ID: 948133079

View in Genome Browser
Species Human (GRCh38)
Location 2:235615207-235615229
Sequence TCCAGGGACGTCCCCACCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948133073_948133079 0 Left 948133073 2:235615184-235615206 CCACTGCCAGCCAGCTTGCACGG 0: 1
1: 0
2: 2
3: 9
4: 182
Right 948133079 2:235615207-235615229 TCCAGGGACGTCCCCACCCTCGG 0: 1
1: 0
2: 0
3: 19
4: 163
948133071_948133079 25 Left 948133071 2:235615159-235615181 CCCACAGAGGTGGGTGTTGTCAC 0: 1
1: 0
2: 0
3: 16
4: 108
Right 948133079 2:235615207-235615229 TCCAGGGACGTCCCCACCCTCGG 0: 1
1: 0
2: 0
3: 19
4: 163
948133072_948133079 24 Left 948133072 2:235615160-235615182 CCACAGAGGTGGGTGTTGTCACT 0: 1
1: 0
2: 4
3: 17
4: 202
Right 948133079 2:235615207-235615229 TCCAGGGACGTCCCCACCCTCGG 0: 1
1: 0
2: 0
3: 19
4: 163
948133075_948133079 -6 Left 948133075 2:235615190-235615212 CCAGCCAGCTTGCACGGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 948133079 2:235615207-235615229 TCCAGGGACGTCCCCACCCTCGG 0: 1
1: 0
2: 0
3: 19
4: 163
948133078_948133079 -10 Left 948133078 2:235615194-235615216 CCAGCTTGCACGGTCCAGGGACG 0: 1
1: 0
2: 0
3: 6
4: 41
Right 948133079 2:235615207-235615229 TCCAGGGACGTCCCCACCCTCGG 0: 1
1: 0
2: 0
3: 19
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948133079 Original CRISPR TCCAGGGACGTCCCCACCCT CGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900824231 1:4913479-4913501 TCCAGAACCTTCCCCACCCTGGG + Intergenic
902109319 1:14064868-14064890 TCCAGGCCAGTCCCCACCCAAGG + Intergenic
903070205 1:20723476-20723498 GCCTGGGACTTCACCACCCTGGG - Intronic
903359091 1:22765830-22765852 ACAAGGAACCTCCCCACCCTGGG + Intronic
903548850 1:24143658-24143680 TCAAGGCAGGTCCCCACGCTTGG + Intergenic
903558518 1:24210723-24210745 TCCAGGGGTGTCCAGACCCTGGG + Intergenic
903811432 1:26036904-26036926 TCCAGCGCCCTCCCCACCCTGGG - Intergenic
905571701 1:39011465-39011487 TCAAGCGACTCCCCCACCCTTGG + Intergenic
905923333 1:41733265-41733287 TCCAAGGACATCCCATCCCTTGG - Intronic
907228937 1:52976884-52976906 CCCAGTGCCGTCCCCACTCTGGG + Intronic
919924395 1:202184979-202185001 CCCAGGGACCACCCCATCCTGGG - Intergenic
923538403 1:234870627-234870649 TCCTGGGACCTTCCCAGCCTCGG - Intergenic
923568062 1:235091488-235091510 TCTAGAGACCTCTCCACCCTGGG - Intergenic
924583369 1:245340933-245340955 TCCACTGACGTCCCCACTTTGGG - Intronic
1067094736 10:43292896-43292918 TCCAGGGAGGGCCCCAGGCTTGG + Intergenic
1070289237 10:75103963-75103985 TCTAGGGCCGACCCCACGCTGGG + Intronic
1070725068 10:78782102-78782124 TCCAAGGCCTTCCCAACCCTGGG + Intergenic
1072265939 10:93728094-93728116 TCCAGGACTGTGCCCACCCTTGG + Intergenic
1072443633 10:95479118-95479140 TTCAGGGACGTCCCCTTCCTTGG - Intronic
1074981673 10:118624930-118624952 CCCAGGGACTTCTGCACCCTGGG + Intergenic
1076050973 10:127332822-127332844 TCCTGGCACCTCCCCACACTTGG - Intronic
1076874925 10:133211224-133211246 GCCAGGGAGGTGCCCAGCCTGGG - Intronic
1078241465 11:9534535-9534557 CCCAGGCACGTCCTCAGCCTTGG + Intergenic
1080868175 11:36213640-36213662 CCCAGGGCCGCTCCCACCCTGGG + Intronic
1082849319 11:57751911-57751933 ACCAAGGACGTTGCCACCCTTGG + Intronic
1083823838 11:65187305-65187327 TTCAGGGAAGGCCCCACCCAGGG - Intronic
1084575585 11:69986145-69986167 CCCAGGGAAGTCCCCACAGTCGG + Intergenic
1084695900 11:70755534-70755556 TCCAGGCACGTCCCCAGCCCCGG + Intronic
1084753578 11:71220711-71220733 TCCATGGATTTCCCCACTCTAGG - Intronic
1088832177 11:113546864-113546886 CCCAGGAACTTCACCACCCTTGG + Intergenic
1089207117 11:116773129-116773151 GCCAGGGACGTGCGCACCTTCGG + Intergenic
1090014228 11:123071487-123071509 TCAAGTGACCTACCCACCCTTGG - Exonic
1090449730 11:126795886-126795908 GCCAGGCTCGTCCTCACCCTGGG + Intronic
1090576069 11:128105340-128105362 TCCAGGCATGTCCTCAACCTGGG + Intergenic
1091837468 12:3595828-3595850 TCCAGGCAGGTCTCCGCCCTTGG - Intergenic
1097698546 12:62798098-62798120 TCCAGGCATGTCCTTACCCTTGG - Intronic
1102008928 12:109606352-109606374 TCCAGGGGGGGCCCCACCCCTGG - Intergenic
1103963654 12:124624717-124624739 TCCAGGCACTTCCCGACCCTTGG - Intergenic
1104975598 12:132550625-132550647 ACCAGGGTCGTCCCCACCTCTGG - Intronic
1106329727 13:28729129-28729151 TCCAGGGAGGACTCCATCCTAGG - Intergenic
1107640420 13:42437429-42437451 TCCACTGACGTCCTCACCCATGG + Intergenic
1109624521 13:64957964-64957986 TCCTGGGGAGTCCCCACTCTAGG - Intergenic
1110167390 13:72460099-72460121 TGCAGGGCCCTCCTCACCCTGGG - Intergenic
1113523220 13:110954866-110954888 TCCACGGGCCTCCCTACCCTCGG + Intergenic
1113644060 13:111979953-111979975 TCCAGGGCCCTCCTGACCCTCGG + Intergenic
1113702141 13:112395943-112395965 TCCACGGGCCTCCCTACCCTCGG - Intronic
1113804966 13:113107235-113107257 TCCCGGGACACCCACACCCTTGG - Intronic
1117304227 14:54458365-54458387 TCCTGAGACCTCCCCAGCCTTGG + Intergenic
1119891513 14:78186007-78186029 TCCAGGGACATTACCACCCCTGG - Intergenic
1121581845 14:95037611-95037633 TCCAAGGCTGACCCCACCCTGGG - Intergenic
1122339512 14:101019109-101019131 TCCAAGAGCGGCCCCACCCTCGG + Intergenic
1122870328 14:104635420-104635442 CCCAGGGAAGTCCCCGCCCTGGG + Intergenic
1129378943 15:75153663-75153685 CCCAGGGACCTGCCCAGCCTTGG - Intergenic
1129686903 15:77691480-77691502 CCCAGGGACATCCCTTCCCTAGG - Intronic
1132299777 15:100768311-100768333 TCCAGAAACGCCACCACCCTGGG - Intergenic
1132603500 16:784138-784160 CCCCGGGACGTGTCCACCCTCGG - Intergenic
1133460410 16:5982234-5982256 TCCAGGGATGTTCCCACCATAGG + Intergenic
1133476121 16:6123810-6123832 TCCAGGGATGTCTTGACCCTGGG + Intronic
1134017880 16:10901967-10901989 TCCAGGGCCCTCCCCATCCCAGG + Intronic
1134113454 16:11530768-11530790 TGGAGGGAGGGCCCCACCCTAGG - Intergenic
1134979130 16:18593234-18593256 TCCAGGCACCCACCCACCCTGGG + Intergenic
1136077324 16:27826158-27826180 TCCAAGTGCGTCCCCACCTTGGG - Intronic
1136477553 16:30522979-30523001 GCCCGTGACATCCCCACCCTTGG + Exonic
1138022968 16:53501694-53501716 TCCAGGGACGTACCCAACCCAGG + Intronic
1138302982 16:55948127-55948149 CCCAGGCACGTCCTCAACCTGGG - Intronic
1139638432 16:68273617-68273639 TCCAGGGGCATCCCAACCCAGGG - Intronic
1140228226 16:73096037-73096059 TCCAGGCCCCTCTCCACCCTTGG - Intergenic
1140841103 16:78839858-78839880 TCCAGTGACCTCCCAACCCCAGG + Intronic
1141462311 16:84184798-84184820 TCCAGGGACATCCCTTCCCTGGG - Intronic
1141844591 16:86598795-86598817 TCCAGGGACGCCCTCGCCCCTGG + Intergenic
1142441811 16:90103275-90103297 TCCAGGGAAGCCTCCAGCCTTGG - Intergenic
1143108054 17:4539196-4539218 TGCAGAGACCTCCCCACCCCCGG - Intronic
1144725954 17:17502909-17502931 TGTAGGGGCCTCCCCACCCTGGG + Intergenic
1146901496 17:36592168-36592190 GCCCGCGACGTCCCCGCCCTCGG - Intronic
1147869788 17:43579099-43579121 CCCTGGGGCGTCCCCTCCCTCGG + Intronic
1151246222 17:72796987-72797009 TTCAGGGACGGCCCCATCCTAGG - Intronic
1152179258 17:78807554-78807576 TCCAGGAATGGCTCCACCCTGGG - Exonic
1152271081 17:79325232-79325254 TCCAGGGATGAGCCCACCCAGGG - Intronic
1152584105 17:81181483-81181505 TCCAGGGAAGACCCCGCCCTGGG - Intergenic
1155225812 18:23728252-23728274 TCCAGGAAGGTCACCAGCCTGGG - Intronic
1156542294 18:37926092-37926114 TCCAGGGACCTCCCCAACAGAGG - Intergenic
1157910752 18:51615478-51615500 TCCAGGGACTTCCCAGCCCTTGG - Intergenic
1160521954 18:79512907-79512929 TGCAGGGACGTCCTGACCGTAGG + Intronic
1160906939 19:1455988-1456010 CCCTGGGATGACCCCACCCTGGG - Intronic
1161208508 19:3054577-3054599 TACAGGGACGTCCTGATCCTAGG + Intronic
1161768011 19:6217419-6217441 CCCAGGGCCCTCCCCACTCTGGG + Intronic
1161988523 19:7670646-7670668 TCTAGTGACGTCCCCACCCAAGG + Intergenic
1163104258 19:15114537-15114559 TCCGGGGAAGTCCCCACGATTGG + Exonic
1166849752 19:45753850-45753872 TCCAGGGATGTCCTTACTCTGGG + Intronic
1167297403 19:48659735-48659757 TTCAGAGATGACCCCACCCTGGG + Intergenic
1167410718 19:49342212-49342234 TGCTGTGACATCCCCACCCTGGG + Intronic
1168346661 19:55653179-55653201 CCCAGGCACGTCCCCCTCCTAGG - Intergenic
925121559 2:1422243-1422265 TCCATGCTCGTCCCCACCCAAGG - Intronic
925876741 2:8317662-8317684 TCCAGTGACGTCACCCCTCTCGG - Intergenic
926706484 2:15841295-15841317 TCCCGGGACGTCCCCTCCATAGG + Intergenic
931254560 2:60558495-60558517 TCCAGGGACCTCCCAACCTGTGG - Intergenic
942640861 2:178059317-178059339 TCTTGGGATGTCCCCACCCCAGG + Intronic
944601746 2:201310102-201310124 TCCAGGGCCTTCCCCCTCCTAGG - Intronic
946026309 2:216673791-216673813 TCCCAGGATCTCCCCACCCTGGG + Exonic
946172798 2:217905497-217905519 TCCAGGGCCCTCCCCACCGTGGG + Intronic
946758742 2:222972570-222972592 TCCAGGCACCTCCCGACCCCAGG - Intergenic
946864975 2:224034692-224034714 CCCAGGGAGTCCCCCACCCTTGG - Intronic
948133079 2:235615207-235615229 TCCAGGGACGTCCCCACCCTCGG + Intronic
948365296 2:237450780-237450802 GGCACGGACCTCCCCACCCTGGG + Intergenic
948382576 2:237561058-237561080 TGCAGGAAAGTCCCCTCCCTGGG - Intergenic
948922335 2:241071606-241071628 ACCAGGGAGGACACCACCCTCGG + Exonic
1175413307 20:58785477-58785499 TCCAGGGAAATGCCCACACTGGG - Intergenic
1176116669 20:63434650-63434672 TCCACGGACTTCCCCGCCCCGGG + Intronic
1176243783 20:64087821-64087843 TGGAGGGACCACCCCACCCTTGG + Intronic
1179626006 21:42650099-42650121 TCCAGCCTCGTCCCCACCCAGGG + Intergenic
1181637383 22:24180821-24180843 TCCAGAGATGCCACCACCCTGGG - Intergenic
1182080453 22:27525080-27525102 TCCAGGCATGTCTCTACCCTTGG + Intergenic
1182085035 22:27555621-27555643 TCCAGGGATGGCCCCACCACAGG + Intergenic
1182261285 22:29073932-29073954 TCCAGCGACATCCCTCCCCTGGG + Intronic
1183228220 22:36564556-36564578 TCCAGGGACGCCTCCCCCGTGGG - Exonic
1184789361 22:46689897-46689919 CCCAGGGAACCCCCCACCCTGGG + Intronic
950494155 3:13323858-13323880 TGCAGGGAGGTCTCCAGCCTGGG - Intronic
950590426 3:13932820-13932842 CGCAGGGACGCCCCGACCCTCGG + Intergenic
952557985 3:34555813-34555835 TCCAGGGACAACCCTACCCATGG + Intergenic
952953768 3:38544068-38544090 GCCAGGGAAGACCCCACCCAAGG + Intergenic
953406243 3:42661219-42661241 TCCAGGAAATTCCCCACTCTGGG - Intronic
955321645 3:57978840-57978862 TCCATGTACTTCCCCACCCTGGG + Intergenic
955860975 3:63329985-63330007 TGCAGGGATGTCCAGACCCTGGG - Intronic
960940066 3:122927750-122927772 ACCAGGGGAGTCCCCACCCCTGG + Intronic
964732625 3:159883422-159883444 TCCAGGACCCTGCCCACCCTGGG - Intronic
966535698 3:181031305-181031327 TCCATGGACTTTCCCACTCTGGG - Intergenic
966834753 3:184040560-184040582 TCCAGGCATGTCCACAACCTGGG + Intergenic
967095719 3:186175601-186175623 TTAAAGGACATCCCCACCCTTGG - Intronic
967271575 3:187737603-187737625 TCCAGGGACTGCCCGCCCCTGGG + Intronic
968266916 3:197369744-197369766 TCCAGGTAGGTCCCTTCCCTGGG + Intergenic
968362076 3:198154242-198154264 TCCAGGGAAGCCTCCAGCCTTGG - Intergenic
968599558 4:1502563-1502585 GCCAGGGGCGTCCCCACCTGGGG + Intergenic
968762793 4:2451125-2451147 CCCAAGGACGGCCCCACCCTGGG + Intronic
968920085 4:3517983-3518005 ACCAGAGACGGCCCCACCCTCGG + Intronic
985421361 4:189788177-189788199 CCCAGGCACGTCCTCAACCTTGG - Intergenic
985494468 5:196717-196739 TCCAGGTGTGTCCCCACCCCAGG + Intergenic
985510885 5:313124-313146 TCCCAGGCTGTCCCCACCCTTGG + Intronic
986139692 5:5018016-5018038 TGCTGGGACCTCCCCATCCTTGG + Intergenic
986634068 5:9802346-9802368 TCCCAGGAAGTCCCAACCCTAGG + Intergenic
986708006 5:10467389-10467411 TCCAGGCACGTCCTTAACCTTGG - Intronic
988354135 5:30151246-30151268 TCCAGCAGCTTCCCCACCCTGGG + Intergenic
994134695 5:96272356-96272378 TCAAGGGAAGTGCCCACCCAGGG + Intergenic
998076647 5:139241944-139241966 GCCTGGGACCTCCCCACCCCTGG + Intronic
998397883 5:141831083-141831105 TCAAGTTACGTGCCCACCCTGGG + Intergenic
1000462384 5:161538587-161538609 TCAAGCGATTTCCCCACCCTTGG - Intronic
1001091837 5:168747561-168747583 TCCAGGGAGGCCCCCTCACTGGG + Intronic
1001760431 5:174203755-174203777 TCCATCGTCTTCCCCACCCTGGG + Intronic
1001950610 5:175814218-175814240 TCCGGGGCAGTCCTCACCCTGGG + Intronic
1002493965 5:179599423-179599445 CCCAGGGATGACCCGACCCTGGG - Intronic
1002923878 6:1593786-1593808 TACAGGAACGTCACCGCCCTCGG - Intergenic
1002975448 6:2070722-2070744 TCCCAGGACGTCCTCACCCATGG + Intronic
1004367960 6:15027935-15027957 CCCAGGCACGTCCTCAACCTTGG - Intergenic
1004611255 6:17242187-17242209 TCCAGGGTATTCTCCACCCTTGG + Intergenic
1009059306 6:58378413-58378435 TGCAGGGACTTCAGCACCCTGGG + Intergenic
1009267179 6:61569845-61569867 TCCTGGGAAGTCCCATCCCTAGG + Intergenic
1016635202 6:146280860-146280882 TCAAGGGAAGTCTCCAGCCTTGG + Intronic
1018654331 6:166019417-166019439 TCCAGGGAAAACCCCAGCCTCGG + Intergenic
1019253604 7:34465-34487 TCCAGGGAAGCCTCCAGCCTTGG + Intergenic
1019543073 7:1560170-1560192 CCTTGGGACGGCCCCACCCTGGG - Intronic
1020256936 7:6507825-6507847 CCCAAGAACGTCCCCACGCTTGG - Intronic
1021847642 7:24778496-24778518 ACCAGGGACCTCCTCAGCCTTGG - Intergenic
1023760623 7:43462249-43462271 TCCAGGAAAGTCTCCAGCCTAGG + Intronic
1029655732 7:101923178-101923200 TCCAGGGAGGACCCCACGCTGGG - Intronic
1030305915 7:108018786-108018808 GCAGGGGACATCCCCACCCTTGG - Intergenic
1031424103 7:121584912-121584934 TGCAGTCATGTCCCCACCCTTGG - Intergenic
1032388443 7:131540385-131540407 CCCAGGGAAGGCCCCACCCCAGG + Intronic
1033344801 7:140518555-140518577 TCCAGGGAAGAGCCCAGCCTCGG + Exonic
1040875060 8:52142133-52142155 TCCAGGGACCTCCCTTCCCTCGG - Intronic
1042526100 8:69766451-69766473 TCCAGGCACATCTCCACCTTAGG + Intronic
1043540597 8:81258006-81258028 TCCAGGCATGTTCCTACCCTTGG - Intergenic
1049526778 8:143130877-143130899 TCCTGGGCATTCCCCACCCTGGG - Intergenic
1054823528 9:69547902-69547924 TCCAAAGATGTCCACACCCTGGG + Intronic
1055182275 9:73402507-73402529 GCCAGGGCCGGCCCCACCCAAGG - Intergenic
1056595787 9:88006848-88006870 TCCAGGGACTGGGCCACCCTGGG - Intergenic
1057342357 9:94214263-94214285 CCAAGGCACGCCCCCACCCTCGG + Intergenic
1060192665 9:121603025-121603047 TCCAGGGTCCTCACCACTCTGGG - Intronic
1060207589 9:121691309-121691331 TCCCCGGATGTCCCCACACTAGG - Intronic
1062137895 9:134939281-134939303 GCCAGGCACGTCCCCCTCCTGGG + Intergenic
1062746763 9:138217904-138217926 TCCAGGGAAGCCTCCAGCCTTGG - Intergenic
1190296131 X:49029074-49029096 TCCTGGGACCTCCCCAGCCCAGG - Exonic
1195100506 X:101550811-101550833 TCCAGGGGCGACCCCAGACTCGG + Intronic
1197708881 X:129652532-129652554 TCCAGGGACATGCCCTTCCTTGG + Intronic