25785859 AGGAAGAAGATAAAGGAAGGAGG + Intronic
1106052138 13:26201468-26201490 AGGCAGAAGATAAATGGTGGGGG + Intronic
1106114464 13:26805448-26805470 GGGTAGAAGAGAAATGCTGCTGG + Intergenic
1106713332 13:32361574-32361596 AGGGAAAAAATTGATGATGCAGG + Intronic
1106825969 13:33520771-33520793 AGGAAGAAGTTACATGAGGCAGG + Intergenic
1108604885 13:52027354-52027376 AGGGAAAGGGTAAAAGATGCAGG + Intronic
1108700093 13:52936407-52936429 AAGGAAAAGAGAAATGAAGCAGG + Intergenic
1108963915 13:56272508-56272530 AGGGCTAAGAAAAATGAAGCTGG + Intergenic
1109606508 13:64704867-64704889 AGGGCTAAGAAAAATGAAGCTGG - Intergenic
1110827136 13:79985687-79985709 AGAGAGAAGAAAAATGATACCGG - Intergenic
1111746332 13:92274393-92274415 ATGGAGAGGGTAGATGATGCTGG - Intronic
1111799148 13:92960709-92960731 GGGCAGAAGAAAAATGCTGCCGG + Intergenic
1111806417 13:93044217-93044239 AGGGCTAAGAAAAATGAAGCTGG + Intergenic
1112219344 13:97472048-97472070 AGGGAGAAGTTGTGTGATGCAGG + Intergenic
1112809716 13:103203676-103203698 AGGGAAAAAAAAAATGATGACGG - Intergenic
1113262896 13:108585415-108585437 AGGGTGAAGATAAAGGATTGTGG + Intergenic
1113757988 13:112827387-112827409 ATGGAGATGATAACAGATGCTGG + Intronic
1115152410 14:30301270-30301292 AAGGAAAAGATAAATGATTTTGG - Intergenic
1115720067 14:36151007-36151029 AGGGAGAAGAAAAATGATATAGG - Intergenic
1115926683 14:38443461-38443483 AGTGAAAAGATAACAGATGCTGG - Intergenic
1116023587 14:39489608-39489630 AGGGAGAAGAGAATTGCAGCAGG + Intergenic
1116083904 14:40209762-40209784 AGGGAGAAGAACAATGATACAGG + Intergenic
1116236987 14:42291793-42291815 AGAGAGAAGAAAAATGATATAGG + Intergenic
1116779308 14:49218666-49218688 AGGGAAAAAATAGATGATGGAGG + Intergenic
1117347821 14:54851129-54851151 GGGGAAAACATAAATGGTGCTGG + Intronic
1117607963 14:57451081-57451103 AGAGAGAAGAAAAATGATATAGG - Intergenic
1117914007 14:60658173-60658195 AGGCAGAAGATAAGTGAGTCTGG - Intronic
1118115133 14:62767200-62767222 AGGGAGCACATAGATGTTGCTGG + Intronic
1118242578 14:64074300-64074322 AGGGAGAAGATCAGTGTGGCTGG + Intronic
1118542476 14:66843268-66843290 GGGGAGCAGATAGATAATGCTGG - Intronic
1118841192 14:69513724-69513746 AGGGAGAAGGAAAATGATATAGG - Intronic
1119626470 14:76181164-76181186 AGGGAGAAGTCAGATTATGCAGG - Intronic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1120590793 14:86371221-86371243 AGGGAGAGGAAAGATGATGCAGG - Intergenic
1123507870 15:20963332-20963354 AGAGAGAAAATAAGTGATGGAGG - Intergenic
1123565088 15:21537071-21537093 AGAGAGAAAATAAGTGATGGAGG - Intergenic
1123601351 15:21974361-21974383 AGAGAGAAAATAAGTGATGGAGG - Intergenic
1125792703 15:42381254-42381276 AGGGAGAAGAAAAATGATACAGG - Intronic
1127018068 15:54711121-54711143 AAGGAGGAGATAAGGGATGCTGG - Intergenic
1127387670 15:58480113-58480135 AGGAAGAAGATGAATGTTACTGG - Intronic
1127768673 15:62212564-62212586 AGGGCTAAGAAAAATGAAGCTGG - Intergenic
1127888553 15:63226599-63226621 AGTGTGAAGAAAAATGACGCTGG - Intronic
1128383135 15:67127868-67127890 AGGGAGACTATCAATGAAGCTGG + Intronic
1128714257 15:69895622-69895644 AGGTACAGGATAAATGATGGTGG - Intergenic
1129149145 15:73676747-73676769 AGTGAAAAGATTGATGATGCAGG + Intergenic
1129531474 15:76268772-76268794 AGGGCTAAGAAAAATGAAGCTGG + Intronic
1131286564 15:91063964-91063986 AAAGAGAAAATAAATGATCCAGG - Intergenic
1131591406 15:93752849-93752871 ATGGTAAAGATACATGATGCTGG + Intergenic
1202973459 15_KI270727v1_random:264180-264202 AGAGAGAAAATAAGTGATGGAGG - Intergenic
1133392066 16:5418720-5418742 AGGAAGAAAATAAAGGATGAAGG - Intergenic
1134357519 16:13497820-13497842 AAAGAAAAGATAAATGGTGCTGG + Intergenic
1134397105 16:13875189-13875211 CGGGTGAAGATAAATGATTGTGG - Intergenic
1135224945 16:20647569-20647591 AGGGCTAAGAAAAATGAAGCTGG + Intronic
1137054846 16:35739833-35739855 AGGAAGAGGATAAATCAGGCTGG + Intergenic
1137706370 16:50538634-50538656 AGGGACCAGAGAAATCATGCTGG + Intergenic
1137820778 16:51443318-51443340 AGGGAGAAGATAATTTGTGCTGG + Intergenic
1138781206 16:59790189-59790211 AGGCAGAAGGAAAATGATACAGG - Intergenic
1139121954 16:64031006-64031028 AGAGAGAAGAAAAATAATACAGG - Intergenic
1139184791 16:64793155-64793177 AGGGAGAAAATAATACATGCAGG - Intergenic
1139232587 16:65298869-65298891 AGAGAGAAGAAAAATGATTTGGG + Intergenic
1140703559 16:77605042-77605064 AGGGAGAAAAACTATGATGCAGG - Intergenic
1140962761 16:79932374-79932396 AGAAAGAATATAAATCATGCTGG + Intergenic
1142441160 16:90098367-90098389 ATGGAGGAGATAGATGATGCAGG - Intergenic
1142644864 17:1305087-1305109 AGGCAGCAGATCAATAATGCAGG - Intergenic
1143278627 17:5733257-5733279 AGGCAGAAGATAAATAATATAGG - Intergenic
1143910895 17:10247896-10247918 GGGGAGAAGAGAAAAGATGTTGG + Intergenic
1144140618 17:12343681-12343703 AGGGAGAAGAGAGACGAAGCTGG - Intergenic
1145119592 17:20245820-20245842 GTGGAGAAAATAAATGAAGCTGG - Intronic
1145194348 17:20875847-20875869 ATGGAAAAGTTATATGATGCAGG - Intronic
1146085998 17:29830205-29830227 AGGGAGAAAATAACTCAAGCTGG - Intronic
1146986702 17:37227015-37227037 AGGAAGAAGAGAAATGATTTGGG - Intronic
1148249830 17:46067168-46067190 AGGGAGAAAACAAAAGATTCAGG - Intronic
1148669891 17:49402717-49402739 AGGCCTGAGATAAATGATGCTGG + Intronic
1148965482 17:51431461-51431483 AGGCAGAAGATCAATGCTGAGGG - Intergenic
1149911937 17:60574674-60574696 GGGGAGAAGAAAAAAGATGATGG - Intronic
1150161481 17:62901809-62901831 AGGGAGTAGCTAGATGGTGCTGG - Intergenic
1151042716 17:70882499-70882521 AGGAAGAAGAGAAAGCATGCAGG + Intergenic
1151999996 17:77639251-77639273 AGGGAGGAGAGGAAGGATGCTGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154082579 18:11273010-11273032 AGGGTGATGAAAAATGAAGCTGG + Intergenic
1154372049 18:13773036-13773058 TTGGAGAAAAAAAATGATGCTGG - Intergenic
1155977311 18:32144922-32144944 AGAGTGATGATAAATGAGGCTGG - Intronic
1156115112 18:33778157-33778179 AGGGAATAGATAAATGACGGGGG + Intergenic
1156229382 18:35139088-35139110 AGGAAGAAAACAAATGCTGCAGG + Intronic
1157748437 18:50157567-50157589 GGGGAGAAGAGAAATGTGGCTGG - Intronic
1157963715 18:52184525-52184547 AAGTGGAAGAAAAATGATGCAGG - Intergenic
1158365824 18:56734560-56734582 AGGGATAGGATAGAGGATGCAGG - Intronic
1158366061 18:56737517-56737539 AGGTAAAAGATAAATCATCCTGG - Intronic
1158754044 18:60300698-60300720 AGGTAGAAGATGAATGATTGAGG + Intergenic
1159115316 18:64106737-64106759 AAGGAGCAGAAAAATGACGCAGG + Intergenic
1159373275 18:67557814-67557836 AGAGAGAAGAAAAATGATACAGG - Intergenic
1162203745 19:9040206-9040228 AGGGAGAAGATAGAAGAGGAAGG + Intergenic
1162687130 19:12396884-12396906 AGAGAGAAGAAAAATGATACAGG + Intronic
1162691457 19:12436711-12436733 AGAGAGAAGAAAAATGTTACAGG + Intronic
1162719945 19:12656431-12656453 AGGGAGAAGATACAAGAGGGGGG + Intronic
1162991757 19:14307416-14307438 GGGGAGAAGAAAAATGAGACAGG - Intergenic
1165004809 19:32796071-32796093 GGTGTGAAGGTAAATGATGCAGG + Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165790052 19:38485974-38485996 AGGGGGGCGAGAAATGATGCGGG - Exonic
1166437229 19:42777771-42777793 TGGAAGAAGGTAAGTGATGCTGG + Intronic
1166466134 19:43032438-43032460 TGGAAGAAGGTAAGTGATGCTGG + Intronic
1168500320 19:56887613-56887635 GGGGAGAAGAGAAATGGTGCAGG - Intergenic
926993408 2:18705715-18705737 AGAAAGAAGATAAATGATCTGGG + Intergenic
928332893 2:30371153-30371175 AGGGTGAAAAAAAATGAGGCTGG + Intergenic
929278310 2:40049592-40049614 TGGGGAGAGATAAATGATGCTGG - Intergenic
929952963 2:46430262-46430284 AGGGAGAAGAGGAAGGATGAAGG + Intronic
930232310 2:48855832-48855854 AAGCAGAAGGTACATGATGCAGG + Intergenic
930594016 2:53363725-53363747 AGGGAGAAAGAAAATGCTGCTGG + Intergenic
930624398 2:53680396-53680418 AGGTAGAAAATAATAGATGCTGG - Intronic
930739386 2:54814455-54814477 AGGGAGGAGATGAATGCAGCCGG - Intronic
932069686 2:68606923-68606945 AGGGCTAAGAAAAATGAAGCTGG - Intronic
932936365 2:76107642-76107664 AGGGAGAAGGAAAATGATATAGG - Intergenic
933335377 2:80951226-80951248 ATGGAGATGAAAAATGAAGCTGG - Intergenic
933614649 2:84471322-84471344 AGGGCTAAGAAAAATGAAGCTGG - Intergenic
933885250 2:86713297-86713319 AGAGAGAAGGAAAATGATGTAGG + Intronic
933887345 2:86730733-86730755 AGAGAGAAGAAAAAAGATACAGG - Intronic
933922830 2:87065980-87066002 AGAGAGAAGAAAAAAGATACAGG + Intergenic
933924924 2:87083386-87083408 AGAGAGAAGGAAAATGATGTAGG - Intergenic
934161597 2:89254737-89254759 AGGGAGAAGATTTCTGATGTTGG - Intergenic
934205687 2:89927678-89927700 AGGGAGAAGATTTCTGATGTTGG + Intergenic
934850307 2:97695495-97695517 AGGGTGAAGATACATTATTCAGG - Intergenic
935809169 2:106779908-106779930 AAGGAGAAGAAAAAGAATGCTGG + Intergenic
936399058 2:112152087-112152109 AGTGAGAGGATGAATGAGGCAGG + Intronic
936809669 2:116382784-116382806 AGGCAGAAGAAAAATGATAGAGG - Intergenic
940736064 2:157453783-157453805 AGAGAGAAGACAAATGAAACAGG - Intronic
943214707 2:185015665-185015687 AGGGACAAGAAGAAAGATGCTGG + Intergenic
943241603 2:185391280-185391302 AGGCAGGAGCTAAATAATGCAGG - Intergenic
943456155 2:188110125-188110147 AGGCAGAAGGAAAATGATACTGG - Intergenic
943521667 2:188959413-188959435 AGTGAGAAGAAAAATAAAGCAGG + Intergenic
945543221 2:211115291-211115313 AGGGAGAAGCCAAATCATTCAGG - Intergenic
945771352 2:214046733-214046755 AGGAAGAAGTTAAATTATCCTGG + Intronic
945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG + Exonic
947960281 2:234230466-234230488 AGGGAGAAGAGAAATGAGCTTGG + Intergenic
948131691 2:235605514-235605536 AGGGAGAAGATAAATGATGCCGG - Intronic
948193641 2:236078991-236079013 TGGGGGAAGATACCTGATGCCGG + Intronic
948504958 2:238422465-238422487 GGTGAGGAGATAAATGCTGCTGG + Intergenic
948546686 2:238737063-238737085 AGGGAGAAGAAAAATCATATAGG - Intergenic
949038031 2:241827748-241827770 AAGTAGAAGAAAAATGATTCTGG + Intergenic
1168910065 20:1440485-1440507 AGAGAGAAGAAAAATGAAGCAGG + Intergenic
1168950450 20:1796552-1796574 ATGGTGAAGAGAAATGATGTGGG - Intergenic
1169110094 20:3027069-3027091 AGGGAGAGGACAAATGATATTGG + Intronic
1169407750 20:5337334-5337356 AGGGTAAAAATAAAGGATGCTGG - Intergenic
1169510971 20:6263144-6263166 AGGGAGAAGATATATTTTCCTGG + Intergenic
1169798620 20:9492864-9492886 AAGAAGAAGACAAATGGTGCGGG + Intergenic
1170034941 20:11980352-11980374 AAGGAGAAGGTAGATGCTGCTGG + Intergenic
1171151261 20:22828198-22828220 AGTGAGCAGATAACTGCTGCGGG - Intergenic
1171170123 20:23008303-23008325 AGTGAGAAGATGAATGTTTCCGG - Intergenic
1171340239 20:24421643-24421665 AGGGAGAAAATAAATGAGTAAGG - Intergenic
1171353733 20:24526684-24526706 AGGAAGAAGAAAAATAATGCTGG - Intronic
1171562885 20:26143475-26143497 ATGGAAAAGTTATATGATGCAGG - Intergenic
1172486438 20:35300748-35300770 AGGGATAATAAAAATGATGAGGG + Intergenic
1172955527 20:38755366-38755388 AAGGTGAAAATAAATAATGCTGG - Intronic
1173161188 20:40653627-40653649 AGGGAAATGAGAAATGAGGCAGG + Intergenic
1173428358 20:42962733-42962755 AGGGAGGAGGTAAATGGTGGTGG - Intronic
1174944243 20:54967240-54967262 TGGGAGAATATCATTGATGCAGG - Intergenic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1177347398 21:19891236-19891258 AATGAGAAGATAAATATTGCAGG - Intergenic
1177347750 21:19895504-19895526 AATGAGAAGATAAATGTTTCAGG - Intergenic
1177666524 21:24166789-24166811 AGTGAAAACATAAAAGATGCTGG - Intergenic
1177739059 21:25131843-25131865 GGGGAGAAGCTAAATGAATCCGG - Intergenic
1177884293 21:26730715-26730737 AGGAACAAGAAAAATGATTCTGG - Intergenic
1178399781 21:32275615-32275637 AGGGTGAAGAGAAATGAAGAAGG + Intronic
1179593032 21:42423547-42423569 AAGGACATGCTAAATGATGCGGG - Intronic
1180734375 22:18004678-18004700 AGGGTGAAGTTAAATAATGCGGG - Intronic
1180899803 22:19362167-19362189 AGAGAGAAGATAAATGATGCAGG + Intronic
1181323601 22:22027334-22027356 AGGTGGAAGATAAATGATAATGG + Intergenic
1182049165 22:27299899-27299921 AGGGAGGTGATAAAAGAAGCAGG + Intergenic
1182491594 22:30675902-30675924 AGGGCTAAGAAAAATGAAGCTGG - Intergenic
1182951463 22:34380216-34380238 AGGAAGAAGGGAAATGATGGTGG + Intergenic
1184198338 22:42947239-42947261 AGGGAGAAGAGGAATGCTCCAGG + Intronic
1184349651 22:43935471-43935493 AAGGAGAAGACACAGGATGCTGG + Intronic
1184367635 22:44062696-44062718 AAGGAGATGATAAAGGGTGCAGG + Intronic
950404612 3:12796890-12796912 AGGGAGAAGAGAGAAGAGGCAGG - Intronic
950555155 3:13691081-13691103 AGGGAAAAAATAAATGGGGCTGG + Intergenic
951308011 3:21089743-21089765 AGGCAGAGGATAACAGATGCTGG + Intergenic
952473252 3:33678651-33678673 AGAGAGAAGGAAAATGATACAGG + Intronic
956812572 3:72878420-72878442 AGAGAGAAGGAAAATGATGTAGG - Intergenic
956815197 3:72901855-72901877 AGGAAGTAGATTAATGAGGCTGG - Intronic
956843584 3:73161853-73161875 AAAAAGAAGATAAATGCTGCTGG + Intergenic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957541128 3:81570462-81570484 AGGGAGAAGATGAAGGTTGATGG + Intronic
957645764 3:82923182-82923204 AGAGAGAAGGTAAATGATAGAGG + Intergenic
957684135 3:83478028-83478050 AGGAAAAAGATAAATGAAGGAGG + Intergenic
958998368 3:100932685-100932707 AGTCAGAAGATAACAGATGCTGG + Intronic
959108077 3:102088959-102088981 AAGAATCAGATAAATGATGCAGG - Intergenic
959969690 3:112395349-112395371 AGGGATAGGAAAAATGAAGCTGG - Intergenic
960831011 3:121847919-121847941 AGGGAGAAGAGGAAGGATGAAGG + Intronic
960846671 3:122010219-122010241 ACAGAGAAGATAAATAAGGCGGG + Intronic
961517572 3:127447571-127447593 AGGGAGAAGAGATGTGATGACGG + Intergenic
961725204 3:128923636-128923658 AGGGCTAAGACAAATGAAGCTGG + Intronic
962051305 3:131818501-131818523 AGTGAGAATTTAAATAATGCTGG - Intronic
962207556 3:133447478-133447500 AGGTAGAAGGTGGATGATGCAGG - Intronic
963390008 3:144649303-144649325 AAGGAAAAGGTAAATGATGCTGG - Intergenic
963764132 3:149316116-149316138 ATGGAGAGGAGAAAAGATGCAGG + Intergenic
963849174 3:150192564-150192586 AGAGAGAAAAAAAATGATACAGG - Intergenic
964311714 3:155400834-155400856 GGGGAGAGGGTAAATGATGGAGG - Intronic
965335630 3:167428493-167428515 AGGAAGAAGAGAAATTAGGCTGG - Intergenic
965500276 3:169447357-169447379 AGGGAACAGATGAATAATGCAGG + Intronic
965825395 3:172724176-172724198 AGGGCTAAGAAAAATGAAGCTGG + Intergenic
965964500 3:174470152-174470174 AGTGAGAAAATAACAGATGCTGG - Intronic
966114520 3:176445691-176445713 AGGGAAAAGTAAAAAGATGCTGG - Intergenic
966415908 3:179689355-179689377 AGGTAGAAAATACACGATGCTGG + Intronic
967228398 3:187314605-187314627 AGGGAGGAGATAGAAGAAGCTGG + Intergenic
967298508 3:187989230-187989252 AAAGAAAAGATAAATGATGTCGG - Intergenic
967953356 3:194857938-194857960 AGGGAGAGAAGAAATGAGGCAGG - Intergenic
967968495 3:194982706-194982728 AGGGAGAAATTCAAAGATGCTGG + Intergenic
968361422 3:198149339-198149361 ATGGAGGAGATAGACGATGCAGG - Intergenic
969159152 4:5240037-5240059 AGAGAGAAGAGAAATGAAGGGGG - Intronic
970017331 4:11526579-11526601 ATGCAGAAGAAAGATGATGCAGG - Intergenic
970122362 4:12770819-12770841 TGGGTGAAGAAAAATGATGAGGG + Intergenic
970186936 4:13465661-13465683 AGGGAGAAGGAAAATGATATGGG + Intronic
970447363 4:16135442-16135464 AGGGAGAAGTGCAAAGATGCAGG + Intergenic
971090549 4:23338713-23338735 AGAGAGAAGAAAACTGATGTAGG + Intergenic
971249356 4:24959919-24959941 AGGCAGAAGGAAAATGATACCGG + Intronic
971705492 4:30037191-30037213 AGAGAGAAAAAAAATGATTCAGG - Intergenic
972334477 4:38095101-38095123 AGGGAAAAGATTAAAGATGGTGG + Intronic
972652230 4:41029268-41029290 AGGGAGAAGCTAAATAAAGCTGG + Intronic
972692572 4:41413880-41413902 AGGGAGAAGATTAATGACTGAGG + Intronic
972832313 4:42828541-42828563 AGTGAGAAATAAAATGATGCTGG - Intergenic
972884785 4:43471994-43472016 AGGGCTAAGAAAAATGAAGCTGG + Intergenic
973199348 4:47482409-47482431 AAGAAGAAGATCAATGCTGCAGG - Intergenic
974072096 4:57133192-57133214 AGGAAGAAGCTAAAAGATGCTGG + Intergenic
974247707 4:59342153-59342175 AGTGACAAGATAGATGTTGCTGG - Intergenic
974876166 4:67705533-67705555 AGGCAGAAAATAACAGATGCTGG - Intergenic
975773207 4:77752942-77752964 ATGCAGATGATAAATTATGCAGG - Intronic
975862271 4:78690248-78690270 AGGAAAAAGATTGATGATGCAGG - Intergenic
976299975 4:83508031-83508053 AGGGAGCAGAAAAATGAAGTGGG + Intronic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976921041 4:90443281-90443303 ATGCAGAAGAATAATGATGCTGG - Intronic
977087875 4:92627778-92627800 AGTGAAAATATAAATAATGCAGG - Intronic
977257421 4:94756949-94756971 AAGGAGAAAATAAGTAATGCTGG + Intergenic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977453602 4:97228965-97228987 AGGGAGCAGAGAAATGAAACAGG + Intronic
977453936 4:97234030-97234052 AGGGAGTAGAAAAATGGTTCTGG + Intronic
977565601 4:98577404-98577426 TGGGAGAAGGCAAATGATGAGGG - Intronic
977794236 4:101143282-101143304 AGGGAGTAAATAATTGATGATGG - Intronic
978052643 4:104221435-104221457 AGGGAAAAGAAAAATGATCCTGG - Intergenic
979973517 4:127167171-127167193 GGGGAAAAATTAAATGATGCTGG + Intergenic
980822762 4:138038466-138038488 TGGGAGATGATAAATGCTGCTGG - Intergenic
981062813 4:140444866-140444888 AGGCAAAAAATAAAAGATGCTGG - Intronic
983579668 4:169295022-169295044 AGAGAGAAGAAAAATGATACAGG + Intergenic
984190511 4:176600584-176600606 AGGGACCAGAAAAATGATTCTGG - Intergenic
984702979 4:182830195-182830217 AGGCAGAAGAAAGAAGATGCCGG - Intergenic
984771552 4:183441003-183441025 GGGGAGAAGATAGAGGAAGCTGG - Intergenic
986403667 5:7404723-7404745 AGGAGGAAAATAAATGATGGTGG - Intronic
986876045 5:12111184-12111206 AGGGAGAAGGGCAATGATGCTGG + Intergenic
987876831 5:23690581-23690603 AGGGCTAAGAAAAATGAAGCCGG + Intergenic
987923055 5:24308535-24308557 AGGGCTAAGAAAAATGAAGCTGG - Intergenic
987956474 5:24748115-24748137 AGGGCTAAGAAAAATGAAGCTGG - Intergenic
989406755 5:41069978-41070000 AAAGGGAAGATAAAAGATGCCGG + Intronic
989652106 5:43702365-43702387 AGGGAGAAGCATAATAATGCAGG + Intronic
990686250 5:58304471-58304493 AGTGAGAAAACAAATCATGCTGG - Intergenic
991012365 5:61897790-61897812 ATGGACAAGATAACTGAAGCAGG + Intergenic
991292002 5:65042228-65042250 AGGAAGAAGAAAAATGCTGGAGG - Intergenic
991734701 5:69621069-69621091 TGGGAGAGGATTTATGATGCAGG - Intergenic
991780277 5:70125652-70125674 TGGGAGAGGATTTATGATGCAGG + Intergenic
991811135 5:70476210-70476232 TGGGAGAGGATTTATGATGCAGG - Intergenic
991859564 5:71001066-71001088 TGGGAGAGGATTTATGATGCAGG + Intronic
991872724 5:71125963-71125985 TGGGAGAGGATTTATGATGCAGG + Intergenic
992023993 5:72652886-72652908 ATGGAGAAGATCTCTGATGCAGG + Intergenic
993007707 5:82446209-82446231 AGGAAGAAGAAAAATGTTGTTGG + Intergenic
993429869 5:87818919-87818941 AGCCAGAAAATAACTGATGCTGG + Intergenic
993541051 5:89152168-89152190 AGGCAAAAAATAAAAGATGCTGG - Intergenic
994686853 5:102966373-102966395 AAGGAGAAGATAGAAGATGATGG - Intronic
994719137 5:103360725-103360747 AGGCAGAAGAGAAATGATGGAGG + Intergenic
995145159 5:108780221-108780243 AGGGGGAAGAAAAATGATAGAGG - Intronic
995524195 5:113037723-113037745 AGCGGGAAGATACATGATGGAGG + Intronic
996215359 5:120859238-120859260 AGGCAGAAGATTAATAATACTGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997218236 5:132132968-132132990 AGGGAGAAGGAAAATGATATAGG - Intergenic
997246244 5:132351921-132351943 AGGGAAAAGATTTATGATGGGGG - Intergenic
997926723 5:138036941-138036963 TGGGAGAAGGTCAAGGATGCTGG + Intronic
998725280 5:145005578-145005600 AGGGAGCAGAAAAAAAATGCTGG - Intergenic
999221066 5:149978092-149978114 CAAGAGAAAATAAATGATGCTGG - Exonic
999498680 5:152125246-152125268 AGGGAGAAGCTAAGTGGTGTGGG - Intergenic
999519335 5:152334494-152334516 AGGAAGAAGTTAAACCATGCGGG + Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
1000227068 5:159274013-159274035 AATGAGCAGATACATGATGCAGG + Intronic
1000521268 5:162297536-162297558 AGTCAGAAAATAAAAGATGCTGG - Intergenic
1001189431 5:169614344-169614366 AGAGAGAAGAAAAATGATATAGG + Intergenic
1001289369 5:170445706-170445728 AGGGAGAGGTTAATTGTTGCCGG - Intronic
1001994325 5:176143351-176143373 AGGGCTAAGAAAAATGAAGCTGG - Intergenic
1002305102 5:178278547-178278569 AGTGAGAAAATAGATGAGGCTGG - Intronic
1002815024 6:671560-671582 AGGGAGAAGCAAAATGATATAGG - Intronic
1003948684 6:11097918-11097940 AGGGAGCAGATAAGTTATGTGGG - Intronic
1005021097 6:21419482-21419504 AGGGTGAAGATCAGGGATGCTGG + Intergenic
1005128988 6:22481406-22481428 AGGGAGAAGGAAAATGATAGAGG + Intergenic
1005213754 6:23500554-23500576 AGGAAAAAGACAAATGATGTGGG - Intergenic
1005221274 6:23591674-23591696 AGGGAGAAAAAAAATGACGCTGG + Intergenic
1005921607 6:30406774-30406796 AGGGCTAAGAAAAATGAAGCTGG + Intergenic
1006090237 6:31624413-31624435 AGAAAGATGATAAATGATGTGGG - Intronic
1006256519 6:32837040-32837062 AGGGAAAAGAGTAATGATTCTGG + Intronic
1007068741 6:39019172-39019194 AGGGAGGAGGTAAAAGAGGCAGG + Intronic
1007103145 6:39264741-39264763 ATGGAGCAGATATATGATGGTGG + Intergenic
1007697985 6:43745674-43745696 AGTGAGAATATAAATGAAGCAGG - Intergenic
1008379547 6:50825964-50825986 AGGGTGAAGTTGACTGATGCAGG + Intronic
1008545641 6:52580838-52580860 TGGGATAACATAAATGATGGTGG + Intergenic
1009850161 6:69186447-69186469 TGGTAGAGAATAAATGATGCTGG - Intronic
1010686279 6:78858166-78858188 AGGGCTAAGAAAAATGAAGCTGG + Intergenic
1010950408 6:82030476-82030498 AGGGAGACGATAAATATTGCTGG - Intergenic
1011975998 6:93299471-93299493 AGACAGAAAATAAAAGATGCTGG + Intronic
1012222809 6:96670631-96670653 AGAGAGAAGAAAAATTATGTAGG + Intergenic
1012257352 6:97049256-97049278 AGGTACAAGAGAAGTGATGCTGG - Intronic
1013467485 6:110430340-110430362 AGGGAGAATGTACATGAGGCTGG + Intronic
1013949361 6:115760899-115760921 AGGGAGAAGAGACTTGAAGCAGG - Intergenic
1014728086 6:124997706-124997728 AGCGAGCAGATTAAAGATGCAGG - Intronic
1014813602 6:125911487-125911509 AGGGCTAAGAAAAATGAAGCTGG - Intronic
1015083977 6:129265103-129265125 ATTGAGAAGATAACAGATGCTGG + Intronic
1015198581 6:130552489-130552511 AGGGAGAAGAGAACAGAAGCAGG - Intergenic
1015434398 6:133169123-133169145 TGGGATAAAATAAATGATGTAGG + Intergenic
1015504022 6:133963096-133963118 AGGCAGAAGACAGATTATGCTGG + Intronic
1016472989 6:144394436-144394458 TGGTAGAAGATAAATCATGGAGG - Intronic
1017051008 6:150393317-150393339 AGGGAGAAAAGAAATGATAATGG + Intronic
1017336795 6:153270539-153270561 AGTGAGAAGAAAAATGATATAGG - Intergenic
1017560739 6:155625576-155625598 AGAGAGAGGATTTATGATGCAGG - Intergenic
1017646696 6:156545767-156545789 AGGGAGCATCTAAATGTTGCAGG + Intergenic
1018244225 6:161806384-161806406 TGGGAAAGGAGAAATGATGCGGG - Intronic
1018365610 6:163116990-163117012 AGGGAGTGGAGAAATGATGCTGG - Intronic
1018487469 6:164256518-164256540 AGGGAAAATGTAAATGTTGCAGG - Intergenic
1019254268 7:39381-39403 ATGGAGGAGATAGACGATGCAGG + Intergenic
1020492886 7:8811240-8811262 AGGAAGAGGGGAAATGATGCTGG + Intergenic
1022454371 7:30545651-30545673 AGGGCTAAGAAAAATGAAGCTGG + Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1024673024 7:51613772-51613794 AGGCAGAAGAAATAAGATGCAGG - Intergenic
1024701888 7:51912331-51912353 AATGAGAGGAGAAATGATGCTGG - Intergenic
1026617052 7:71914699-71914721 AGTCAGAAGATAACAGATGCTGG - Intronic
1026654575 7:72246014-72246036 AGGGAGAAAAGAAAGGAGGCTGG - Intronic
1027167258 7:75843832-75843854 AGGGCTAAGAAAAATGAGGCTGG - Intronic
1027928678 7:84501846-84501868 AGGTGAAAGATAAATAATGCTGG - Intergenic
1030115282 7:106058285-106058307 CGGGATAAGAGAAGTGATGCTGG - Intergenic
1030150292 7:106397803-106397825 AGGGAGTAGATGAATGATAAAGG + Intergenic
1030167566 7:106570404-106570426 ATGGAGAAGATAAAAACTGCTGG - Intergenic
1030550784 7:110956761-110956783 AGACAGAGGAAAAATGATGCTGG + Intronic
1031188642 7:118517419-118517441 AAGCAGCAGATAAATGAAGCAGG + Intergenic
1031279382 7:119777622-119777644 AGGGAGAAGAAAAATGACATAGG + Intergenic
1031855352 7:126915713-126915735 GGGGAGAAGAGAAATGGTGGCGG + Intronic
1033086336 7:138345368-138345390 AGGGCTAAGAAAAATGAAGCTGG + Intergenic
1033255530 7:139798173-139798195 GGGGAGAAGATGGATGAAGCAGG + Intronic
1033255803 7:139800295-139800317 AGGGAGAGGATAAGCCATGCAGG - Intronic
1034432992 7:151050259-151050281 AGGGAGCACACAAATGAGGCTGG + Intronic
1034456833 7:151175221-151175243 AAGGAGCAGATAAAAGAGGCAGG + Intergenic
1036218849 8:6903648-6903670 AGGGGGAAGAGAAAGGATGGGGG + Intergenic
1036623895 8:10449025-10449047 TGGTAGAAGAAAAATGATCCAGG + Intergenic
1037098893 8:15018638-15018660 GGGGAGAAGGTAAGTGATGAAGG + Intronic
1037168559 8:15861096-15861118 AGGCTAAAGATAAATGATGATGG - Intergenic
1038316984 8:26493197-26493219 ATGAAGAAGATACATAATGCTGG + Intronic
1038347574 8:26746515-26746537 GGAGAGAAGAAATATGATGCTGG + Intergenic
1039047387 8:33462396-33462418 AGGAAGAAAATAAAAGATTCAGG + Intronic
1039450740 8:37673061-37673083 AGAGAGAAGATAATTTATCCAGG - Intergenic
1040393733 8:46974711-46974733 AGGGAGAAGAAAAATAATTATGG + Intergenic
1040712141 8:50201846-50201868 AAGAAGAAGCTAAATGATTCAGG - Intronic
1040722282 8:50339309-50339331 AGAGAGAAGAAAAATGATATGGG + Intronic
1041050320 8:53927804-53927826 AAGGAGAAGATGTATGAAGCTGG + Intronic
1041403135 8:57465541-57465563 AGGGCTAAGAAAAATGAAGCTGG + Intergenic
1041825133 8:62086996-62087018 AGATAGAAGAAAAATGATGAAGG + Intergenic
1043176266 8:77026663-77026685 AGAGAGAGGACAAATGATGGAGG + Intergenic
1045131091 8:99153815-99153837 AGAGAGAAGAAAAATGATAAAGG - Intronic
1045180105 8:99771660-99771682 AGAGAGAAAAGAAATGATTCAGG - Intronic
1045454467 8:102363474-102363496 AGGGAGAAGATAAACAAGGGTGG + Intronic
1045903288 8:107311382-107311404 AAGGAGAGGATAAAAAATGCAGG + Intronic
1046070539 8:109247795-109247817 AGGAATAACATACATGATGCTGG - Intronic
1046250037 8:111618378-111618400 TGTGAGAAAAAAAATGATGCTGG - Intergenic
1047164543 8:122422397-122422419 AGGGAGAAGCTAAGTTGTGCAGG - Intergenic
1047393467 8:124473606-124473628 AAGCAGTAGATAAATGATGGCGG + Intergenic
1047678016 8:127224074-127224096 AGGGAGAGTAGAAATGAGGCTGG - Intergenic
1047791842 8:128211235-128211257 AGGGAGAAACTATATGAAGCTGG + Intergenic
1048200427 8:132369510-132369532 AGGGAGTATAAAAATGAGGCTGG + Intronic
1048556330 8:135480978-135481000 AGGGAGAAGAATAATGCTGGTGG - Intronic
1048966906 8:139621755-139621777 AGGGTAAATATAAAAGATGCAGG + Intronic
1050406855 9:5318226-5318248 AGGGAGAAAATAAAAGTGGCAGG - Intergenic
1051360108 9:16274744-16274766 AGGAAGAGGATGAATGATGTGGG + Intronic
1051491466 9:17671122-17671144 AGAAACAAGATATATGATGCTGG + Intronic
1051691207 9:19714555-19714577 AGGGAAAAGGTAAGTGATGTGGG - Intronic
1052383521 9:27797914-27797936 AGGGGGAATATAAAAGATTCAGG + Intergenic
1052477440 9:28978268-28978290 AGGGAGAAGAAAATTAATGTGGG - Intergenic
1053289278 9:36869320-36869342 AGGGAGAAGATGAGTGTTTCAGG - Intronic
1053921152 9:42993183-42993205 AGGGAGAAGAAAAATGGTATAGG + Intergenic
1055664890 9:78543497-78543519 AGGGAGAAGAGAAATGAAGCGGG - Intergenic
1055688796 9:78807949-78807971 AGGGAGAAAATAAATGGGGAGGG - Intergenic
1055881209 9:81006089-81006111 AGGGAGAAGGGAAATGACACAGG + Intergenic
1056422458 9:86442282-86442304 AGGTAGAAGAAAAATGAATCCGG - Intergenic
1057136213 9:92689897-92689919 AGAGAGAAGGAAAATGATACAGG - Intergenic
1058119595 9:101124159-101124181 AGGGCTAAGAAAAATGAAGCTGG - Intronic
1059778579 9:117502135-117502157 AGTCAGAAAATAACTGATGCTGG - Intergenic
1059909294 9:119024660-119024682 AGGGAGAGGAGAAAAGATGAGGG - Intergenic
1062746134 9:138213160-138213182 ATGGAGGAGATAGACGATGCAGG - Intergenic
1203626179 Un_KI270750v1:25797-25819 ATGGAAAAGTTATATGATGCAGG + Intergenic
1185999255 X:4989537-4989559 AGGGAGAAGAAAAAAGAAGTAGG - Intergenic
1186696736 X:12042465-12042487 AGGCAGGATATAAATAATGCAGG - Intergenic
1186722338 X:12318792-12318814 AGAGAAATGATAAATGTTGCAGG + Intronic
1189058542 X:37727180-37727202 TGGAAGAAGAGAAATGAGGCAGG + Intronic
1189103612 X:38215213-38215235 AGGGAGAAGATAAATGGGTTTGG - Intronic
1189643549 X:43101210-43101232 AGGGAGAATTTAAGTCATGCAGG + Intergenic
1192217414 X:69171782-69171804 AGAGAGAAGAAAAATAATACTGG - Intergenic
1192347935 X:70327367-70327389 AGGGAGAAGCTAAAGGATCAGGG + Intronic
1192601620 X:72470402-72470424 AGGTAGAAGAAATATGATGGAGG - Intronic
1192908895 X:75582448-75582470 AGGGAGAATACTAAGGATGCTGG - Intergenic
1193232191 X:79060798-79060820 AAGGAGAAGATAAATGTTTGAGG - Intergenic
1193248075 X:79253781-79253803 AGGGAGAAGATCAAGGGTGAAGG + Intergenic
1193662283 X:84271869-84271891 AGGGAGTAGATTAATTATGGTGG + Intergenic
1194426677 X:93747449-93747471 AGGGAGAAAAAAGATGATGAAGG + Intergenic
1194441039 X:93934568-93934590 AGGCAGAAAATAATAGATGCTGG - Intergenic
1194773340 X:97931806-97931828 ATGGTGAATATAAATGATGATGG - Intergenic
1195026264 X:100880679-100880701 AGGGAGAAGACACAACATGCAGG - Intergenic
1196371631 X:114985647-114985669 AAAGAGAAGAATAATGATGCTGG - Intergenic
1196562182 X:117163059-117163081 GGGGAGAAGAGAAGTGATACTGG + Intergenic
1196663531 X:118293539-118293561 AGGGCTAAGAAAAATGAAGCTGG - Intergenic
1196776232 X:119340318-119340340 AGGAAAAAGATAAAGAATGCAGG - Intergenic
1198333413 X:135643408-135643430 AGGGCAAAGATGAATGATACTGG - Intergenic
1198344560 X:135746904-135746926 AGGGCTAAGAAAAATGAAGCTGG + Intergenic
1198364792 X:135929503-135929525 AGGGCAAAGATGAATGATACTGG + Intergenic
1199522111 X:148747882-148747904 AAAAAGATGATAAATGATGCTGG + Intronic
1200371904 X:155736308-155736330 AGGGAGAAGGAAAATGATATAGG - Intergenic