ID: 948132971

View in Genome Browser
Species Human (GRCh38)
Location 2:235614439-235614461
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 1, 2: 2, 3: 53, 4: 578}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948132965_948132971 -8 Left 948132965 2:235614424-235614446 CCTGTGATGGGCTGGATGTATTT 0: 1
1: 0
2: 0
3: 19
4: 141
Right 948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG 0: 1
1: 1
2: 2
3: 53
4: 578
948132961_948132971 14 Left 948132961 2:235614402-235614424 CCAGAGGAGCAGCAGCAAACGGC 0: 1
1: 0
2: 2
3: 18
4: 141
Right 948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG 0: 1
1: 1
2: 2
3: 53
4: 578
948132959_948132971 15 Left 948132959 2:235614401-235614423 CCCAGAGGAGCAGCAGCAAACGG 0: 1
1: 0
2: 3
3: 17
4: 240
Right 948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG 0: 1
1: 1
2: 2
3: 53
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901255134 1:7818018-7818040 ATGCATTTGGGGAGAGAATGCGG - Intronic
901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG + Intergenic
902116911 1:14128707-14128729 ATGAATTTGGGGGGTGAGGAGGG + Intergenic
902659122 1:17889236-17889258 ATGTGTTGTGGGAGGGACGAGGG - Intergenic
903014510 1:20353326-20353348 ATGGATTGGGGGTGGGGAGAGGG + Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904043547 1:27597679-27597701 GGGGGTTTGGGGAGGGAAGAGGG + Intronic
904044049 1:27599791-27599813 AGGCATTTGGGGAGGGCAGAAGG + Intronic
904175417 1:28624944-28624966 ATGTTTGTGGGTAGGGGAGAAGG - Intronic
904733067 1:32609428-32609450 ATCTATATGGGGAGGACAGAGGG - Intronic
904889917 1:33772073-33772095 TTGGATTTAGGGAGGGAAAAGGG - Intronic
905308657 1:37035021-37035043 ATGGGGTTGGGGAGGGAAGCCGG - Intergenic
906509157 1:46401064-46401086 GGGAAATTGGGGAGGGAAGAGGG + Intronic
906823271 1:48951441-48951463 ATGAATGTGGGGAGGGATGGGGG - Intronic
906892122 1:49728648-49728670 AGGCATGTGGGGAGAGAAGAGGG + Intronic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
909044939 1:70698540-70698562 ATGAATCTGTGGAGGGAAGATGG + Intergenic
910099529 1:83561182-83561204 ATGAATTTGGGCAGGGAATGGGG + Intergenic
910241859 1:85095334-85095356 ATGAATTGGGGAAAGGAAGAAGG - Intronic
910503202 1:87918452-87918474 TTTTCTCTGGGGAGGGAAGAGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912663872 1:111561501-111561523 ATGTATTGGGGGAAGGAGGGAGG + Intronic
912760215 1:112359773-112359795 CTGTATTTGGGCAGAGAGGAGGG - Intergenic
913217462 1:116632343-116632365 ATGGATCTGTGGGGGGAAGAAGG + Intronic
913246313 1:116873324-116873346 ATATATTTGGGGAGGCCAAAGGG - Intergenic
913547902 1:119887600-119887622 ATGTGTTTGTGAAGAGAAGAAGG - Intergenic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915328456 1:155093475-155093497 ATGTCTGTGGTGTGGGAAGAGGG - Intergenic
915473685 1:156140043-156140065 ATTGATTTGGGGAGGAGAGAAGG - Exonic
915634956 1:157179684-157179706 ATGAATTTGGGCAGGAAAAATGG + Intergenic
915749915 1:158197082-158197104 AAGTAATGGGGGAGGGGAGAAGG - Intergenic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
915804142 1:158827117-158827139 TTTTGTTTGGGGAGAGAAGAGGG + Intergenic
915891519 1:159778697-159778719 ATGTATGTGGGCAGACAAGAAGG + Intergenic
916240264 1:162632356-162632378 AGGGGGTTGGGGAGGGAAGAAGG - Intronic
916330438 1:163610210-163610232 AGATATTTAGGGATGGAAGACGG - Intergenic
916439673 1:164811060-164811082 ATGAATCTGGTGAGGGAAGGGGG - Intronic
916489103 1:165285831-165285853 ATGGATTTAGGGAGGAAGGACGG + Intronic
916729080 1:167550400-167550422 ATCTATTTGGGTAGGCAAGGTGG + Intronic
917403032 1:174673043-174673065 ATGTATTAGGGGTTGGAAGTAGG - Intronic
917697894 1:177546850-177546872 ATGGATTTTGTGAGGGAAGATGG - Intergenic
920225431 1:204435072-204435094 TTTTATTTGGGGCAGGAAGAAGG - Intronic
920692066 1:208154720-208154742 ATGTCTATTGGAAGGGAAGATGG - Intronic
920823581 1:209403650-209403672 AATCATTTGGGGAGTGAAGATGG + Intergenic
921542429 1:216432529-216432551 ATGTTTGTGGGTATGGAAGAAGG - Intergenic
921625995 1:217378550-217378572 ATGTATTAAGGCAGGGAAGTGGG + Intergenic
921641583 1:217560950-217560972 ATTTAATGGGGTAGGGAAGAAGG + Intronic
922470181 1:225871910-225871932 ATGGTTTTGGGGAGGGAGCAGGG - Intronic
922625217 1:227033724-227033746 ATTTATTATGGGAGGCAAGAGGG - Intronic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923009093 1:230074008-230074030 ATGCATTTGGGCAGGGACAAGGG + Intronic
923188592 1:231597855-231597877 ATTTATTTGGGGAGTGAGGGTGG + Intronic
923791547 1:237115352-237115374 ATGGATCCGGAGAGGGAAGAGGG - Intronic
923864859 1:237928743-237928765 ATTTTTTTGGGGGGGGCAGATGG - Intergenic
1063198362 10:3763897-3763919 TTTGATTTGGGGAGGGATGATGG + Intergenic
1063424045 10:5937480-5937502 ATGTATCTGGTCAGGGAAGTGGG + Exonic
1063502026 10:6563842-6563864 GTGCAGTTGGGGAGGGAGGAAGG + Intronic
1063917244 10:10895913-10895935 AGGTATTTGGAAGGGGAAGAAGG + Intergenic
1064970417 10:21060492-21060514 ATGTCTTTGAGTAGGCAAGAGGG - Intronic
1065090731 10:22230460-22230482 AATTATTTGAGGAGAGAAGAAGG - Intergenic
1065541619 10:26775350-26775372 ATATTTTTGGCGAGGGATGAAGG - Intronic
1065927737 10:30450643-30450665 ATGTCTCTGGAGAAGGAAGACGG - Intronic
1066122048 10:32298701-32298723 ATGTACTTAGGGAGCGAAAATGG + Intronic
1066346628 10:34592916-34592938 ATGAATATGGTAAGGGAAGAAGG - Intronic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1067094766 10:43293135-43293157 ATGTTTTTAGGGACAGAAGAGGG - Intergenic
1068588041 10:58822406-58822428 ATCTTTTGGGGGAGGTAAGATGG + Intronic
1068829807 10:61480557-61480579 ATGTCTTTGGGGAGGGACCAAGG + Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069780783 10:70954103-70954125 ATGGATGTGCTGAGGGAAGAAGG - Intergenic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1069933794 10:71901196-71901218 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933801 10:71901215-71901237 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933808 10:71901234-71901256 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1070179040 10:73997519-73997541 ATGTCTTTGAGGAGGGCAGGGGG + Intergenic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1070651408 10:78239789-78239811 ATTGATTTGGGGAGGAGAGAAGG + Intergenic
1071755021 10:88527665-88527687 GTGTATATGTGGGGGGAAGAGGG - Intronic
1073184499 10:101607560-101607582 AGGGATTTGGGCAGGGAGGACGG + Intronic
1073628320 10:105121918-105121940 ATGCATTTGGAGTGGGAGGAGGG + Intronic
1073728783 10:106267302-106267324 ATGGCTTTGGAGAAGGAAGATGG + Intergenic
1074293653 10:112161307-112161329 ATGTATTTTGGGAGGATAAAGGG + Intronic
1074448629 10:113540876-113540898 ATGTATCAGGGGAGCGGAGATGG + Intergenic
1075070298 10:119315872-119315894 ATGAATTTGGAGGGGGAGGAAGG - Intronic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076526264 10:131114147-131114169 ATGTACTTGTGGAGTGATGAAGG - Intronic
1076885530 10:133260757-133260779 GTGCATTTGGGGATGGGAGAAGG + Intergenic
1077380077 11:2229183-2229205 ATGCTTTTGTGGAGGGATGATGG - Intergenic
1078109744 11:8382767-8382789 AGATATATGGGGAGGGAAGAAGG - Intergenic
1078160673 11:8837236-8837258 GTGTATTTGGGGAGGAGGGATGG + Intronic
1078182299 11:9022235-9022257 TTTGATTTGGGGAGAGAAGATGG - Intronic
1078754001 11:14191443-14191465 AAGTGTGTGGGGAAGGAAGAAGG - Intronic
1078809850 11:14747691-14747713 GTGTATTGGGGGAGGGAAGGAGG + Intronic
1078828734 11:14957232-14957254 AAGGATTTGGGGGAGGAAGAGGG - Intronic
1079264695 11:18920027-18920049 ATGTTTCTCGGGAGGGAAAAGGG + Intergenic
1079266871 11:18942173-18942195 ATGTTTCTGGGGAGGCAAAAGGG + Intergenic
1079268997 11:18964452-18964474 ATGTTTCTGGGGAGGCAAAAGGG + Intergenic
1081877532 11:46419804-46419826 ATGAAGGTGGGGAGGGAGGAAGG + Intronic
1082792032 11:57352771-57352793 GGGTATTTGGGGAGGCAGGACGG + Intronic
1082848613 11:57745707-57745729 AAGTCCTTGGGGAAGGAAGAGGG - Exonic
1082995362 11:59250035-59250057 ATGGTTTGGGGAAGGGAAGAGGG + Intergenic
1083582076 11:63831440-63831462 AAGACCTTGGGGAGGGAAGAGGG - Intergenic
1083711235 11:64550166-64550188 ATGTCCTTGGGGAGGGCAGTGGG + Intergenic
1083953577 11:65970531-65970553 ATTTATTTCAGGAGGGAAGGTGG + Intronic
1084194770 11:67518219-67518241 ATGGAGTTAGGGAGGGAGGAAGG + Intergenic
1084740164 11:71134251-71134273 AGGCATCTGGGGAGGGGAGAGGG + Intronic
1084920296 11:72464287-72464309 ATATATGAGGGGAGGGGAGATGG - Intergenic
1085704919 11:78778315-78778337 ATGTATGTGGGGCGGGGGGAGGG + Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087195713 11:95302533-95302555 ATGGATTTGGAGAGGGAAATTGG + Intergenic
1087901735 11:103649102-103649124 AGGTGCTTGGGGAGGGAGGAAGG + Intergenic
1087961064 11:104349886-104349908 AAGTATTTAGGGAGGACAGAAGG + Intergenic
1087985339 11:104671753-104671775 AAGCAGTTGGGAAGGGAAGACGG - Intergenic
1088059165 11:105624709-105624731 ATGTTTTTGGGGAGGAAAAAAGG - Intronic
1088879025 11:113959010-113959032 ATGTAAATGGGAAGGGAAGTGGG + Intergenic
1089531484 11:119132705-119132727 ATGTGGTTGCGGAGGGAGGAAGG - Exonic
1090270855 11:125385258-125385280 GAATATTTGGGGAGGGATGATGG - Intronic
1091727837 12:2857940-2857962 TTGAATTTGGGGTGGGAGGATGG - Exonic
1092897704 12:13029209-13029231 GGCTATTTGGGGTGGGAAGATGG + Intergenic
1093786619 12:23199217-23199239 ATGACTTTGAAGAGGGAAGAAGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094530677 12:31271724-31271746 TGGCATTTGGGGAAGGAAGAAGG + Intergenic
1094641817 12:32283113-32283135 AGGTTTTCAGGGAGGGAAGATGG + Intronic
1095757040 12:45780527-45780549 ATTTATCTGAGAAGGGAAGAAGG + Intronic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095864718 12:46958882-46958904 ATTAATTTGGGGGTGGAAGATGG + Intergenic
1096245202 12:49980971-49980993 AGGAAGATGGGGAGGGAAGAAGG + Intronic
1096862570 12:54540391-54540413 ATGTGTTTGGTGAGGCAAGAGGG + Intronic
1096882682 12:54685505-54685527 ATGGATTTGGGGACAGATGAAGG + Intergenic
1097108574 12:56640610-56640632 AGGTATTAGGGGTGGTAAGAAGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1098369860 12:69746481-69746503 AGGGTTGTGGGGAGGGAAGAGGG - Intronic
1098977028 12:76913388-76913410 ATGATCTTGGGGAGGGGAGAGGG + Intergenic
1099079347 12:78157075-78157097 TTATCTTTGGGGAAGGAAGAGGG + Intronic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099444983 12:82741790-82741812 ATGTATATGGGGGAGGAAGTGGG + Intronic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1100228837 12:92586817-92586839 ATGTGATTGGGGAGGTTAGAGGG - Intergenic
1100284361 12:93150920-93150942 ATTTATTTGGGTAGGGAGGATGG - Intergenic
1101018247 12:100524823-100524845 ATGTTTGTTGGGAGGGAAGATGG - Intronic
1101057391 12:100932955-100932977 ATGCATTTGGGAAGGCAAGGGGG - Intronic
1101551902 12:105771101-105771123 ATGAATTTGGGGTGGGGAGAGGG + Intergenic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1102208063 12:111104312-111104334 ATGGATTTGGGGCGTTAAGAAGG + Intronic
1102830048 12:115989864-115989886 ATGGATTTGGGGAGACAAGGAGG - Intronic
1103130448 12:118463767-118463789 ATTTATTTGGGTTGGGAGGAGGG - Intergenic
1103435242 12:120920355-120920377 AAGTATTTGGGGCTGGAAGGAGG + Intergenic
1103662040 12:122527861-122527883 ATTTGTTTGGGAAGGGAAGGAGG - Intronic
1104413580 12:128579482-128579504 ATGTATTTGAGAAGAGAAGCTGG - Intronic
1105070033 12:133228646-133228668 AGGCATTTGGGGAGTGCAGAAGG - Intronic
1105792263 13:23813529-23813551 ATATATTTGGGGAAGAAAAATGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106897473 13:34320057-34320079 ATATATTTGGGGAGTGGAGGGGG - Intergenic
1106900607 13:34351396-34351418 ATGGATTAGCGGAGGGATGATGG + Intergenic
1107119891 13:36784933-36784955 AGGTAATTGGAAAGGGAAGATGG - Intergenic
1107578851 13:41759895-41759917 GGGTATTTGGGGAGGGAGGGAGG - Intronic
1108812260 13:54242029-54242051 ATGAATGTGGGCAGGGAAGGAGG + Intergenic
1108993022 13:56688099-56688121 GTAAATTTGGGGATGGAAGACGG + Intergenic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1110477621 13:75935714-75935736 ATGTATTTGAGGAAGGCAAATGG - Intergenic
1110503160 13:76252942-76252964 ATAAATTTGGGGGAGGAAGAAGG - Intergenic
1110545488 13:76750692-76750714 ATGTCCTTGAGGAGGCAAGAAGG - Intergenic
1110597131 13:77331504-77331526 AGGAGTTTGGGGAGGGGAGATGG - Intergenic
1110792141 13:79598371-79598393 ATGTGTTTGGGAAAGGAATAAGG - Intergenic
1110801085 13:79695885-79695907 ATGTATATGTTTAGGGAAGAAGG + Intergenic
1111582362 13:90239229-90239251 ATGTATTTGGCAAGGTGAGAAGG + Intergenic
1112863738 13:103868183-103868205 GTGTATTTGGGGAGTGCAGAAGG + Intergenic
1112938666 13:104832573-104832595 ATGTATTTGTCAAGGGAGGAGGG - Intergenic
1113124275 13:106958997-106959019 TTGTGTTTGGGAAGGGAAGAAGG + Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1114230885 14:20781414-20781436 AAATATTTCAGGAGGGAAGAGGG + Intronic
1114258171 14:21019816-21019838 CAGGATTTGGGGAAGGAAGAAGG - Intronic
1114529256 14:23385400-23385422 ATGTAGTGGGGTAAGGAAGAGGG + Intronic
1114887849 14:26877048-26877070 ATGTATTTATGGAGGGGAAAAGG - Intergenic
1115580577 14:34754632-34754654 GTGTATGTGGGGATGAAAGATGG - Intronic
1115772538 14:36680905-36680927 ATGTATTTGGAGACTCAAGATGG - Intronic
1116006289 14:39295401-39295423 ATGTATGTGGGGGAGAAAGAGGG - Intronic
1117650862 14:57903533-57903555 AGGCAGTTGGGAAGGGAAGATGG - Intronic
1118689871 14:68328051-68328073 AGGTATATAGGAAGGGAAGAAGG - Intronic
1118755876 14:68843491-68843513 GTGTGTTTGGGGAGGGAGTAGGG - Intergenic
1119062781 14:71493063-71493085 ATGTTTTGGGGGAGGGATAAAGG - Intronic
1119811223 14:77521356-77521378 ATGTATTTTGTTAGGGAAAATGG - Intronic
1119917995 14:78420070-78420092 CTGCTTTTGGGCAGGGAAGATGG + Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121647331 14:95527885-95527907 GTCTATCTGGAGAGGGAAGAAGG + Intergenic
1121751304 14:96359610-96359632 TTCTATTTGGGGTGGGAAGTTGG - Intronic
1121894507 14:97634010-97634032 AGGTATTTGTGGAGGGAGGGAGG + Intergenic
1123823739 15:24059952-24059974 ATGTAATTGAAGAGGGAAGGAGG + Intergenic
1124792267 15:32739614-32739636 ATGTGTTTGTGGATTGAAGAAGG - Exonic
1125088906 15:35767726-35767748 ATGTATTATGGAAGAGAAGAGGG - Intergenic
1125101514 15:35918464-35918486 AGGGATTGGGGGAAGGAAGAAGG + Intergenic
1125120493 15:36152916-36152938 AAGTATTTGAGAAGGGAACAGGG + Intergenic
1125626334 15:41112218-41112240 ATATTTTTGGGGAAGGCAGAAGG + Intronic
1126317915 15:47390463-47390485 ATGAAATTGGGTAGGAAAGAGGG + Intronic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1127187608 15:56495368-56495390 ACTTATATGGGGAGGGAAAATGG - Intergenic
1127246371 15:57179796-57179818 ATTAATTTGGGGGAGGAAGAAGG - Intronic
1127891229 15:63253125-63253147 TTGTATTTGAGGCTGGAAGAAGG + Intronic
1128283617 15:66417735-66417757 GTGTATTTGGGCAGGGAGAAGGG + Intronic
1129373015 15:75109742-75109764 ATGTATTTGGGAAGGGAAATTGG - Intronic
1130011224 15:80154230-80154252 AAGTGTTTGAGGAGGGCAGAGGG - Intronic
1131165291 15:90137950-90137972 ATGTATATGTGGAGGGCACAGGG - Intergenic
1131656082 15:94460641-94460663 ATGTGTCTGAGGAGAGAAGAGGG + Intronic
1131886777 15:96924252-96924274 TTACATTTGGGGAGGCAAGAAGG - Intergenic
1131888761 15:96949286-96949308 ATGTGTTTGGGGAAGGAATGTGG + Intergenic
1132070387 15:98771465-98771487 ACGTATTTGAGGAGGTAAGAGGG + Intronic
1133804702 16:9115962-9115984 ATGGAAGTGGGGAGGGGAGAGGG - Intronic
1133922031 16:10162051-10162073 ATGTCTTTGGGTGGGGAAGAGGG + Intronic
1135513679 16:23111338-23111360 ATGAATGTGGAGAGGGAGGAAGG + Intronic
1135556455 16:23440985-23441007 ATATATATGGAGAGGGAAAAAGG + Intronic
1135703941 16:24658145-24658167 GTGAATTTGGGGTGGGAAGCTGG + Intergenic
1135791113 16:25396981-25397003 CTGTATTTGAGGCAGGAAGATGG + Intergenic
1135869972 16:26140697-26140719 CTGTCTTTGGGTAGGGGAGAAGG - Intergenic
1137026317 16:35479155-35479177 TTGAAATTGGGGATGGAAGATGG - Intergenic
1137568812 16:49551374-49551396 GTGTATTTTGGGAGGGGGGATGG - Intronic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1137672146 16:50285320-50285342 ACATATTTGGGGAAGGAGGAAGG - Intronic
1138499221 16:57428628-57428650 ATGTGGTTGGGGATGGAAGGGGG + Exonic
1139160335 16:64498365-64498387 ATGTGTGTGGGGAGGGAATGGGG + Intergenic
1139457208 16:67090479-67090501 ATGTCTTTTGTGAAGGAAGATGG + Intronic
1139853973 16:69966203-69966225 ATCTATTAGGGGAGTGAGGAAGG + Intergenic
1139882952 16:70189116-70189138 ATCTATTAGGGGAGTGAGGAAGG + Intergenic
1140369557 16:74406403-74406425 ATCTATTAGGGGAGTGAGGAAGG - Intergenic
1141387058 16:83631477-83631499 ATGTTTTTGGGAGGGGAAGGTGG + Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143286295 17:5791687-5791709 ATTTACTTGGGGGGAGAAGAAGG + Intronic
1143375203 17:6463151-6463173 ACGGTTTTGGGGAGAGAAGACGG - Intronic
1144506534 17:15836135-15836157 AGGTATATGGGGAAGGAAGGTGG + Intergenic
1145118582 17:20234950-20234972 AGGTATGTGGGGAAGGAAGGCGG + Intronic
1145170708 17:20654067-20654089 AGGTATATGGGGAAGGAAGGTGG + Intergenic
1145180761 17:20749891-20749913 AATTATTCAGGGAGGGAAGACGG - Intergenic
1145933740 17:28703301-28703323 GTGTATCTGGGGTGGGAAGGAGG - Exonic
1147421864 17:40325955-40325977 TTGGATTTAGGGAGGGGAGAAGG - Intronic
1147476300 17:40714893-40714915 ATGTATTTGGGGAATGGTGATGG - Intergenic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1149002955 17:51775820-51775842 ATGTATGTGGGGAAGAATGAGGG + Intronic
1149268030 17:54948752-54948774 ATATATTTGTGGAGTGAATAAGG + Intronic
1149327628 17:55548426-55548448 ATATATTTGGGGTTGAAAGACGG + Intergenic
1149531119 17:57396054-57396076 GTGTTCTTGGGGAGTGAAGATGG + Intronic
1149840357 17:59958853-59958875 AATTATTCAGGGAGGGAAGATGG - Intronic
1150122434 17:62615432-62615454 ATGGGGTGGGGGAGGGAAGAAGG + Intronic
1150234285 17:63580284-63580306 TTAGATTTGGGGAGGAAAGAAGG + Intronic
1150902622 17:69298406-69298428 AGGTATTTTGAGAGGGAAAAGGG - Intronic
1151167806 17:72219901-72219923 ACGGCTTTGGGGAGGGGAGAGGG - Intergenic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152279191 17:79375432-79375454 GTGTATTTGGGGAGTGTTGAGGG + Intronic
1152788015 17:82261890-82261912 ATGGTTTGAGGGAGGGAAGAGGG - Intronic
1153225387 18:2895830-2895852 GTATGTTTGGGGAGGGAAGGGGG + Intronic
1155381050 18:25223239-25223261 ATTTACTTGGGGAGGGGAGAAGG + Intronic
1155513534 18:26600864-26600886 ATGTGGTTGGGGATGGAAGGGGG - Intronic
1155803137 18:30134110-30134132 GTGGAGTTGGGGAGGGAAGGAGG + Intergenic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1156501212 18:37559753-37559775 ATCTATATCAGGAGGGAAGAGGG - Intronic
1157136938 18:45065300-45065322 ATGTCTTGGGGAAGGTAAGAGGG - Exonic
1157231106 18:45916860-45916882 ATGGAGTTGGGGAGTGAGGAGGG - Intronic
1157286260 18:46379436-46379458 ATGGACTCGGGGAGGGAAGGTGG - Intronic
1157496255 18:48159676-48159698 AAGTATTTGGAGAAGAAAGAGGG - Intronic
1158608913 18:58920786-58920808 GTGTGTTTGGGGAGGGGAGGGGG + Intronic
1159117997 18:64136973-64136995 ATGGATTTGGGGAGGGGTGCAGG - Intergenic
1159334167 18:67042885-67042907 ATATATTTGGAGAGAGAGGAAGG - Intergenic
1163295329 19:16408049-16408071 ATGGATAAGGGAAGGGAAGATGG + Intronic
1164787113 19:30942418-30942440 ATTTAATTGGGCGGGGAAGAGGG + Intergenic
1165285656 19:34839402-34839424 AGGGAGCTGGGGAGGGAAGAGGG + Intergenic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166439294 19:42797294-42797316 ATGAGATTTGGGAGGGAAGATGG - Intronic
1166494923 19:43293617-43293639 ATGAGATTTGGGAGGGAAGATGG - Intergenic
1166761190 19:45225165-45225187 GTATATTGGGGGAGGGAAGGGGG + Intronic
1166975629 19:46603515-46603537 ATGAGGTGGGGGAGGGAAGAGGG - Intronic
1167295598 19:48647162-48647184 TTGTATTTGGGGAGAAGAGATGG + Intergenic
1167455210 19:49594269-49594291 ATGAATGAGGGGAGGGAAGGGGG - Intronic
1168149607 19:54438042-54438064 ATGTATCTGGGTAGGGAAAATGG + Intergenic
1168498669 19:56875358-56875380 ATGGATTTGAGGGGGGCAGAAGG - Intergenic
925217523 2:2110391-2110413 ATGAATATGAGGAGGGAAGTGGG - Intronic
925526172 2:4804856-4804878 ATAGATTTGGGGAGAGGAGATGG + Intergenic
925727889 2:6892133-6892155 ATGTATTTTTGGATGGCAGATGG - Intronic
926113743 2:10198068-10198090 ATGGGCCTGGGGAGGGAAGAGGG - Intronic
926274830 2:11395809-11395831 ATGGAATTGGGGATGCAAGAGGG + Intergenic
926458693 2:13100676-13100698 ATGTATTGGGGGAGGGACCCAGG + Intergenic
926809897 2:16746659-16746681 AGGGAGGTGGGGAGGGAAGACGG - Intergenic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
929054874 2:37867916-37867938 ACGTATTTGGTGATGCAAGATGG + Intergenic
929083386 2:38144274-38144296 ATGTATATGGGGAATGAGGAAGG - Intergenic
929182773 2:39061392-39061414 ATTTATTTTGGGGGGGAACAGGG + Intronic
929326414 2:40616750-40616772 ATCTGTTTGGGGAGATAAGAGGG - Intergenic
929765421 2:44839990-44840012 ATGTATTTGGGGGGGGCAGTTGG + Intergenic
930386105 2:50697113-50697135 ATGTATTTGGAAGGGGCAGATGG + Intronic
930640550 2:53850349-53850371 CTGTATTTGGGGAGAGCTGAGGG + Intergenic
930862762 2:56092155-56092177 AGGGATTTGGGGAGGGACAAGGG - Intergenic
931113538 2:59139680-59139702 AGATATTTGGGAAGGCAAGAGGG + Intergenic
931168293 2:59775157-59775179 AAGTGTTTGGAAAGGGAAGAAGG - Intergenic
931334534 2:61326206-61326228 GTGTATTTGGGGCTGGAAGGGGG + Intronic
931531243 2:63216559-63216581 TGGTATTGGGGGAGGGGAGAGGG + Intronic
931666839 2:64615810-64615832 ATGGAATTGGGGTGGGAGGAAGG - Intergenic
932093753 2:68828953-68828975 AAGGAGTTTGGGAGGGAAGAGGG - Intergenic
934736860 2:96694010-96694032 AAGGAGTTGGGGAAGGAAGAGGG + Intergenic
935271130 2:101435317-101435339 GTGTGTTTCGGGAGGGATGAGGG + Intronic
936157372 2:110057215-110057237 ATGTATCTGCAGAGAGAAGAAGG - Intergenic
936187320 2:110314229-110314251 ATGTATCTGCAGAGAGAAGAAGG + Intergenic
937108387 2:119341006-119341028 ATGGAATTGGGGAGGGTACATGG - Intronic
939648537 2:144732788-144732810 AGGAATCTGGGGAGGGGAGATGG - Intergenic
940378301 2:152983457-152983479 ATGTATATGGGGAGGTTGGAGGG + Intergenic
940811540 2:158248228-158248250 TTGTCTCTGGGGAGGAAAGAAGG + Intronic
942872946 2:180757656-180757678 ATGTTTTGGGGGAGAAAAGAAGG - Intergenic
943205451 2:184887756-184887778 ATGTATTGTGGGAGGGACCAAGG - Intronic
943569244 2:189553585-189553607 ATGTATTTGTGTAAAGAAGAAGG - Intergenic
943809904 2:192171966-192171988 AAGTAGCTGAGGAGGGAAGAAGG - Intronic
944636316 2:201679085-201679107 GTGTATTGGGGCTGGGAAGATGG - Intronic
945674832 2:212843571-212843593 ATGTATTTGTGTTGGGAGGAAGG - Intergenic
945695186 2:213093273-213093295 ATGTATCTGGAGAGGTGAGAAGG - Intronic
946051613 2:216867508-216867530 ATGTATGTGAGGAGGGGAGAGGG - Intergenic
947489682 2:230582846-230582868 GTGTTTTTTGGGAGGGAAGGAGG - Intergenic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
948737266 2:240017108-240017130 ATGCATTTGGTGAGGAGAGACGG - Intronic
1168831151 20:845908-845930 TTGTATTGGGGGAGGGGAGGAGG - Exonic
1169004755 20:2197197-2197219 ATGAGGTTGGGGATGGAAGAGGG - Intergenic
1169318708 20:4613467-4613489 ATGTATCTGGGTGGGGCAGAGGG + Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169612734 20:7400766-7400788 ATGAATTTTGGGAGATAAGAGGG + Intergenic
1170026421 20:11893008-11893030 ATGTGTTTGGGCAGGGAAGTAGG - Intronic
1171232148 20:23496049-23496071 ATATATGTGGGGACAGAAGATGG + Intergenic
1171525223 20:25803833-25803855 ATGTGTTCGGGGAGGGAATCAGG + Intronic
1171551604 20:26052051-26052073 ATGTGTTCGGGGAGGGAATCAGG - Intergenic
1171792727 20:29543354-29543376 ATGTGTTCGGGGAGGGAACCAGG - Intergenic
1171855743 20:30341048-30341070 ATGTGTTCGGGGAGGGAACCAGG + Intergenic
1172957205 20:38769458-38769480 TTGGATCTGGGGAGGGAAGTCGG + Intronic
1173583194 20:44161852-44161874 ATATATTTGGGGAGGTCAGCAGG - Intronic
1173672224 20:44806575-44806597 GTGGGTTTGGGGAGGGGAGAAGG - Intronic
1173931657 20:46825864-46825886 ATCTACTTGGGGGGGGAAGATGG + Intergenic
1174065393 20:47860924-47860946 ATGTGTTTGGTGAGTGAGGAGGG - Intergenic
1174185437 20:48702979-48703001 ATGAACTTGGGGAGGAGAGAGGG + Intronic
1174299021 20:49568515-49568537 TTATATGCGGGGAGGGAAGAGGG + Intergenic
1174953469 20:55068180-55068202 GTATATTTGGGGAAGGAAAATGG + Intergenic
1175172511 20:57090444-57090466 CTGGATTTGGGGAGGGCGGAAGG + Intergenic
1175506810 20:59491962-59491984 GTGTAGTTGGGGAGGGAAACAGG - Intergenic
1176372823 21:6072826-6072848 GTGGATCGGGGGAGGGAAGAAGG - Intergenic
1179108387 21:38424023-38424045 ATGCATTTCGGGAGGACAGAAGG - Intronic
1179750654 21:43465417-43465439 GTGGATCGGGGGAGGGAAGAAGG + Intergenic
1180713528 22:17856274-17856296 AAGTATTTTGGCAGAGAAGAGGG + Intronic
1180818769 22:18810425-18810447 ATGGATCTGTGGGGGGAAGAAGG + Intergenic
1181204993 22:21244880-21244902 ATGGATCTGTGGGGGGAAGAAGG + Intergenic
1181546739 22:23606600-23606622 AAATATTTGGGGTGGGAAGCGGG + Intergenic
1181921332 22:26322776-26322798 AGGCATTTGGGGTGTGAAGAAGG - Intronic
1182246533 22:28962675-28962697 CTGTATTTGGGGAGGTATGCAGG + Intronic
1183154959 22:36067676-36067698 ATGTATTTGGGGAGGGGGGTGGG - Intergenic
1183229748 22:36574366-36574388 ATGGATATGGGTAGTGAAGAGGG + Intronic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
1183732339 22:39625691-39625713 AGGTGGTTGGGGAGGGAGGAAGG + Intronic
1184476441 22:44724613-44724635 AGGTATGTAGGGAGGGAAGGAGG + Intronic
1184760415 22:46540653-46540675 AAGTAAGTGGGGAGGGGAGAGGG + Intergenic
1184897366 22:47418420-47418442 ATGAATTTGGTGGGGGGAGAGGG + Intergenic
1203221932 22_KI270731v1_random:50535-50557 ATGGATCTGTGGGGGGAAGAAGG - Intergenic
1203268897 22_KI270734v1_random:36278-36300 ATGGATCTGTGGGGGGAAGAAGG + Intergenic
949115498 3:316144-316166 ATGTGGCTGGGAAGGGAAGATGG + Intronic
949569119 3:5274662-5274684 CAGTCTTTGGGGAGGCAAGAGGG + Intergenic
949858224 3:8481702-8481724 TTGAATTTGGGGAGGTAAGGGGG + Intergenic
950525190 3:13519110-13519132 GAGTCATTGGGGAGGGAAGAGGG - Intergenic
950567251 3:13777371-13777393 ATGGAATAGGGAAGGGAAGATGG + Intergenic
950861536 3:16151541-16151563 ATGCAGTTGGGAAGGAAAGATGG - Intergenic
950984100 3:17341909-17341931 CTGTATTGGGGATGGGAAGAGGG - Intronic
951359775 3:21711613-21711635 GTGTTTTTGGGGATGGGAGATGG - Intronic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
951729669 3:25796664-25796686 AGGCAGTTGGGAAGGGAAGATGG - Intergenic
952226522 3:31382305-31382327 ATCTCTTTGGGGAGAGATGAAGG - Intergenic
952311020 3:32190468-32190490 ATGTATTTTGAGAGGAAAAAAGG - Intergenic
952621288 3:35346220-35346242 ATGTATTTGGTAGGGGAAAAAGG - Intergenic
953062615 3:39439871-39439893 ATGAATCTGGAGAGGGAAGCAGG - Intergenic
953194154 3:40716083-40716105 AGGGATTTGGGGATGGAAGTAGG + Intergenic
953418812 3:42739344-42739366 ATGTATTGGGGGAAGGAGGTGGG - Intronic
953610248 3:44441784-44441806 ATGGATTTGGGGAGGGTACATGG - Exonic
954050834 3:47975746-47975768 TTTTATTTGGGGAGGGAAGGTGG - Intronic
954652441 3:52173393-52173415 GAGCATTTGGGGAGAGAAGATGG + Intergenic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
954982714 3:54760842-54760864 ATGGATTTGGGAAGTGAAGTCGG + Intronic
955114372 3:55982713-55982735 ATATATTTGTGGAGGGAATGGGG + Intronic
955626131 3:60921612-60921634 ATGTTTTTGGGGAGAGGGGATGG - Intronic
955724589 3:61919577-61919599 GTCCATTTGGGGAGTGAAGATGG + Intronic
955977972 3:64496606-64496628 ATGTATTTGGGGGTGGAGCAGGG - Intergenic
956285924 3:67610051-67610073 ATTTATTTGGGGTGAGAAGGGGG - Intronic
956975148 3:74570206-74570228 ATGTATATGGAGGGGGAGGAGGG + Intergenic
957269519 3:78011405-78011427 ATGAATTTGGGAAGGGAGCAGGG - Intergenic
957275645 3:78087974-78087996 ATGTTTTAGGGGAGGAGAGAAGG + Intergenic
959747396 3:109792692-109792714 ATGTATTTGGGGAGTGGAGTAGG + Intergenic
960554042 3:119007904-119007926 ATATATTTTCTGAGGGAAGAAGG - Intronic
962284476 3:134074782-134074804 AGATCTTGGGGGAGGGAAGAGGG + Intronic
962644996 3:137429455-137429477 CTTTATTTGGGGTGGGAAAAAGG + Intergenic
964083135 3:152784871-152784893 TTTTATTTGGGGAGGGAAAAGGG - Intergenic
964181092 3:153887326-153887348 AACAATTTGGGGAGGGAAAATGG - Intergenic
964838156 3:160963642-160963664 ATGTATTTGTGAAGAGAAGGGGG + Intronic
965229941 3:166037694-166037716 TTGTATATGGGGAGCCAAGATGG + Intergenic
965259992 3:166469707-166469729 AACTATCTGAGGAGGGAAGAGGG - Intergenic
965283624 3:166786680-166786702 ATGCATATGTGGGGGGAAGAGGG + Intergenic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967290416 3:187914428-187914450 ACATATCTGGTGAGGGAAGAAGG + Intergenic
967724316 3:192847339-192847361 TTGTTTTTAGGGAGGGAATAAGG - Intronic
967848289 3:194062110-194062132 ATGTATTTGGGTTGACAAGATGG - Intergenic
969437033 4:7194152-7194174 ATTTGTATGGGGAGGGGAGATGG + Intronic
969499995 4:7546824-7546846 ATGTGTTTTTGCAGGGAAGAGGG - Intronic
970725696 4:19041768-19041790 ATGTAATTGGGAAAGGAAGATGG - Intergenic
971582600 4:28361865-28361887 ATGAATTTGGGCAGGGAGGGGGG - Intergenic
972095918 4:35346866-35346888 GTGACTTTGGGGAGGGCAGAGGG - Intergenic
973561891 4:52145139-52145161 TTGAATTTGGGCAGGGAGGAAGG + Intergenic
974256120 4:59457748-59457770 ATGTACTTTGGGATGGGAGAGGG - Intergenic
975369548 4:73568640-73568662 TTGTGCTTGAGGAGGGAAGAAGG - Intergenic
976551554 4:86402306-86402328 CTGTATTTGGGGATTGCAGATGG - Intronic
976662248 4:87551761-87551783 AAAAATTTGGGCAGGGAAGAAGG - Intergenic
976676044 4:87704631-87704653 ATGAATAGGGGAAGGGAAGAGGG + Intergenic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
977355226 4:95937982-95938004 AGGAGGTTGGGGAGGGAAGAGGG + Intergenic
977498185 4:97803195-97803217 ATATATATGGAGGGGGAAGAGGG + Intronic
978188534 4:105886034-105886056 TGGGATTTGGGGAGGGGAGAAGG + Intronic
978393975 4:108258386-108258408 ATGTATTGGGAGATGGAATATGG - Intergenic
978698817 4:111617580-111617602 ATGTGTATGGGGAGGCAAGGAGG + Intergenic
979338937 4:119497222-119497244 TTGGATTTGGGGAGAGTAGAAGG - Exonic
979807007 4:124986521-124986543 AAGTAATTCAGGAGGGAAGAGGG - Intergenic
980027861 4:127787443-127787465 ATGTGGTTGGGAAGGGATGAAGG - Intronic
981438123 4:144750122-144750144 ATGAATTTGGGGAAGGGAGAGGG + Intergenic
981546498 4:145899329-145899351 AGGGAGTTGGGGAGGGTAGAGGG + Intronic
982523723 4:156452075-156452097 AGGAATTTGGGGAGGGAGGACGG + Intergenic
984883197 4:184428353-184428375 AGGAATTTGGAGAAGGAAGAGGG + Intronic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
984984716 4:185316785-185316807 ATCAATTTGGCTAGGGAAGATGG - Intronic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
990416995 5:55596311-55596333 CTGCATGTGGGGAGGAAAGATGG + Intergenic
990868525 5:60405925-60405947 GTGTAATTGGGGCAGGAAGAAGG - Intronic
991951271 5:71948697-71948719 GTTTTTTTTGGGAGGGAAGAGGG + Intergenic
992294718 5:75316627-75316649 ATTTATGTGGGGAAGGAAGGGGG - Intergenic
992535237 5:77694741-77694763 AGCTATTTGGGAAAGGAAGAAGG - Intronic
993183500 5:84585769-84585791 ATGGACTTGGGTAGGGAAAATGG - Intergenic
995405111 5:111785896-111785918 ATGGATAGGGAGAGGGAAGAGGG + Intronic
996289460 5:121834833-121834855 ATTTACTTGGTAAGGGAAGAAGG + Intergenic
996390993 5:122961347-122961369 ATGTATTTGGGAGGGGGTGAGGG + Intronic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
996684980 5:126269965-126269987 AGGGATCTGGGAAGGGAAGATGG + Intergenic
996883927 5:128333325-128333347 CTGAATCTGGGCAGGGAAGAAGG - Intronic
997430197 5:133832625-133832647 ATGTATGTAGGGAGGAAAGCTGG - Intergenic
997549527 5:134739507-134739529 ATGTGTTTGGGGGAGGAAGGAGG - Intronic
997608594 5:135194235-135194257 ATTTATCTGGAGAGGAAAGAAGG + Intronic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
997904343 5:137800219-137800241 ATGTATTTGGGTAGGGAAACAGG + Intergenic
998207051 5:140165442-140165464 ATATATTTGGGGAGTGTACAGGG + Intergenic
998702654 5:144721554-144721576 ATGTATTGGGTAAGGGATGAGGG - Intergenic
998975178 5:147637411-147637433 AAGAATTTGGGGAGGCAAAATGG - Intronic
999334378 5:150703020-150703042 ATAAATTGGGGGAGGAAAGAGGG - Intergenic
999715925 5:154359833-154359855 AAGAATCTTGGGAGGGAAGATGG - Intronic
1000019880 5:157309912-157309934 AGGGATCTGGGGAGGGAGGAGGG - Intronic
1000226271 5:159264728-159264750 ATGTAATTGGGGTGGAGAGAAGG - Intronic
1000245769 5:159447281-159447303 ATGTGTTTGTGGAGGAAAGAAGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1001262095 5:170239318-170239340 AAGTATATTGGGAGAGAAGAGGG + Intronic
1001995895 5:176157784-176157806 ATGGATGTGGGGCGGGGAGATGG - Intergenic
1003428931 6:6021327-6021349 ATGTATTTGGAGTGTGAAGAGGG + Intergenic
1004419212 6:15453059-15453081 ATGTATTGAGTGAGGGATGATGG - Intronic
1004468674 6:15908779-15908801 AGGGTGTTGGGGAGGGAAGATGG + Intergenic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1005341193 6:24845340-24845362 ATCTTTTAGGGGAGGGATGAAGG + Intronic
1005499886 6:26420687-26420709 ATTTTTTTTTGGAGGGAAGAGGG + Intergenic
1005631049 6:27708395-27708417 AGATGTTTGGGGAGGGCAGATGG - Intergenic
1005813719 6:29533994-29534016 AGGGATGTGGGGAGGGAAGGAGG - Intergenic
1005918673 6:30378337-30378359 AAGTATTAGGGGCAGGAAGAGGG + Intergenic
1006214892 6:32432291-32432313 ATGTCCTTGGGTAGGGATGACGG - Intergenic
1006314326 6:33280982-33281004 ATGTACCTGGTGAGAGAAGAGGG + Exonic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1007189058 6:39998047-39998069 ATGTATTTAGGGTGGTAAGTGGG - Intergenic
1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG + Intergenic
1007421609 6:41723260-41723282 ATGTCTTTGGGGAGGGGTGGGGG - Intronic
1007586548 6:42993851-42993873 ATGAATTTGGTGAGGGGAGGGGG + Intronic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1008664426 6:53702078-53702100 ATGTGTTTGGGGAGGCACCAAGG + Intergenic
1009337863 6:62515927-62515949 AAGTATTTGGGGTTGGAGGAGGG + Intergenic
1009970619 6:70621777-70621799 ATGTATTTGAGGACGGACGCAGG + Intergenic
1010331659 6:74630130-74630152 AGGTGTTTGGGGAGGGAGGGAGG - Intergenic
1010537844 6:77052965-77052987 ATGTATTTTGGAAGAAAAGAAGG + Intergenic
1010641012 6:78327297-78327319 ATGTATTTAAGGAGGGAAACAGG - Intergenic
1011221436 6:85058355-85058377 TTGAGTTTGAGGAGGGAAGAAGG + Intergenic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012150533 6:95745102-95745124 ATGATTTTAGGGAGAGAAGAAGG - Intergenic
1013122647 6:107154837-107154859 ATTAAATTGGGGAGGGGAGATGG + Intronic
1014002475 6:116380259-116380281 ATGTCTAGGTGGAGGGAAGAGGG + Intronic
1014143001 6:117965544-117965566 ATCCTTTTGGGGAGGGAGGACGG - Intronic
1014827838 6:126066469-126066491 ATGTATGTCGAGAGGGAAGATGG + Intergenic
1015445273 6:133296636-133296658 AAGCTTTTCGGGAGGGAAGATGG + Intronic
1016050809 6:139528089-139528111 ATGTATGTGTGGGGGGAAGGAGG + Intergenic
1016215226 6:141591758-141591780 ATGCAGATGGGGTGGGAAGAGGG - Intergenic
1016301809 6:142640125-142640147 ATGTGATTGGGGAAGGCAGATGG + Intergenic
1016475939 6:144428025-144428047 ATGAATTCAGGGAGGGAAGTGGG + Intronic
1016501639 6:144726989-144727011 AGGGGTGTGGGGAGGGAAGAGGG - Intronic
1016630539 6:146224957-146224979 CTGTATTTGGGGTGGGGAGAAGG - Intronic
1017055812 6:150434721-150434743 ATGGAGGTGGGGAGGGAAGGGGG - Intergenic
1017732058 6:157325337-157325359 ATGTATGAGGGGAAGGAAAAAGG - Intergenic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1018159589 6:161025415-161025437 AAGTATTTGGTGACGGAAAACGG - Intronic
1019436048 7:1022754-1022776 AAGTAACTGGGGAGGGAGGACGG - Intronic
1020191912 7:6006883-6006905 ATGTATTGGAGCAGGGAATAAGG - Intronic
1020724429 7:11792449-11792471 ATATATTGGGGGAGGAAAGTTGG - Intronic
1020726020 7:11815863-11815885 AATAATTTGGGGTGGGAAGAAGG - Intronic
1021469550 7:20985657-20985679 ATGAATTTGGTGTGGGTAGAGGG + Intergenic
1021524861 7:21575690-21575712 ATGCCTTTGGGGAGGAAAAATGG - Intronic
1021673563 7:23057821-23057843 CTGGATCTGGGAAGGGAAGAAGG - Intergenic
1021835871 7:24674159-24674181 AGGTCATTGTGGAGGGAAGAAGG - Intronic
1022525208 7:31032715-31032737 ATGTGTAAGGGAAGGGAAGAAGG + Intergenic
1023205473 7:37745126-37745148 GAGGATTTGGGGAGGCAAGAGGG - Intronic
1023491012 7:40741955-40741977 TTATATTTGGGGATAGAAGAGGG + Intronic
1023495793 7:40795396-40795418 ATTTATTTGGTGAAAGAAGATGG - Intronic
1023513797 7:40980359-40980381 ATGAATTTGGGGGGGCAAAAGGG - Intergenic
1024158741 7:46652527-46652549 ATGTGTCTGGTGAGGGCAGATGG - Intergenic
1024295965 7:47842579-47842601 ATGAAGATGGGGTGGGAAGAAGG - Intronic
1024473749 7:49789726-49789748 ACCTGTTTGGGGAGAGAAGAAGG - Intronic
1024482966 7:49884166-49884188 ATGGAGTGTGGGAGGGAAGAAGG + Intronic
1024624356 7:51191944-51191966 ATGCATTTTGGGAGAAAAGACGG + Intronic
1024807227 7:53157245-53157267 AGGTATTTCTGAAGGGAAGAAGG + Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026178217 7:68016351-68016373 ATGGATGGAGGGAGGGAAGAGGG - Intergenic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1028047819 7:86145452-86145474 ATATATTTGTGCAGGCAAGAAGG - Intergenic
1028482389 7:91321783-91321805 AGGAAGTTAGGGAGGGAAGATGG - Intergenic
1028918195 7:96283000-96283022 ATTTATTTTGGGTGGGAACACGG - Intronic
1029162111 7:98559926-98559948 TTGTATCTTGGGAGGTAAGAGGG + Intergenic
1029337459 7:99914645-99914667 ATGTTTATGGGGTAGGAAGAAGG - Intronic
1029681948 7:102117558-102117580 GTGGCCTTGGGGAGGGAAGAGGG + Intronic
1029949912 7:104573087-104573109 ATTCATTTGGGGAGGGAAAATGG + Intronic
1030109420 7:106013721-106013743 ATGTTCTTGGGGATTGAAGAAGG - Intronic
1030810076 7:113960787-113960809 TAGAATTTGGGGATGGAAGATGG - Intronic
1031210961 7:118825576-118825598 TTGCATTTGGGAAGGGGAGAAGG - Intergenic
1031534435 7:122916039-122916061 ATGCATTTGGGGACTGAAGTTGG + Intergenic
1031962682 7:128004075-128004097 ATGTATTTGTGGGAGGAAGATGG + Intronic
1032575232 7:133046563-133046585 ATTTTTTTGGGGGGGGGAGACGG + Intronic
1033218033 7:139508301-139508323 ATGAATTTGTGGAAGGAAGAAGG + Intergenic
1034075333 7:148225913-148225935 ATACTTTTGGGGAGAGAAGATGG + Intronic
1035916122 8:3625426-3625448 ATGTAGTGGGAGAGGAAAGAGGG - Intronic
1036796231 8:11758480-11758502 AGGAATTTGAGGAGGGAAGAGGG - Exonic
1037348978 8:17929075-17929097 ATGTATTATTGGAAGGAAGAGGG - Intronic
1038468422 8:27788674-27788696 TTGTCTTGGGGGAGGGAAGGAGG + Intronic
1039546975 8:38417440-38417462 ATTTACTTGGGAAGGGAGGAGGG + Intronic
1039817339 8:41106105-41106127 ATGAATGTGGGGAAAGAAGATGG + Intergenic
1039877698 8:41601677-41601699 ATGACTTTGGGTAGGGCAGAAGG + Intronic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1043285258 8:78519921-78519943 ATCTGGTTGGGGAAGGAAGATGG - Intronic
1045014315 8:97986443-97986465 ATGGACTTGGGGTGGGAGGATGG - Intronic
1045439890 8:102198649-102198671 AAATATTTGTGGAGGGAAGGAGG + Intergenic
1046816653 8:118591882-118591904 GGGTATTTTGGGAGGGAAGAAGG + Intronic
1046892894 8:119442417-119442439 CTGAATTGGGGGTGGGAAGATGG + Intergenic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1048201643 8:132379548-132379570 AAGGGTTTGGGAAGGGAAGAGGG - Intronic
1048477091 8:134753255-134753277 ATCTATTTTGGGGGGGCAGAGGG + Intergenic
1048817866 8:138350923-138350945 ATGACTTTGGGGAGGTAAGCAGG - Intronic
1049224530 8:141443515-141443537 AGGTAATGGGAGAGGGAAGAGGG - Intergenic
1050772805 9:9224302-9224324 ATGTGTATGGGGAGGGAGAAAGG + Intronic
1050858827 9:10397447-10397469 TTGTTTTTGGAGAGGGAACAAGG + Intronic
1050945662 9:11513512-11513534 ATGTAGGAGGGGAGGGAAAATGG + Intergenic
1051356776 9:16246678-16246700 AAGTCTTTGGGGAATGAAGAAGG + Intronic
1051493026 9:17688345-17688367 ATGTAGTTTGGGATGGAAAATGG + Intronic
1051675443 9:19553951-19553973 ATGAATTTGGGTGGGGGAGAAGG - Intronic
1052495485 9:29218414-29218436 ATGAATTTGGGGTGGGAAGAAGG + Intergenic
1052590627 9:30489387-30489409 ATGTTCTTGGGGATGGATGAAGG - Intergenic
1052970448 9:34374040-34374062 ATGGATTTGGTGATGGATGATGG - Intronic
1053041500 9:34877465-34877487 AGGGTTTTGGGGAGGGATGAGGG + Intergenic
1053793563 9:41704341-41704363 ATGTGTTCGGGGAGGGAACCAGG + Intergenic
1054151615 9:61610489-61610511 ATGTGTTCGGGGAGGGAACCAGG - Intergenic
1054181974 9:61916356-61916378 ATGTGTTCGGGGAGGGAACCGGG + Intergenic
1054471383 9:65541628-65541650 ATGTGTTCGGGGAGGGAACAAGG - Intergenic
1056418948 9:86404808-86404830 AAGTGTTTGTGAAGGGAAGATGG - Intergenic
1056717513 9:89044593-89044615 ATGTTTTTGAGAAGGGAAAAAGG + Intronic
1056741349 9:89258008-89258030 AGGAATTTGAGGATGGAAGAAGG + Intergenic
1057242844 9:93427331-93427353 TTATATTTGGGCAGGGGAGAGGG + Intergenic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057828665 9:98390669-98390691 AGGTGTTTGGGGAAGGATGATGG - Intronic
1057857707 9:98614721-98614743 TTGTTTCTGTGGAGGGAAGAAGG + Intronic
1057952712 9:99382723-99382745 ATGGATTTGGGCAGGGCAGTGGG - Intergenic
1059052320 9:110939367-110939389 AGGTATTTGGTGAAGAAAGATGG - Intronic
1059291597 9:113230055-113230077 ATTTATGTAGGGAGTGAAGATGG + Intronic
1059321759 9:113475759-113475781 ATGTATCTGTGGAGGGAGGTTGG + Intronic
1059801118 9:117750485-117750507 CTGTACTTGGAGAGGAAAGATGG - Intergenic
1060174124 9:121485122-121485144 ATTTATCTGGGGTGGGAAAATGG - Intergenic
1060183188 9:121547817-121547839 GAGTATTTGGGGAGGAAAGCAGG - Intergenic
1060541405 9:124433028-124433050 ATGGCTTTGAGGATGGAAGAAGG + Intergenic
1060601244 9:124879425-124879447 AAGTATTTGGGGTGGGATGAGGG + Exonic
1060888063 9:127169437-127169459 ATGTATTTGGAGGGAAAAGAAGG + Intronic
1060925842 9:127454591-127454613 ATGTGTTTGGTGAGGGAAAGTGG + Exonic
1060929870 9:127482490-127482512 ATGTTTTTGGGAAGGTAAGTTGG - Intronic
1061720788 9:132550016-132550038 ATGTATGTGGGGAGTGATGGGGG + Intronic
1061798474 9:133101882-133101904 ATGGATTTGGAGTGGGGAGATGG + Intronic
1061945767 9:133907580-133907602 ATGTTTTAGGGGATGGGAGAAGG + Intronic
1061946255 9:133909809-133909831 ATGTGTTTTGGGATGTAAGAGGG - Intronic
1062418132 9:136463959-136463981 CAGTATTTGGGGAGAGAAAATGG - Intronic
1185612892 X:1402785-1402807 CTGCATTTGGGGAGGGGGGAAGG - Intergenic
1186100824 X:6154718-6154740 ATATACTTTGGGAGTGAAGAAGG + Intronic
1186309691 X:8304089-8304111 AAGTATTTGGGGAATGAAGCTGG - Intergenic
1186365109 X:8884461-8884483 GAGTATTTGGGTGGGGAAGAGGG - Intergenic
1187107534 X:16259749-16259771 AGGTAGTTGGGAAGGAAAGATGG + Intergenic
1187714367 X:22088015-22088037 AGGTATTTGGGGGTGGATGATGG - Intronic
1187988548 X:24842980-24843002 GTGTATTGGGGGAGGGAGGCAGG - Intronic
1188257260 X:27977900-27977922 ATTTTTTTGGGGAGGGGATAGGG - Intergenic
1188258334 X:27990184-27990206 ATGGATTTGGGCAGTGAAAAAGG - Intergenic
1188594717 X:31885273-31885295 GTATGTTTTGGGAGGGAAGAGGG - Intronic
1189089940 X:38071252-38071274 AAGCATTTCAGGAGGGAAGATGG + Intronic
1189407883 X:40741989-40742011 ATTTTTTTGTGGAGGGGAGAGGG + Intergenic
1189602130 X:42638339-42638361 TTGTTTTTGAGGAGAGAAGAGGG + Intergenic
1190329254 X:49225784-49225806 ATTTATTTGGGTAGGGGGGAAGG + Intronic
1190387213 X:49894058-49894080 ATTTATTTGGGGTGAGATGAAGG - Intergenic
1190430828 X:50376403-50376425 GGGAATTTGGGGAGGGTAGAAGG + Intronic
1190685089 X:52866388-52866410 ATGTCTATGGGGAGGGGAGGAGG - Intronic
1191054440 X:56227785-56227807 ATAAATTGGAGGAGGGAAGAGGG - Intergenic
1191944629 X:66518700-66518722 AGGTATTTGGGTTGGGAGGATGG - Intergenic
1192639453 X:72848099-72848121 AAGGATTGGGGGAGGCAAGATGG + Intronic
1192642258 X:72872706-72872728 AAGGATTGGGGGAGGCAAGATGG - Intronic
1192828913 X:74729721-74729743 AAATATTTGGGGAAGGGAGATGG + Intergenic
1193083553 X:77428292-77428314 AGGTATCTGGGGAGAAAAGAAGG - Intergenic
1193598851 X:83483287-83483309 ATGTGTTTGTGGAGGTATGAGGG + Intergenic
1194562722 X:95442868-95442890 TTAAATTTGGGGAGGGAAAAGGG + Intergenic
1194966440 X:100293748-100293770 AAGTATTTGGATAGGGAAGAAGG + Exonic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1195263773 X:103160509-103160531 GTGTATTTGGGAATGTAAGAAGG + Intergenic
1195441229 X:104900865-104900887 ATGAATTTAGGGAGAGACGAAGG + Intronic
1196818253 X:119682446-119682468 ATGTAATTGGGGAGGGGAGTGGG - Intronic
1197681115 X:129386463-129386485 ATGTCTTTAGGCAGGGAAGAGGG - Intergenic
1198279493 X:135127680-135127702 ATGTATTTGGGGATTAAAGAAGG + Intergenic
1198291464 X:135244834-135244856 ATGTATTTGGGGATTAAAGAAGG - Intergenic
1198620229 X:138499663-138499685 ATGGGTTTGGGGAGGGCAAAGGG + Intergenic
1198688186 X:139250248-139250270 TGGTGTTTGGGGAGTGAAGATGG - Intergenic
1198864101 X:141102935-141102957 ATGTATATAGGAATGGAAGAAGG - Intergenic
1198898588 X:141484481-141484503 ATGTATATAGGAATGGAAGAAGG + Intergenic
1199495585 X:148448759-148448781 ATGCAATTAAGGAGGGAAGAGGG - Intergenic
1199789380 X:151137756-151137778 ATGAATTTTGCCAGGGAAGAAGG + Intergenic
1200314287 X:155115445-155115467 GTGTATTTGGGGTGAGAAGTGGG + Intronic
1200409351 Y:2846228-2846250 TTAAATCTGGGGAGGGAAGAGGG - Intronic
1201013159 Y:9570507-9570529 ATGTATTTAGGAATGGAAGAAGG - Intergenic