ID: 948132331

View in Genome Browser
Species Human (GRCh38)
Location 2:235609803-235609825
Sequence CTGTGGGCATATTTGGCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948132327_948132331 -3 Left 948132327 2:235609783-235609805 CCAGAAAGTGTAGTGGGAGGCTG 0: 1
1: 0
2: 2
3: 11
4: 147
Right 948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG 0: 1
1: 0
2: 2
3: 9
4: 116
948132323_948132331 9 Left 948132323 2:235609771-235609793 CCAACTCACAGGCCAGAAAGTGT 0: 1
1: 0
2: 1
3: 14
4: 178
Right 948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG 0: 1
1: 0
2: 2
3: 9
4: 116
948132320_948132331 21 Left 948132320 2:235609759-235609781 CCACTTTCACTCCCAACTCACAG 0: 1
1: 0
2: 3
3: 38
4: 351
Right 948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG 0: 1
1: 0
2: 2
3: 9
4: 116
948132322_948132331 10 Left 948132322 2:235609770-235609792 CCCAACTCACAGGCCAGAAAGTG 0: 1
1: 1
2: 3
3: 28
4: 235
Right 948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG 0: 1
1: 0
2: 2
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948132331 Original CRISPR CTGTGGGCATATTTGGCGCT TGG Intronic
900206277 1:1433220-1433242 CTGTGGTCATGTTTGACCCTGGG - Intergenic
900428552 1:2591634-2591656 CTGTGGGCATGTTGGGGGCGTGG + Intronic
902204859 1:14860878-14860900 CTGTCTGCATTTTTGGCACTGGG + Intronic
903645610 1:24894133-24894155 CTGTGGGCATATTTGGGTAGGGG + Intergenic
904479605 1:30785641-30785663 CTGTGGTCAGCTTTGGCCCTGGG + Intergenic
910301367 1:85710347-85710369 CTGTGAGTATATTTGGAGATAGG + Intergenic
917962615 1:180156383-180156405 CTGTGGGCATCTTTGGAAATAGG + Intronic
918178596 1:182066943-182066965 CAGTGGGAATGTTTGGGGCTAGG - Intergenic
920991120 1:210941018-210941040 CTATAGGCATGTTTGGCACTGGG + Intronic
922873410 1:228921089-228921111 CTGTGGGATTGTTTGGCCCTGGG + Intergenic
1063754473 10:8991602-8991624 CTGTGGTCATATTTGGAAATAGG + Intergenic
1067968281 10:50939938-50939960 ATGTGGTGATATTTGGAGCTGGG + Intergenic
1069259817 10:66381201-66381223 CTGTGGGCATATTAGAACCTTGG + Intronic
1070128722 10:73641883-73641905 CTGTGGGTGTATTTGGAGCAGGG + Intergenic
1072263202 10:93702338-93702360 CTGTGGGTATATTTGGCATCAGG - Intronic
1076232745 10:128835307-128835329 CAGTAGGCAAATTTGGAGCTTGG - Intergenic
1079394391 11:20049388-20049410 CTGTGGTTATTTTTGGTGCTTGG + Intronic
1080297937 11:30751697-30751719 CTGTGGTCACATATGGAGCTAGG - Intergenic
1080874650 11:36264761-36264783 CTGTGGGCATAGCAGGCTCTAGG + Intergenic
1081267629 11:41045811-41045833 CTGTGGGTATCTTTTGCCCTGGG + Intronic
1082760205 11:57119995-57120017 ATGTGAGTATATTTGGAGCTAGG + Intergenic
1083900014 11:65638969-65638991 CTCTGGGCACATTCAGCGCTCGG - Intronic
1091593539 12:1859510-1859532 CTGTAGAAATATTTGGCTCTAGG - Intronic
1092310918 12:7351571-7351593 CTGTGGCTATATTTGGAGATAGG - Intronic
1103019426 12:117522110-117522132 CTGTAGGCAGTTATGGCGCTTGG + Intronic
1104678946 12:130735668-130735690 CTGTTGGTATATTTCCCGCTTGG + Intergenic
1109242638 13:59908882-59908904 CTTTGGTCCTATTTGGAGCTGGG + Intronic
1111881885 13:93967409-93967431 ATGTAAGCATATTTGGTGCTGGG - Intronic
1112258373 13:97855670-97855692 ATGTGCGTATATTTGGCACTAGG + Intergenic
1113017939 13:105849729-105849751 CTTTGGGCCTATTTGGCACTAGG + Intergenic
1115374994 14:32665099-32665121 CTGTGACCATATTTGGGGGTGGG + Intronic
1118658375 14:67979099-67979121 GTGTGGGCAGATTTGGCAATGGG + Intronic
1121945983 14:98122485-98122507 CTGTGACCATATTTGGAGATAGG + Intergenic
1122175648 14:99916696-99916718 CTGTGGGCATATTTGAGGAGTGG - Intronic
1135135303 16:19882809-19882831 CTGTAGGCAGATTTGGGGGTGGG - Intronic
1140843727 16:78866620-78866642 CTGTGAGCCTATTTGGCTCCTGG + Intronic
1142314724 16:89336421-89336443 CTGTGGGCTTCTGTGGTGCTAGG + Intronic
1149244426 17:54688631-54688653 CTGTGGGCATATTTAACATTGGG + Intergenic
1152724805 17:81939924-81939946 CTGTGGGCATCTGTGGCACTGGG - Exonic
1155268113 18:24113449-24113471 CTGTGGGGATAATGGGCACTTGG + Intronic
1160974264 19:1784981-1785003 CTGGGGGCATCCTTGGAGCTGGG - Intronic
1163615171 19:18322922-18322944 CTGTGGGCTTGGTTGGCGCGGGG - Intronic
1165147039 19:33737466-33737488 CTGTGGCCATAATTAGAGCTGGG + Intronic
1168312151 19:55465680-55465702 GTGGGGGCATATTGGGAGCTGGG + Intergenic
1168422359 19:56212904-56212926 CTCTGGGCACATGTGGCACTGGG + Intergenic
925521584 2:4752469-4752491 CTGTCGGCAGATTTGGTTCTTGG + Intergenic
929094267 2:38248706-38248728 ATGTGGACATATTTGGCGGGGGG + Intergenic
931876827 2:66522620-66522642 CTGTGAGCATGTTTTGCACTTGG + Intronic
932264666 2:70357367-70357389 CTGAGGGCACATTTTGCACTAGG + Intergenic
932607139 2:73172867-73172889 CTGTGTGCATGTATGGGGCTGGG - Intergenic
936072895 2:109383173-109383195 CTGTGGAGAGATTTGGCACTGGG + Intronic
937079630 2:119131333-119131355 CTGTGGTCATCTCTGGGGCTAGG + Intergenic
937927641 2:127179462-127179484 ATGTGGGCATCTTTGGGGCAGGG + Intergenic
939354812 2:141087496-141087518 CTGTGTGAATATTTGGAGGTTGG - Intronic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
943296189 2:186142805-186142827 ATGTGGCTATATTTGGAGCTAGG + Intergenic
948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG + Intronic
948887274 2:240890563-240890585 CTGTGGGCATAGGCGGGGCTGGG - Intronic
948904783 2:240973640-240973662 CTGTGGGCATATGTGGACCCCGG - Intronic
1172915574 20:38440918-38440940 ATGGGGGCATCTTTGGAGCTTGG + Intergenic
1174050233 20:47762661-47762683 CTGAGGGCCTTTTTGGCCCTGGG + Intronic
1179562151 21:42222398-42222420 CTGTTGGCTTATTTGGGGATGGG + Intronic
1180954975 22:19737517-19737539 CTGTGGCCATATTGGGGGCGGGG - Intergenic
1183045469 22:35216111-35216133 CTGTGGGCAGATTTGGTGTTTGG + Intergenic
1183493931 22:38131583-38131605 CTGTGGACATTTTTAGCACTGGG - Intronic
953198596 3:40756363-40756385 ATGTGACCATATTTGGAGCTAGG + Intergenic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
956211157 3:66803144-66803166 CTGAGGGCTTATTAGGCTCTAGG + Intergenic
957176074 3:76811594-76811616 CTGTAGGCATTTTTAGCTCTGGG + Intronic
961347565 3:126274055-126274077 CTGTGGGCATATTTTGGGAGTGG + Intergenic
964123392 3:153209916-153209938 CTGTGGACATATTTGGCGTGTGG - Intergenic
967963271 3:194941878-194941900 CTGTGGGAAGATGTGGTGCTGGG + Intergenic
968966831 4:3773068-3773090 CTCTGGGCATGTTTTGTGCTCGG - Intergenic
969454604 4:7294241-7294263 CTGTGGGCAGATTTGGGGTGGGG + Intronic
969910710 4:10442960-10442982 CTGTAGGAATATTGGGAGCTAGG - Exonic
970992130 4:22224511-22224533 CAGTGGGCAGATTTGGCCCATGG + Intergenic
973951469 4:56019134-56019156 CTATGGGCTTATTTGGCTATAGG - Intronic
973969780 4:56201454-56201476 CTGAGGGCAAACTTGGCACTGGG + Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
977626321 4:99192974-99192996 CTGTGGGCCTATTTGGATTTTGG - Intergenic
977930451 4:102744141-102744163 CTGTGGGCCTATTTGGATTTTGG - Intronic
981271105 4:142847338-142847360 CTGTGGGCTTGTTAGGGGCTAGG - Intronic
982076643 4:151743921-151743943 CTGTCAGTATATTTGGCTCTAGG - Intronic
983566890 4:169162852-169162874 CTTTGGGCTTTTTTAGCGCTTGG + Intronic
983576223 4:169264391-169264413 ATGTGGCCATATTTGGGGATAGG - Intronic
991183285 5:63779182-63779204 CTGTAAGCATATTTGGCTTTCGG - Intergenic
995080035 5:108040131-108040153 CTGTGGGCATTTTTGCTGTTTGG + Intronic
999048578 5:148496514-148496536 CTTTAGGCATATTTGGCCATAGG - Intronic
1000118360 5:158174346-158174368 ATGCGGGCATATTTGGAGATAGG + Intergenic
1001281377 5:170388845-170388867 CTGGGGGCTGATTTGGGGCTAGG - Intronic
1003355437 6:5365097-5365119 CTGTGGGCAGATTTGGCCCTTGG + Intronic
1004358531 6:14950779-14950801 ATGTGGCTATATTTGGAGCTAGG + Intergenic
1006378311 6:33683927-33683949 CTGTGGGGCTGTTTGGCGTTTGG + Intronic
1016944628 6:149518171-149518193 CTGAGGGGATTTTTGGCACTTGG - Intronic
1018576667 6:165266769-165266791 CTGTGGGTGTAATTGGAGCTGGG + Intergenic
1019226045 6:170510306-170510328 CTATGGGCCTATTTGGTTCTGGG + Intergenic
1022423167 7:30243305-30243327 CTGTGCGCATACTTTGTGCTGGG - Intergenic
1024570648 7:50720491-50720513 CTCTGGGCCTTTTTGGCGCCTGG - Intronic
1027449603 7:78315855-78315877 CTGTGGTCATCTTTGTCTCTCGG + Intronic
1029587729 7:101486238-101486260 CTCTGGGCATAGTTGACCCTTGG + Intronic
1035945832 8:3961412-3961434 CTGTGGGAATATTTGGCACTTGG - Intronic
1035990849 8:4488727-4488749 CTGAGGGCCCATTTGGTGCTGGG - Intronic
1037238296 8:16747832-16747854 CTGTGGGCACATATGATGCTTGG - Intergenic
1037631786 8:20664263-20664285 CTGTGGGCATATAAGGAGATAGG - Intergenic
1039861860 8:41466037-41466059 ATGTGAGGATATTTGGAGCTGGG + Intergenic
1042022803 8:64387843-64387865 CTGTGGGCATATTTTGGGATAGG - Intergenic
1043163966 8:76880126-76880148 GTGTGGGCATATTTGGTGTCTGG - Intergenic
1048266726 8:132993827-132993849 CTGTTGACATATTTTGCTCTTGG - Intronic
1048422722 8:134293338-134293360 TTGTGGCCATATTTGGAGATGGG + Intergenic
1048829128 8:138459050-138459072 CTGTGGGCTGATTTGGGGGTGGG - Intronic
1055332215 9:75196438-75196460 ATGTGGCTATATTTGGAGCTAGG - Intergenic
1056423276 9:86451211-86451233 GTGTGGCCATCTTTGGAGCTAGG + Intergenic
1056903551 9:90624586-90624608 CTGTGGGCTTATTGGCCTCTTGG - Intronic
1058523048 9:105831113-105831135 CTGTTGGCAAATTGGGCACTTGG - Intergenic
1060779216 9:126399405-126399427 CTGTGGCCCTCTTTGGGGCTGGG + Intronic
1062161455 9:135082620-135082642 GTGTGTGCATATTTGGGGCTGGG - Intronic
1062555850 9:137113146-137113168 GTTTGGGCATAGCTGGCGCTGGG + Intronic
1185768642 X:2747814-2747836 CCGTGGGCAGATTTGGCTCCCGG - Intergenic
1187836292 X:23435409-23435431 CTGTGGGCCTGTCTGGGGCTAGG + Intergenic
1190128173 X:47724026-47724048 GTGGGGGCAGATTTGGCGCCTGG + Intergenic
1190334692 X:49255288-49255310 GTCTGGGCATGTTTGGAGCTGGG + Intronic
1194123193 X:89985704-89985726 CTGCTGGCATATTGGGCGCTTGG - Intergenic
1195084300 X:101399878-101399900 CTGTCTGCATATGTGGCGTTTGG + Intronic
1195592975 X:106653683-106653705 CTGTCGGCATGTTGGGGGCTAGG - Intronic
1196329122 X:114448487-114448509 CTGAAGGCAGATTTGGCACTGGG + Intergenic
1198880777 X:141278716-141278738 CTGTGGGAAGATTAGGAGCTTGG - Intergenic
1200476054 Y:3643150-3643172 CTGCTGGCATATTGGGCGCTTGG - Intergenic
1200756107 Y:6991492-6991514 CTGTGAGCTTATTTGGAGGTGGG + Intronic