ID: 948136283

View in Genome Browser
Species Human (GRCh38)
Location 2:235638792-235638814
Sequence CCCAGGCGGAGGGCTGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948136275_948136283 -5 Left 948136275 2:235638774-235638796 CCAGGAAGCTGGTTACAACCCAG 0: 1
1: 1
2: 0
3: 16
4: 148
Right 948136283 2:235638792-235638814 CCCAGGCGGAGGGCTGGCGTGGG 0: 1
1: 0
2: 0
3: 21
4: 248
948136272_948136283 14 Left 948136272 2:235638755-235638777 CCGGAGGAGGAGGGAGCAGCCAG 0: 1
1: 0
2: 5
3: 55
4: 674
Right 948136283 2:235638792-235638814 CCCAGGCGGAGGGCTGGCGTGGG 0: 1
1: 0
2: 0
3: 21
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948136283 Original CRISPR CCCAGGCGGAGGGCTGGCGT GGG Intronic