ID: 948136283

View in Genome Browser
Species Human (GRCh38)
Location 2:235638792-235638814
Sequence CCCAGGCGGAGGGCTGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948136275_948136283 -5 Left 948136275 2:235638774-235638796 CCAGGAAGCTGGTTACAACCCAG 0: 1
1: 1
2: 0
3: 16
4: 148
Right 948136283 2:235638792-235638814 CCCAGGCGGAGGGCTGGCGTGGG 0: 1
1: 0
2: 0
3: 21
4: 248
948136272_948136283 14 Left 948136272 2:235638755-235638777 CCGGAGGAGGAGGGAGCAGCCAG 0: 1
1: 0
2: 5
3: 55
4: 674
Right 948136283 2:235638792-235638814 CCCAGGCGGAGGGCTGGCGTGGG 0: 1
1: 0
2: 0
3: 21
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948136283 Original CRISPR CCCAGGCGGAGGGCTGGCGT GGG Intronic
900222416 1:1516280-1516302 CCGAGAGGGAGGGCTGGTGTTGG + Intronic
900690425 1:3977450-3977472 CACAGTGGGAGGGCTGGCGCTGG + Intergenic
901064456 1:6488345-6488367 CTCAGGCACAGGGCAGGCGTGGG + Intronic
902226222 1:14998072-14998094 CCCAGGAGCAGGGCAGGCCTCGG + Intronic
902733315 1:18383940-18383962 CCAGGGAGGAGGGCTGGCGCTGG + Intergenic
904046654 1:27613187-27613209 GCCAGGGGTAGGGCTGGGGTGGG - Intronic
904748980 1:32729091-32729113 CCCAGGCTGGGGGGTGGGGTGGG + Intergenic
905390724 1:37634147-37634169 CCCAGGCTGCGGACTGGGGTGGG + Intronic
905871175 1:41405369-41405391 CCCAGGGAGAGGGCTGGGGCTGG + Intergenic
906539167 1:46571971-46571993 GCCAGGCAGAGGGCTGGTGCAGG - Intronic
908727960 1:67197132-67197154 CCCAGGTGGAAGGCTGGAGGGGG + Intronic
909239877 1:73199072-73199094 CCCAGGGAGAAGGCTGGAGTTGG - Intergenic
909623013 1:77687179-77687201 CCCAGACGGTGGGGTGGCGGGGG - Intergenic
910935686 1:92483651-92483673 CCCAGGCGGAGGGAGAGCGCGGG + Intronic
912385032 1:109267212-109267234 CCCAGGATGGGGGCTGGCGCTGG + Intronic
912431350 1:109630051-109630073 CCCAGGCTGAAGGCTGGGGTGGG - Intronic
912879270 1:113391486-113391508 ACGAGGGGGAGGGGTGGCGTTGG + Intronic
915227436 1:154421340-154421362 CCCAGGCGGTGGGATGGGGTTGG - Intronic
917141645 1:171841501-171841523 GCCAAGCGGCGGGCTGGCGGCGG + Exonic
920146037 1:203861772-203861794 CGCAGGCTGAGGGCAGGCCTGGG + Intronic
920511750 1:206557085-206557107 CCCAGGCGGCGGGGAGGCGGGGG + Intronic
922180290 1:223227991-223228013 CCCAGGCGCAGGCCTGGCACAGG + Intronic
922726308 1:227924586-227924608 CCCAGGCGCAGGGCTGGCTGGGG + Intronic
923470045 1:234282392-234282414 CCCAGGCCAAGGGCAGGGGTGGG - Intronic
923629777 1:235642279-235642301 TCGAGGCGGAGGGCTGGCCTTGG - Intronic
924439208 1:244072647-244072669 CCCAGGAGCAGCGCTGGCCTTGG + Intergenic
1066535209 10:36383722-36383744 CCCAGGCAGAGGACTGTTGTAGG + Intergenic
1067091156 10:43266510-43266532 CGCACGCGGCGGGCGGGCGTGGG - Intronic
1069546116 10:69330074-69330096 CCCAGGCAGAGGCCAGGAGTGGG - Intronic
1069997876 10:72354197-72354219 CCGAGGCGGCGGACTGGGGTGGG + Intronic
1070409586 10:76127361-76127383 CGCAGGAAGATGGCTGGCGTGGG - Intronic
1071505161 10:86227659-86227681 TCCAGGCAGAGGGCTGGCATGGG - Intronic
1072549906 10:96469531-96469553 CCCAGGCGGGAGGCTGGTGGTGG - Intronic
1074977653 10:118594563-118594585 CCCAGGCGTAGAGCTGGCGCTGG + Exonic
1075313739 10:121435555-121435577 GTGAGGCGGAGGGCTGGGGTAGG - Intergenic
1076133474 10:128029160-128029182 CCCAGGCGGAAGGCTCGTGGGGG + Intronic
1076406729 10:130217155-130217177 CCCAGGAGAAGAGCTGGCGCCGG - Intergenic
1076464446 10:130668920-130668942 GCCAGGAGGAGGGTTTGCGTGGG - Intergenic
1076856358 10:133117265-133117287 CCCAGGCAGTGGGCAGGGGTGGG - Intronic
1077178426 11:1201059-1201081 CGCAGGCTGAGGGCTGAGGTAGG - Intronic
1078489580 11:11756827-11756849 CTCTGGCGGAGGGCTGTCTTGGG - Intergenic
1079081025 11:17413879-17413901 CCCAGGCTAAGGGCTGGCTGGGG - Intronic
1081131120 11:39381532-39381554 CACTGGCGGAGGGCAGCCGTGGG - Intergenic
1081631455 11:44692688-44692710 CCCAGGGAGAGGCCTGGGGTGGG + Intergenic
1083266341 11:61548572-61548594 CCCAGGAAGAGCGCTGGGGTGGG + Intronic
1083621836 11:64053151-64053173 CCCAGACGGAGAGCTGGGGCTGG + Intronic
1083886871 11:65577264-65577286 CCCAGGGGAAGGGCTGGGGCAGG + Intronic
1083937898 11:65879963-65879985 CCCAGGCGTGGGACTGGCATAGG - Intronic
1084940568 11:72610521-72610543 CCCAGGAGGAGGGCAGTAGTGGG + Intronic
1085417342 11:76328130-76328152 GCCAGGCGGAGGGAGGGGGTTGG + Intergenic
1085982769 11:81744599-81744621 CCACGGGGGAGGGCGGGCGTGGG + Intergenic
1089644873 11:119872326-119872348 CCAAGGCGGAGGGCATGGGTGGG + Intergenic
1091118693 11:133039131-133039153 CACAGGCGGAGGGTTGGCAGGGG + Intronic
1092407514 12:8231220-8231242 CACAGGCTGTGGGCTGGCTTTGG + Intergenic
1094497510 12:30997760-30997782 CCCAGACAGAGGGCTGGGGGTGG + Intergenic
1097018440 12:56003664-56003686 CCCAGTCTCAGGGCTGGTGTGGG - Exonic
1099667351 12:85649376-85649398 CCCGGGCGGAGGGCGGGGGCGGG - Intergenic
1100337151 12:93641995-93642017 CCCAAGCTGAGGGCTGGGTTGGG + Intergenic
1100587445 12:95993246-95993268 GCCAGGTGGAGGGATGGGGTTGG - Intronic
1101341091 12:103841872-103841894 CCTAGGCGGGGGGCGGGCATTGG - Intronic
1102490882 12:113288886-113288908 CCCGGGCAGAGGGCTGGCCAGGG + Intronic
1103596899 12:122029715-122029737 CCCAGAAGCAGGGCTGGGGTTGG - Intronic
1103896961 12:124279415-124279437 CCCAGGAGCAGGGCTGGGGCTGG + Intronic
1103967036 12:124646508-124646530 CACAGGCGGGCGGCTGGGGTGGG - Intergenic
1103991090 12:124800030-124800052 CCCAGGCAGAGAGCTGCTGTGGG - Intronic
1107045540 13:35988384-35988406 CACAGGGGGAGGGCTGGCACCGG - Intronic
1111397019 13:87677347-87677369 CGCAGGCGGAGGGGCGTCGTCGG + Exonic
1113967701 13:114163775-114163797 CCCAGGCCGAGGGCAGGGGCAGG + Intergenic
1118573710 14:67220200-67220222 CCCAGGCGGGAGGATGGCTTGGG + Intronic
1119481454 14:74960793-74960815 CCCAGTGGGAGGCCTGGGGTGGG + Intergenic
1119717254 14:76867709-76867731 CCCAGGAGGAGGGCAGGCAAGGG + Intronic
1121118401 14:91359585-91359607 CCCAGCCAGAGGCATGGCGTTGG - Intronic
1121119083 14:91364610-91364632 CCAAGGGGGAGGGTTGGGGTGGG + Intronic
1121539009 14:94711227-94711249 GCCAGGCGGAGGGGTGGAGAGGG - Intergenic
1122959604 14:105088345-105088367 CCCGGGCGGAGGGCTGGGGGCGG + Intergenic
1123885053 15:24718452-24718474 CCTAGGGGGAGGGGTGGCCTTGG - Intergenic
1124655021 15:31500571-31500593 CTCTGGCGGAGGGCTGGGGGAGG + Intronic
1124972018 15:34496784-34496806 CCCAGGCCCAGGGCTGGGGCTGG - Intergenic
1126786131 15:52179429-52179451 CCCATGCGGAGGGCAGGGGGTGG - Intronic
1127852548 15:62926507-62926529 CTCAGGCTGAGGGCAGGCATGGG - Intergenic
1128316360 15:66661755-66661777 GACAGCCGGAGAGCTGGCGTGGG + Intronic
1129189225 15:73927718-73927740 CTCGGGCGGCGGGTTGGCGTAGG - Exonic
1129382857 15:75178718-75178740 CACAGGCGGCGGGCGGGCGCGGG - Intergenic
1129458942 15:75690321-75690343 TCCAGGCAGGGGGCCGGCGTGGG - Exonic
1129460316 15:75697122-75697144 TCCAGGCTGAGGGCTGCTGTGGG + Intronic
1129724867 15:77896571-77896593 TCCAGGCAGGGGGCCGGCGTGGG + Intergenic
1129826134 15:78636283-78636305 ACCAGGAGGAGGGCAGGGGTGGG - Intronic
1130862264 15:87901441-87901463 GCCAGGCTGAGTGCTGGGGTAGG + Intronic
1130866856 15:87940577-87940599 ACCAGGAGGAGGGCTGGCTGAGG - Intronic
1131397993 15:92101955-92101977 CCCAGGGAGAGGGATGGCGATGG - Intronic
1132010132 15:98268034-98268056 CCCAGGAGGGGGGCTGGTGATGG + Intergenic
1132665945 16:1081362-1081384 CCCAGGCTGAGGCCAGGCCTGGG + Intergenic
1132681108 16:1142110-1142132 CCGTGGCGCAGGGCTGGGGTTGG - Intergenic
1133933665 16:10252174-10252196 CCCAGGCGGAGCCCACGCGTGGG + Intergenic
1134063780 16:11213835-11213857 CCGAGGAGGTGGGCTGGAGTAGG - Intergenic
1134512629 16:14860551-14860573 CCCAGGCGGCTGGCAGGCGAGGG + Intronic
1134700265 16:16259046-16259068 CCCAGGCGGCTGGCAGGCGAGGG + Intronic
1134971560 16:18535613-18535635 CCCAGGCGGCTGGCAGGCGAGGG - Intronic
1135347817 16:21704380-21704402 CCCAGGTGGAGAGATGGCATAGG + Intronic
1136228855 16:28875611-28875633 CCCAGGCGGGGGGCTAGCCGAGG + Intergenic
1136535541 16:30896925-30896947 CCCAGGGGGAGGACTGGGGTCGG + Intronic
1139261473 16:65598695-65598717 CCCAGGCCTAGGGTTGGGGTGGG + Intergenic
1139332100 16:66201382-66201404 CCCAGACAGAGAGCTGGGGTAGG + Intergenic
1140230408 16:73112950-73112972 CCAAGGCGCAGGGCTGCTGTGGG - Intergenic
1141513019 16:84524918-84524940 CCCAGGCTGAGGGCTGCAGGGGG - Intronic
1142157103 16:88537613-88537635 CCCAGGCGGTGGTCTGGTGGGGG - Intergenic
1142192257 16:88723376-88723398 CCCAGGCGGGAAGCTGGGGTTGG + Intronic
1142645181 17:1307123-1307145 GCCAGGCCGATGGCAGGCGTGGG + Intergenic
1144038273 17:11386699-11386721 CTCAGGCGGGGCGCTGGCCTTGG + Intronic
1144089121 17:11837823-11837845 CCCAGCAGGAAGGTTGGCGTGGG - Intronic
1144829051 17:18121608-18121630 GCCAGGGGGAGGGTGGGCGTTGG - Exonic
1144851557 17:18246543-18246565 GCCAGGCGGAGGGGTGTGGTGGG - Intronic
1144923144 17:18781265-18781287 CCCGGAAGTAGGGCTGGCGTAGG + Exonic
1144949423 17:18985893-18985915 CCCAGGCCCTGGGCTGGGGTAGG - Intronic
1146804876 17:35857086-35857108 ACCAGGCAGAGGGTTGGGGTTGG + Intronic
1147388254 17:40094267-40094289 CCCAGGTGGAAGGATGGCTTTGG + Intronic
1148331326 17:46815540-46815562 GCCAGGCGGGGGGCTGGGTTGGG + Intronic
1148722373 17:49763507-49763529 CCCGTGCGGATGGCTGGCGCTGG - Intronic
1150124479 17:62627617-62627639 CCCGGGCGGAGGGAGGGCGGAGG - Exonic
1151269210 17:72979987-72980009 CCCAGCTGGAGAGCTGGTGTAGG - Intronic
1151491035 17:74432448-74432470 CCCAGGCGGGGGGCGGGCGGGGG - Intronic
1151805959 17:76405476-76405498 CCCAGGCCCGGGGCTGGGGTGGG + Intronic
1151834362 17:76573386-76573408 GCCATGAGGAGGGCTGGCATCGG + Intronic
1152236318 17:79140877-79140899 GCCATGCTGAGGGCTGGGGTTGG + Intronic
1152738069 17:82007191-82007213 CCCAGGTGAAGGGCGGGTGTGGG + Intronic
1152797340 17:82314783-82314805 CCCAGGCGGAGGCTTGGGGAGGG + Intergenic
1156245091 18:35290260-35290282 CGCAGGCGCAGGGCGGGGGTGGG - Intergenic
1156602882 18:38631008-38631030 TCCAGGGAGAGGGCTGGCGGGGG - Intergenic
1157528302 18:48401760-48401782 CCCAGGCGGGAGGGTGGCATGGG - Intronic
1157604518 18:48917497-48917519 CCCAGGAGGAGGCCTGGTCTTGG - Intergenic
1160284715 18:77530914-77530936 CCCTGGAGGAGGCCTGGCCTGGG - Intergenic
1161429434 19:4222882-4222904 CCCAGGAGAGGGGCTGGGGTAGG + Intronic
1161521103 19:4723849-4723871 CCCAGGCGGCGGCCTGGGATTGG + Exonic
1161558665 19:4958410-4958432 CACAGGCAGAGGGCTGGCTGTGG + Intronic
1161951205 19:7469137-7469159 CCCAGGCGAAGGGGTGGGGCCGG - Intronic
1162131290 19:8527549-8527571 CCCAGGCAGAGGGGTGGTGCTGG + Intronic
1163463827 19:17455080-17455102 CCCCGGCGGAGGGTTGGGGGGGG - Intronic
1163768974 19:19179295-19179317 CACAGGCTGAGGGGTGGCCTGGG - Intronic
1164990342 19:32677928-32677950 GCCAGTAGGAGGGCTGGCTTTGG + Exonic
1165120820 19:33557273-33557295 CACAGGGAGGGGGCTGGCGTGGG - Intergenic
1165318530 19:35072330-35072352 CCGAGGGGCAGGGCTGGCGCTGG + Intergenic
1165638583 19:37364587-37364609 TCCAGGCAGAGGGCTGTCGCTGG + Intronic
1166085626 19:40472793-40472815 ACCTGGAGGAGGGCTGGGGTGGG + Intronic
1166543999 19:43623300-43623322 CCCAGGCCTAGGCCTGGGGTGGG + Exonic
1166572650 19:43807787-43807809 CCCAGGGGGAGGTCTGGCACTGG + Intronic
1166706219 19:44909331-44909353 CCCAGGAGGACGGCTGGGGCGGG - Exonic
1167449833 19:49560604-49560626 CACAGGTGCAGGGCTGGGGTGGG - Exonic
924997903 2:380790-380812 CCCAGGGGCTGGGCTGGGGTGGG + Intergenic
925155631 2:1647402-1647424 CCCAGGCCTAGGACTGGGGTAGG - Intronic
925350901 2:3200200-3200222 CCCAAGCGGATGGCTGCCGATGG + Intronic
926089452 2:10041012-10041034 GCCAGGACAAGGGCTGGCGTGGG + Intergenic
926141596 2:10371416-10371438 CCCAGGGGGTGGGGTGGGGTGGG + Intronic
926193027 2:10742514-10742536 CCCAGCAGGAGGGCTGGAATTGG - Intronic
929534404 2:42771613-42771635 GCCAGGCTGGGGGCTGGGGTGGG - Intronic
929592810 2:43158088-43158110 CCCAGGCTGATGCCTAGCGTGGG - Intergenic
931667840 2:64623053-64623075 CCCAGCAGGAGGACAGGCGTGGG - Intergenic
932086980 2:68771300-68771322 ACCAGGCGGAGGGTTGGAGAGGG - Intronic
937912152 2:127080994-127081016 CCTTGGCGGAGGGCTGGGGAGGG - Intronic
942058302 2:172205567-172205589 CCCAGGCAGATGGCTGGCGCAGG + Intergenic
944933639 2:204545571-204545593 CCCAAGCCGGGGGCTGGAGTGGG - Intergenic
947722824 2:232379945-232379967 CCCAGGCCAAGGGCTGGGGCTGG + Intronic
947919244 2:233854902-233854924 CCCAGGCGGAGGGGTGAGGAAGG - Intergenic
948136283 2:235638792-235638814 CCCAGGCGGAGGGCTGGCGTGGG + Intronic
948700559 2:239757209-239757231 CCCATGCAGAGGGCTGGCCAGGG - Intergenic
948990539 2:241551740-241551762 CCCAGGAGGAAGGCTTGCGCTGG + Intergenic
1168997329 20:2143206-2143228 CCCAGGGGCAGGGCTGGACTGGG - Intronic
1169066670 20:2697870-2697892 TCCAGGGGGAGGTCTGGCCTGGG - Intronic
1169126158 20:3128467-3128489 CCCAGGCAGATGGCTGAGGTTGG + Intronic
1171811756 20:29750310-29750332 TCGAGGCGGAGGGGTGGGGTGGG - Intergenic
1172519206 20:35556424-35556446 CCCAGGCAGAGTGCAGGCCTGGG + Intronic
1172967134 20:38844968-38844990 CCCAGGGGGTGGGGTGGGGTGGG - Intronic
1173279786 20:41618133-41618155 GCCTGGCGGAGGGCAGGCGGCGG - Intronic
1174494498 20:50930538-50930560 GCCAGGCAGAGTGCTGGCCTCGG + Intronic
1175361971 20:58419366-58419388 CACAGGGGGAGAGCTGGCATGGG - Intronic
1175764153 20:61581511-61581533 CCCAGGAGGAGGGGTGATGTTGG - Intronic
1175943503 20:62548534-62548556 TCCAGGAGAAGGGCTGGTGTGGG - Intergenic
1176113808 20:63422464-63422486 CCCAGGAGGAGGGCCGGGGCGGG + Intronic
1179460805 21:41533764-41533786 ACCAGGCGGCTGGCTGGCATAGG + Intergenic
1182122550 22:27797227-27797249 CCCAGGCCGAGGGCGGGCGGGGG + Exonic
1183586468 22:38755800-38755822 CCCCGGCGGCGGCCTGGCCTCGG - Exonic
1184247560 22:43243339-43243361 GCCAGGCGCAGGGCTGGCTGGGG + Intronic
1184518054 22:44975246-44975268 CCCAGGCGTGGGGCTGGCTGAGG - Intronic
1184549320 22:45196135-45196157 ACCAGGCCGAGGGCAGGCCTGGG + Exonic
1184639516 22:45861953-45861975 CACAGGTGGAGGGCTGGCCTTGG - Intergenic
1184981277 22:48097412-48097434 CCCTGTCGCAGTGCTGGCGTTGG + Intergenic
1185247396 22:49780457-49780479 CCCAGCAGGAGGCCTGGCGGGGG + Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
954646648 3:52135742-52135764 GCCAGGCTGAGGGCTGAGGTAGG - Intronic
954798161 3:53172017-53172039 CCCAGGAGGAGCGCTGGCTGGGG + Intronic
961568611 3:127782533-127782555 CCCAGGCAGAGTGCTGGCGCGGG + Intronic
963166099 3:142205398-142205420 CACAGGAGGAGGCCTGGAGTTGG - Intronic
963864356 3:150344275-150344297 CCCAGGAAGAGAGCTGGCCTTGG + Intergenic
968509116 4:987582-987604 GCCAGGGCCAGGGCTGGCGTTGG + Intronic
975106316 4:70572351-70572373 CCCAGGGGGAGGGTTGGGGTGGG - Intergenic
975139067 4:70902198-70902220 CGCAGCCGGAGGGCCGGGGTGGG + Intergenic
983560761 4:169099202-169099224 CCCAGCCGGAAGGCTGAGGTAGG - Intronic
985573053 5:660781-660803 CCCAGGATGGGGGCTGGGGTAGG + Exonic
988130033 5:27092116-27092138 CCCAGGGAGAGGGCTGGCTAGGG - Intronic
990728891 5:58786839-58786861 CCTATGCGGGGGGCTGGCGGGGG - Intronic
992473263 5:77077754-77077776 CCCAGGCGGCCGGGAGGCGTCGG + Exonic
994063133 5:95504073-95504095 CCCAGGCGGGGGGTGGGGGTGGG + Intronic
995686306 5:114776284-114776306 CCCAGGCAGAGGTCTGGTGCAGG - Intergenic
997559554 5:134834495-134834517 CACAGGCTGAGGGCTGGTTTGGG - Intronic
997843106 5:137260186-137260208 GCCAGGAGGAGGGCTGAGGTGGG - Intronic
999038763 5:148384018-148384040 AACAGGCGGAGGGTCGGCGTAGG + Exonic
1001524458 5:172418720-172418742 CCCAGATGGACGGCTGGAGTGGG - Intronic
1001926512 5:175640804-175640826 CCCAGGCAGAGGTCTTGGGTTGG + Intergenic
1002296149 5:178232466-178232488 CCCGGGCGGGGGGCGGGCGGCGG - Intronic
1002521234 5:179794207-179794229 CCCAGGTGGAGGGCAGAGGTGGG + Intronic
1006034221 6:31199007-31199029 CCCAGGCGGAGTGCAGTTGTGGG - Intronic
1006638815 6:35478401-35478423 CCCAGGAGGTGGGCTGGTGTGGG - Intronic
1007073312 6:39051517-39051539 CCCAGGCTGGGGGCTGGGGCAGG + Intronic
1007409532 6:41653856-41653878 CCTAGGGGCAGGGCTGGGGTGGG + Exonic
1008368243 6:50707008-50707030 CCCAGACGGAGGCCTGGTCTAGG - Intergenic
1012450689 6:99349945-99349967 CGCAGGCGGAGGGCCGGCCGGGG - Intronic
1013366940 6:109443849-109443871 CCCAGGAGTAGGGCTGGCTGAGG - Exonic
1016400858 6:143678244-143678266 CGCGGGCGCAGGGCTGGCGGCGG + Intronic
1018031403 6:159844719-159844741 CCCAGGCTGAGAGGTGGGGTGGG + Intergenic
1018960288 6:168442435-168442457 CCCAGGAGGACGGCTGGAGCTGG - Intronic
1019733142 7:2638351-2638373 ACGAGGGGGAGGGCGGGCGTGGG + Intronic
1020119786 7:5496522-5496544 TCCAGGCTGAGGTCTGGCCTGGG - Intronic
1020139872 7:5606365-5606387 CCCAGGCCCAGGGCTGGGGCTGG - Exonic
1020270718 7:6593746-6593768 CCGAGGCGGAAGGATGGCTTGGG - Intronic
1024494216 7:50024654-50024676 CCCAGGGGCAGGGCAGGGGTGGG + Intronic
1027217389 7:76192724-76192746 CCCAGGGGCAGGCCTGGCTTTGG + Intergenic
1029924388 7:104300212-104300234 CCCATGGGGAGTGCTGGAGTTGG + Intergenic
1030033526 7:105389118-105389140 CCCGGGCCGCGGGCTGGGGTGGG - Intronic
1031947709 7:127858453-127858475 CCAAGTCTGAGGCCTGGCGTGGG + Intronic
1032459864 7:132102577-132102599 CCCCCGCGGAGGGCGGGGGTAGG - Intergenic
1032551320 7:132787035-132787057 TCCAGGTGGAGGACTGGGGTGGG + Intronic
1032731443 7:134647067-134647089 CCCAGCTTGAGGGCTGGAGTGGG - Intronic
1036688014 8:10924583-10924605 CCCAGGTGGAGGGCAGGCCGGGG + Intronic
1037825794 8:22159911-22159933 CCCTGGGGGAGGGCAGGGGTGGG + Intronic
1037876529 8:22551559-22551581 CCCTACCGCAGGGCTGGCGTCGG - Intronic
1038022426 8:23561685-23561707 CCCAGGCAGAGGGCTGGGGCTGG + Intronic
1038422033 8:27439581-27439603 CCCAGGCTAAGGACTGGCCTGGG + Intronic
1041224513 8:55685237-55685259 CCCATGGGGAGGTCTGGAGTGGG + Intergenic
1042155613 8:65841663-65841685 CCCGAGCGGAGGGCTGGGGTTGG - Exonic
1045299676 8:100900265-100900287 CCCAGGGGAAGGGTTGGCTTTGG + Intergenic
1045305543 8:100953117-100953139 CTCGGGCGGAGGGCTGGAGCTGG + Intronic
1045347363 8:101305071-101305093 TCCAGGCTGAGGGCAGGCCTTGG + Intergenic
1048306137 8:133285963-133285985 CCCAGAATGAGGGGTGGCGTTGG - Intronic
1048755470 8:137733261-137733283 CCCAGGCAGAGGACTGGGGGAGG + Intergenic
1049426298 8:142539465-142539487 CACAGGCGGAGGCGTGGAGTGGG - Intronic
1049605149 8:143525919-143525941 CCCAGGCGGACGGCAGGCTTGGG - Intronic
1049683227 8:143929065-143929087 CACAGGCGAGGGGCTGGGGTCGG - Intronic
1053312336 9:37027619-37027641 AGCAGGCGGAGGGCTAGCGACGG - Intronic
1053354893 9:37437331-37437353 CCAGGGCTGAGGGCTGGGGTGGG - Intergenic
1055641587 9:78323009-78323031 CCCAGGCAGAGTGCTGGGGAAGG - Intronic
1059785510 9:117578550-117578572 CCCAGGCTGAGAGCTGCCATAGG + Intergenic
1061096033 9:128457068-128457090 CCCACGCGGAGGACTGCCGGTGG - Intronic
1061875066 9:133539533-133539555 AGTAGGCGGAGGGCTGGCGTGGG + Intronic
1061912420 9:133732246-133732268 CCCCTGCGGGGGGCTGGGGTGGG - Intronic
1061990872 9:134157846-134157868 CCCAGGCGCAGGGATGGCTCTGG + Intronic
1062142510 9:134967352-134967374 CCCACGCGGGGCGCTGCCGTGGG - Intergenic
1062177213 9:135170392-135170414 CCCTGGAGGAAGGCTGGGGTGGG + Intergenic
1062400714 9:136371500-136371522 GCGAGGCAGAGGGCTGGGGTGGG + Intronic
1062498708 9:136843326-136843348 CCCACGCGGCAGGCTGGCCTGGG - Intronic
1062580178 9:137225923-137225945 CGCGGGCGGAGGGCCAGCGTAGG - Exonic
1189260906 X:39678219-39678241 CCCAGCGGGAGGGCAGGCTTAGG + Intergenic
1189370708 X:40426902-40426924 CCCAGGCTGGAGGCTGGAGTGGG - Intergenic
1190370862 X:49739493-49739515 CCCAGGAGGAAGGCTGGCCTTGG + Intergenic
1194018133 X:88651926-88651948 CCCATGTGGAGGGCTAGAGTGGG - Intergenic
1195369614 X:104159916-104159938 CCCAGGAGGAGCTCTGGAGTAGG - Intergenic
1196997711 X:121402184-121402206 CCCAGGCAGAGAACTGGCCTAGG + Intergenic
1198005502 X:132489420-132489442 CCCTCGCGGAGGCCGGGCGTGGG + Intronic
1200114682 X:153764939-153764961 CCCAGGGGCAGGGCTGGGCTGGG + Intronic
1200218541 X:154379450-154379472 CTCAGGCGGAGGCCTGGCGGCGG - Exonic
1202369937 Y:24189577-24189599 TCCAGGCAGCGGGCTGGCATGGG - Intergenic
1202500847 Y:25480540-25480562 TCCAGGCAGCGGGCTGGCATGGG + Intergenic