ID: 948133599

View in Genome Browser
Species Human (GRCh38)
Location 2:235619683-235619705
Sequence TGGGCTGGCTGCACTAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948133586_948133599 11 Left 948133586 2:235619649-235619671 CCCCATGTCCACCCCTTTAATTT 0: 1
1: 0
2: 1
3: 15
4: 210
Right 948133599 2:235619683-235619705 TGGGCTGGCTGCACTAGAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 152
948133591_948133599 -1 Left 948133591 2:235619661-235619683 CCCTTTAATTTCATGAGCATCCT 0: 1
1: 0
2: 0
3: 23
4: 285
Right 948133599 2:235619683-235619705 TGGGCTGGCTGCACTAGAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 152
948133590_948133599 0 Left 948133590 2:235619660-235619682 CCCCTTTAATTTCATGAGCATCC 0: 1
1: 0
2: 0
3: 15
4: 186
Right 948133599 2:235619683-235619705 TGGGCTGGCTGCACTAGAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 152
948133588_948133599 9 Left 948133588 2:235619651-235619673 CCATGTCCACCCCTTTAATTTCA 0: 1
1: 0
2: 3
3: 48
4: 347
Right 948133599 2:235619683-235619705 TGGGCTGGCTGCACTAGAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 152
948133589_948133599 3 Left 948133589 2:235619657-235619679 CCACCCCTTTAATTTCATGAGCA 0: 1
1: 0
2: 1
3: 31
4: 164
Right 948133599 2:235619683-235619705 TGGGCTGGCTGCACTAGAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 152
948133587_948133599 10 Left 948133587 2:235619650-235619672 CCCATGTCCACCCCTTTAATTTC 0: 1
1: 0
2: 1
3: 22
4: 351
Right 948133599 2:235619683-235619705 TGGGCTGGCTGCACTAGAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 152
948133592_948133599 -2 Left 948133592 2:235619662-235619684 CCTTTAATTTCATGAGCATCCTG 0: 1
1: 0
2: 1
3: 11
4: 153
Right 948133599 2:235619683-235619705 TGGGCTGGCTGCACTAGAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948133599 Original CRISPR TGGGCTGGCTGCACTAGAAG GGG Intronic
902956559 1:19928503-19928525 TGGGCCGGCTGCACCAAAATCGG + Intergenic
902988635 1:20171047-20171069 TGGGCTGGCTGCACTCGCCAGGG - Intronic
903309661 1:22444699-22444721 TGGGCTGTCTGCATGAGCAGTGG - Intergenic
903545732 1:24122278-24122300 TGGCCTTGCTGCTCTAGCAGAGG + Intronic
905281272 1:36850835-36850857 TGGGGTGGCAGCACAAGGAGGGG + Intronic
906284275 1:44576497-44576519 TAGGCTGGGGGCACTAGAATTGG - Intronic
908495194 1:64687999-64688021 TGGGCTGGCAGGACTGGAGGTGG + Intronic
915037726 1:152942773-152942795 TAGGATGGCAGCAATAGAAGTGG - Intergenic
916013273 1:160725891-160725913 TGGGCTGTCTGCACACGCAGTGG - Intergenic
918038107 1:180895097-180895119 TGGGCTGGATGAGCAAGAAGTGG + Intergenic
920497669 1:206467072-206467094 TGGGCAGGATGCAGTAGAACGGG + Intergenic
920540442 1:206774067-206774089 TGAGCTTGCTGCACTAGAGAAGG + Intergenic
922219959 1:223550861-223550883 TGGGCTGGCAGCACCACAGGTGG - Intronic
1064194521 10:13234327-13234349 TGGGCTGCCTGCCTCAGAAGTGG - Exonic
1067804206 10:49381987-49382009 TGGGATGTCTGGACTAGAAGGGG + Intronic
1072070247 10:91908607-91908629 TGGGAGGGCTGCGCAAGAAGCGG - Exonic
1075183096 10:120229693-120229715 TGAGCTGGCTGCTCAAGAAAGGG - Intergenic
1076816892 10:132919512-132919534 TGGGCTGGCTGCCTGAGAAAAGG + Intronic
1077933037 11:6753496-6753518 TGGGGTGGCTGCACTAAAACAGG - Intergenic
1078528935 11:12121523-12121545 AGGGCAGGATGCACTTGAAGGGG - Intronic
1080691981 11:34565926-34565948 TGGGCTGGCTGGCCCAGTAGAGG + Intergenic
1080701414 11:34647579-34647601 TGGCCTGTCTGCACTGGAAAAGG + Intronic
1083159190 11:60844163-60844185 TGGGCTTGCTGAGCTAGAGGGGG + Intronic
1085430746 11:76445522-76445544 TGGGCTGGCTGCTCTTGTTGTGG + Intronic
1085462468 11:76702346-76702368 TGGGCTGGCTGGACAGGAATGGG - Intergenic
1088709859 11:112498521-112498543 GGGGCTGGCTGTACTAGTGGGGG + Intergenic
1089890153 11:121872714-121872736 GGAGCAGGCTGCACTTGAAGTGG + Intergenic
1096480567 12:51938032-51938054 TGCACTGGCTGCAATAGCAGTGG + Intergenic
1097920650 12:65068845-65068867 TGGGGTGGCAGCATTTGAAGTGG - Exonic
1097935970 12:65251405-65251427 AGGGCTGACTGCACTAGAGGAGG + Intergenic
1101862598 12:108495169-108495191 TGGGCTGGGTGCTCTAGAAGTGG + Intergenic
1104581849 12:130016489-130016511 TGGGTTGGCTGCACTTGAGCTGG - Intergenic
1104607345 12:130199747-130199769 TGGCCAGGCTGCACTGGGAGTGG + Intergenic
1112801388 13:103113510-103113532 GGTGGTGGCTGCACTAAAAGAGG + Intergenic
1117424712 14:55581212-55581234 GGCGCTGGGTGCACTAGATGTGG + Intronic
1117848050 14:59934690-59934712 TAAGCTGGCAGAACTAGAAGGGG - Intronic
1118921509 14:70153552-70153574 TGTGCTAGCTGCTATAGAAGGGG - Intronic
1119612651 14:76076666-76076688 GGGGCTGGCTTCATTGGAAGAGG + Exonic
1126133580 15:45368399-45368421 TGGCCAGGCTGCTCTTGAAGAGG - Intronic
1126462891 15:48932118-48932140 TGTGCTGGCTGCACTGGGAAAGG - Intronic
1126542633 15:49839658-49839680 TAGGCAGGCAGCATTAGAAGGGG + Intergenic
1127787172 15:62365823-62365845 TTGGGTGGCTTCACTAGTAGTGG - Intergenic
1128576927 15:68782743-68782765 TGGGGAGGCTGGATTAGAAGAGG - Intronic
1129373731 15:75114508-75114530 TGGGCTGGCAGCACTTGATGGGG - Intronic
1129451775 15:75655147-75655169 TGGGCTCCCTGCAGCAGAAGTGG + Intronic
1129662022 15:77558184-77558206 TGGCCTGGCTGGAATAGAGGGGG + Intergenic
1130977168 15:88785489-88785511 TGGTCTGGCTGATCTAGCAGGGG + Intergenic
1132242569 15:100269890-100269912 TGGGCTGGCTGAAGTAGAAAAGG - Intronic
1132595322 16:746481-746503 TGGGCGGGCTGCAGGAGAGGAGG + Intronic
1132595334 16:746525-746547 TGGGCGGGCTGCAGGAGAGGAGG + Intronic
1132992033 16:2800607-2800629 GGAGCTGGCTGGACTAGAAGTGG + Intergenic
1135236575 16:20761946-20761968 TGGGCTGTCTGCACGTGCAGTGG - Intronic
1137270651 16:46900494-46900516 TGGGCTCTCTGCAGCAGAAGGGG - Intronic
1139352935 16:66348587-66348609 GGAGCTGGCTGCGCAAGAAGTGG + Intergenic
1141635346 16:85311373-85311395 TGGGCTGTCTGCACCAGAGCTGG - Intergenic
1145104505 17:20103896-20103918 TGAGCTGGCTGGAGGAGAAGGGG + Intronic
1145926991 17:28655361-28655383 TGGGCTGGCCACACTTGATGGGG + Exonic
1148552376 17:48558221-48558243 CGGGCCGGCTGCAGGAGAAGCGG + Intronic
1149065939 17:52479314-52479336 AGGGCTGGCTTCATTGGAAGGGG + Intergenic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1151383265 17:73739994-73740016 TGTGTTGGTTGCACTGGAAGGGG - Intergenic
1152349250 17:79774647-79774669 TGGGCAGGCTGTTCTGGAAGTGG - Intergenic
1155021059 18:21897223-21897245 CGGGCTGTCTGGACAAGAAGTGG + Intergenic
1156626244 18:38912767-38912789 TGGGCTGACTATACTAGAAAAGG - Intergenic
1162110803 19:8398631-8398653 TGGGTTTGCTGCACCAGGAGAGG + Intronic
1162742618 19:12782309-12782331 GAGGCTGGCTGGACTAGAATGGG + Intronic
1162959500 19:14117650-14117672 CGGGCTGGCTGCGCTAGCTGCGG + Exonic
1163467874 19:17479423-17479445 TGGGCAGCCTGCACAAGAATGGG - Intronic
1165601489 19:37058581-37058603 TGGGATGCCTGCTCTAGGAGCGG - Intronic
1165818978 19:38662440-38662462 TGGGCTGGCTGCACCATCACAGG - Intronic
1166053224 19:40273623-40273645 TGGGCAGGCTGCAAAAGAAACGG + Intronic
1166372961 19:42312679-42312701 GGGGATGGCTGCAATAGAGGTGG + Intergenic
924987816 2:287885-287907 TGGGCTCGCTGCGAGAGAAGGGG + Exonic
929920190 2:46166222-46166244 TGGGCTGGCTTCAGGGGAAGGGG - Intronic
930097908 2:47580916-47580938 TGGGCCGGCTGGCCTTGAAGTGG + Intergenic
930745448 2:54878266-54878288 TGGACTGGCAGAACTGGAAGAGG + Intronic
931615654 2:64153982-64154004 TGAGCTGGTAACACTAGAAGGGG - Intergenic
932087561 2:68775308-68775330 TGGGCTGGCTGAAGAAGCAGAGG + Exonic
934544018 2:95199743-95199765 GGGGCTGGCTTCCCTAGGAGTGG - Intergenic
936765913 2:115848427-115848449 TGGGCTGTCTGCACACGCAGTGG - Intergenic
936983732 2:118288540-118288562 TGGGCTGGCTGCAAGACAATAGG + Intergenic
939077210 2:137618112-137618134 ATGGCTGGCTGGAGTAGAAGAGG - Intronic
943305557 2:186257324-186257346 TTGGCTGCCTGTACTAGGAGAGG - Intergenic
944041690 2:195362902-195362924 TGGGCTGGCAGTACTAGCAGTGG - Intergenic
946462134 2:219878030-219878052 TGGGTGGGCTGCACCAGGAGAGG + Intergenic
948133599 2:235619683-235619705 TGGGCTGGCTGCACTAGAAGGGG + Intronic
948659483 2:239498308-239498330 TGGGCTGGCTGCAGAAGACTCGG - Intergenic
1171024710 20:21619262-21619284 TGGCTTGGCTGCTCTGGAAGAGG - Intergenic
1171463941 20:25314842-25314864 TGGGCAGGCCTCACTCGAAGAGG - Intronic
1172010457 20:31843172-31843194 AGGGCTGCCTGCCCAAGAAGGGG + Intergenic
1172393308 20:34581427-34581449 TATGCTGGCAGCACTAGGAGGGG - Intronic
1173132555 20:40408353-40408375 TGGACTGGCTGCAGAAGAAATGG - Intergenic
1175038297 20:56021125-56021147 TGTGCTGAGTGCAGTAGAAGAGG - Intergenic
1176182391 20:63756789-63756811 TGGGCTTTCTTCACTAGATGTGG + Intronic
1180941995 22:19665730-19665752 TGGGCTGGCTGAACTTGGGGAGG + Intergenic
1181264470 22:21622757-21622779 TGGGCTGGCTGCTCTGGAGGAGG - Exonic
1181335366 22:22124729-22124751 TGGGTTGGGTGCACTATCAGGGG + Intergenic
1182782601 22:32880259-32880281 TGGGCTGGGTTCCCTAGAAGTGG + Intronic
1184770161 22:46592209-46592231 TGGGCTGGTGGCAGTAGCAGTGG - Intronic
950372890 3:12546013-12546035 TGGCCAGGCTGGACTTGAAGAGG + Intronic
951801502 3:26601706-26601728 AGGCCTGGCTTCCCTAGAAGTGG - Intergenic
952160167 3:30685418-30685440 TGGGCCAGCTTTACTAGAAGTGG + Intronic
952901400 3:38114252-38114274 TGGGCTGGCTGGACAAGTGGAGG + Intronic
954226842 3:49187412-49187434 TGGGCAGTCTGCACTAAGAGAGG + Intronic
954706906 3:52485729-52485751 GGGGCTGGCTGCAGTAGGTGGGG + Intronic
955045125 3:55352366-55352388 TGGGCTAGCATGACTAGAAGGGG + Intergenic
955343560 3:58144024-58144046 TGGGCTGGCTTCCCTTGTAGAGG - Intronic
957012729 3:75027037-75027059 TGGGGTGGCTTTACAAGAAGAGG - Intergenic
959555547 3:107713026-107713048 TGGGCAGGCTGAATTTGAAGTGG - Intronic
962648800 3:137467101-137467123 TGGGCTGGGTGCCCTAGGACAGG + Intergenic
968688472 4:1977077-1977099 TGGCCTGGCTGCACTACAGTGGG + Intronic
971207439 4:24584184-24584206 TGGGCTGGGTTCACTAGCGGCGG - Intronic
973573654 4:52264840-52264862 TGGGCTGTCTGCATGAGCAGTGG + Intergenic
981525681 4:145705040-145705062 TGGGCTGTCTGCACTTGCAGTGG + Intronic
987552592 5:19403293-19403315 TGGGCTGTCTGCACGGGCAGTGG + Intergenic
988002267 5:25363377-25363399 TGCACTGGCTGCACTAGTATAGG - Intergenic
993976734 5:94492118-94492140 TGGGATGGCGACACCAGAAGTGG - Intronic
997304685 5:132828951-132828973 GGGGCTGGCTGGACTGCAAGAGG - Intronic
998897429 5:146814734-146814756 TGGGCTGTCTGCATGAGCAGTGG - Intronic
1000407146 5:160900103-160900125 TGGGATGGCTGCACAGGAAGTGG - Intergenic
1001910743 5:175515355-175515377 TGGACTGGCTGAACTCTAAGAGG - Intronic
1006505208 6:34484894-34484916 TGGGCTGGCTGTTCTGGATGGGG + Intronic
1006993222 6:38233493-38233515 TGTGCTGGATGCAGTAGAATGGG - Intronic
1007471556 6:42094039-42094061 TGGGCTGCCTGCACTTGCAATGG + Intergenic
1013369854 6:109459302-109459324 TGGGCTTTCTCCACTGGAAGTGG - Intergenic
1019613431 7:1948202-1948224 TGGCCAGGCTTCACCAGAAGTGG + Intronic
1020034467 7:4956632-4956654 TGCGCTGGCTGCTCTGGAATTGG - Intronic
1020280932 7:6649662-6649684 TGAGCGGGCTGCACTCTAAGGGG - Intronic
1020474716 7:8581924-8581946 TGGGCTGGTAGCACAAGCAGAGG - Intronic
1029517230 7:101032690-101032712 TGAGCTGGCTTCACTAGCAGTGG - Exonic
1029517249 7:101032867-101032889 TGAACTGGCTTCAGTAGAAGTGG - Exonic
1029517269 7:101033044-101033066 TGAACTGGCTTCACTAGAAGTGG - Exonic
1029517288 7:101033221-101033243 TGAACTAGCTTCACTAGAAGTGG - Exonic
1029517424 7:101034460-101034482 TGAACTGGCTTCAGTAGAAGTGG - Exonic
1029517465 7:101034814-101034836 TGAACTGGCTTCAGTAGAAGTGG - Exonic
1029517490 7:101034991-101035013 TGAACTGGCTTCAGTAGAAGTGG - Exonic
1029517628 7:101036230-101036252 TGAACTGGCTTCAGTAGAAGCGG - Exonic
1029517903 7:101038702-101038724 TGAACTGGCTTCAGTAGAAGTGG - Exonic
1029517928 7:101038879-101038901 TGAACTGGCTTCAGTAGAAGTGG - Exonic
1029518174 7:101041177-101041199 TGAACTGGCTTCAGTAGAAGTGG - Exonic
1029518238 7:101041708-101041730 TGAACTGGCTTCAGTAGAAGTGG - Exonic
1030852616 7:114509468-114509490 TAGGCTGGATGCAGTAGAAGTGG + Intronic
1032796233 7:135278393-135278415 TGGGCTGTCTGCTCTAAAGGAGG + Intergenic
1033570424 7:142622984-142623006 TGGGATGGCTGCAGTAGCTGTGG + Intergenic
1033890801 7:146010929-146010951 TGGGCAGGCAGCTCTAGAAGTGG - Intergenic
1034029630 7:147746357-147746379 TGGACTGTCTCTACTAGAAGGGG - Intronic
1038945213 8:32351644-32351666 TGGCCTGGGTGGACTAGGAGTGG - Intronic
1039556676 8:38481385-38481407 TGGGCTGGCAGAACTGGAACCGG - Intergenic
1039867460 8:41517869-41517891 TGGGCTGCCAGCAGTAGCAGTGG - Intergenic
1040351804 8:46576444-46576466 TGGGCTGACTGCCCTAGCAAAGG - Intergenic
1045215532 8:100145506-100145528 TGGGCTGGCGTCACCAGGAGCGG + Intronic
1049420710 8:142515323-142515345 TGGGCAGGCCTCACTAGGAGGGG - Intronic
1049566353 8:143341138-143341160 TGGGGCGGCAGCACGAGAAGAGG - Intronic
1049613890 8:143568041-143568063 TGGTTTGGCTGCAGTAGAAACGG + Intronic
1049708210 8:144052386-144052408 TGGGCAGGCTGGAGTAGGAGCGG - Intronic
1050124399 9:2341794-2341816 TGGACTGGATGAACTAGAAGTGG + Intergenic
1051034733 9:12730580-12730602 TTTGCTGGGGGCACTAGAAGAGG - Intergenic
1051211712 9:14751845-14751867 TTGGCTGGCTGCACTTAGAGGGG + Intronic
1051451812 9:17205588-17205610 TCAGCTGGCTGAACTAGTAGTGG + Intronic
1055563282 9:77543149-77543171 TGGCCTGGCAGCAGCAGAAGTGG + Intronic
1055876884 9:80953951-80953973 TGGGGTGGCTGCACTCTGAGTGG - Intergenic
1056489232 9:87088439-87088461 TGGGCTGGCTGCACTTGGCTGGG - Intergenic
1056792579 9:89635650-89635672 TGGGCTGGCTGCTGTTCAAGTGG - Intergenic
1058910807 9:109518372-109518394 TGGTGTGGCTGCACTGGAGGTGG + Intergenic
1061568161 9:131458070-131458092 AGGGGTGGCTGGACAAGAAGGGG - Intronic
1062503197 9:136859976-136859998 GGCGCTGGCTGCAGAAGAAGGGG + Exonic
1062510612 9:136903397-136903419 TAGGCTGGCTGCACGAGCAGCGG + Intronic
1190739695 X:53280858-53280880 GGGGCTGGCTGACCTGGAAGGGG - Intronic
1192690154 X:73354075-73354097 TGGGCTGGTTGCATCAGGAGGGG + Intergenic
1195667749 X:107445853-107445875 TGGGCGGGCTGCCCCAGCAGAGG + Intergenic
1200176048 X:154116995-154117017 GGGGCTGGCAGCACTGAAAGTGG + Intergenic