ID: 948137787

View in Genome Browser
Species Human (GRCh38)
Location 2:235649705-235649727
Sequence TGTGCTGATGCTGCTTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 932
Summary {0: 1, 1: 1, 2: 22, 3: 188, 4: 720}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948137780_948137787 12 Left 948137780 2:235649670-235649692 CCGAGATTGTGCTTTTCTAGCGC 0: 1
1: 0
2: 1
3: 5
4: 92
Right 948137787 2:235649705-235649727 TGTGCTGATGCTGCTTGTCTGGG 0: 1
1: 1
2: 22
3: 188
4: 720
948137779_948137787 25 Left 948137779 2:235649657-235649679 CCACAGTGGCTGGCCGAGATTGT 0: 1
1: 0
2: 1
3: 49
4: 582
Right 948137787 2:235649705-235649727 TGTGCTGATGCTGCTTGTCTGGG 0: 1
1: 1
2: 22
3: 188
4: 720
948137783_948137787 -10 Left 948137783 2:235649692-235649714 CCTCCCAGGTGGCTGTGCTGATG 0: 1
1: 0
2: 1
3: 32
4: 299
Right 948137787 2:235649705-235649727 TGTGCTGATGCTGCTTGTCTGGG 0: 1
1: 1
2: 22
3: 188
4: 720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948137787 Original CRISPR TGTGCTGATGCTGCTTGTCT GGG Intronic
900435772 1:2629833-2629855 GCTGCTCATGCTGGTTGTCTTGG + Intronic
900831665 1:4969908-4969930 TTTTCTGATGCTGCTACTCTAGG + Intergenic
901245299 1:7725685-7725707 AGTTCTGATGCTTCTGGTCTAGG - Intronic
902211365 1:14907029-14907051 GTTGCTGATGCTGCTGGTCTTGG - Intronic
902271890 1:15310582-15310604 GATGCTGATGCTGCTGGTCCAGG - Intronic
902278272 1:15355271-15355293 GGTCCTGTTCCTGCTTGTCTAGG - Intronic
902293997 1:15453843-15453865 TGTGCTGATGCTGCTGGCCCAGG + Intergenic
902932452 1:19741006-19741028 GGTCCTGGTGCTCCTTGTCTGGG - Intronic
903457080 1:23495029-23495051 AATTCTGATGCTGCTGGTCTGGG + Intergenic
903542413 1:24104413-24104435 TGTGTTGATGTTTCTTTTCTGGG + Intronic
904539182 1:31221328-31221350 GATGCTGATGCTGCTAGTCCAGG - Intronic
904972590 1:34430629-34430651 GGTCCTGATGCACCTTGTCTGGG - Intergenic
904974069 1:34442579-34442601 GATGCTGATGCTGCTGGTCTGGG + Intergenic
904975230 1:34451093-34451115 GATGCTGATGCTGCTGGTCCAGG - Intergenic
905111939 1:35601759-35601781 GCTACTGATGCTGCTGGTCTAGG - Exonic
905214376 1:36396600-36396622 GATGCTGATGCTGCTGGTCAGGG + Intronic
905556408 1:38888687-38888709 GAAGCTGATGCTGCTGGTCTTGG - Intronic
905588479 1:39141377-39141399 GATGCTGATGCTGCTGGTCTGGG + Intronic
905739098 1:40353921-40353943 GACACTGATGCTGCTTGTCTGGG + Intronic
905832969 1:41089080-41089102 AGTGCTGATGCTGCTGGTCTGGG + Intronic
907002854 1:50879693-50879715 GATGCTGATGCTGCTGGTCTAGG - Intronic
907063308 1:51452952-51452974 GATGCTGATGCTGTTTGTCCAGG + Intronic
907376047 1:54041447-54041469 TTTGCTGATGCTGCTGGCCTGGG - Intronic
907824136 1:57999317-57999339 GCTGCTGATGCTGCTGGTCCAGG - Intronic
908070179 1:60451957-60451979 AATGCTGATGCTGCTAGTTTGGG - Intergenic
908743003 1:67348059-67348081 TATGCTGGTGCTGCTGGTTTGGG - Intronic
909068138 1:70961057-70961079 AATGCTGATGCTGCTGATCTGGG + Intronic
909342762 1:74550163-74550185 GATGCTGATGCTGCTTGTCCTGG + Intergenic
909344373 1:74568966-74568988 TGTGCTGATGCTTCTGATCAAGG + Exonic
910216494 1:84849515-84849537 TGTGCTGAGTCTGCCTATCTGGG - Intronic
911181192 1:94862283-94862305 TGTGCTGAGGCTCCTGGACTAGG - Intronic
911213752 1:95169254-95169276 CATGCTGATGCTGCTTATCTGGG + Intronic
911550225 1:99269449-99269471 TGTGATAAGGCTGGTTGTCTGGG + Intronic
912512612 1:110199167-110199189 TGTGCTCCTGCATCTTGTCTGGG + Exonic
912919720 1:113854268-113854290 GATGCTGATGCTTCTTGTCTGGG + Intronic
913047527 1:115087251-115087273 TATGCTGATGCTGCTGGCCCAGG + Intronic
913070294 1:115292472-115292494 GATGCTGATGCTGTTGGTCTGGG + Intronic
913181380 1:116325770-116325792 GATTCTGATGCTGCTGGTCTGGG - Intergenic
913312283 1:117512473-117512495 GATGCTGATGCTGCTGGTCTGGG + Intronic
913373758 1:118129346-118129368 GATACTGATGCTGCTAGTCTGGG - Intronic
913494501 1:119415864-119415886 TGTTCTGAAGCTTTTTGTCTTGG + Intronic
913511239 1:119564521-119564543 TGTTCTGAAGCTTTTTGTCTTGG + Intergenic
913659825 1:120996857-120996879 GGTACTGATGTTGCTTGCCTAGG + Intergenic
914421064 1:147528784-147528806 CTTGCTGATGCTTCTTGTTTGGG + Intergenic
914787151 1:150844524-150844546 GTTGCTGATGCTCCTGGTCTCGG - Intronic
915255229 1:154623485-154623507 TGTGCTGTTTCTGCCTGCCTAGG + Intronic
915431137 1:155868002-155868024 TGTGCTGGTGGTGTGTGTCTCGG + Exonic
915487494 1:156232000-156232022 TAGGCTGATGGTGCTGGTCTGGG - Intronic
916250758 1:162735524-162735546 GATGCTGATGCTGCTGGTCCTGG + Intronic
916488405 1:165279606-165279628 GGGGCTGATGCTGCCTGTCCAGG + Intronic
916888373 1:169092499-169092521 CATGCTGATGCTGCTGGTCTGGG + Intergenic
918104216 1:181402518-181402540 TGTGATGATGCTGCTTGGAGAGG + Intergenic
918209287 1:182336754-182336776 GCTGCTGATGCTTCTTGTCTGGG - Intergenic
918552995 1:185765734-185765756 AATGCTGATGCTGCTAGTCCAGG - Intronic
918594668 1:186279186-186279208 GATGCTGATGCTGCTGGTCCAGG - Intergenic
920123058 1:203673156-203673178 TGAGCTGATGCATCTGGTCTGGG - Intronic
920281856 1:204849533-204849555 TCTGCTGATGCTGCTGGTCCAGG + Intronic
920388447 1:205583972-205583994 TGTGCTGATGCTGCTGTCCAAGG + Exonic
920854384 1:209651395-209651417 TGGGTTGAGGCTGCTGGTCTAGG - Intronic
921118099 1:212113524-212113546 GGTGCTGATGCTGCTGGTCTAGG + Intergenic
921556356 1:216602737-216602759 TGTGAAGATGTTGCTTGGCTAGG - Intronic
922033090 1:221823361-221823383 GATGCTGATGCTGCTGGTCCAGG + Intergenic
923036801 1:230290196-230290218 GATGCTGATGCTGCTGGCCTGGG + Intergenic
923350815 1:233103977-233103999 GATGCTGATGCTGCCAGTCTGGG + Intronic
1063126946 10:3143888-3143910 GGTGCTGATGCTGTTTGGTTTGG - Intronic
1063196015 10:3744478-3744500 TTTCCTGATGCTGCTTGAATGGG - Intergenic
1063352964 10:5373570-5373592 CGGGCTGATGCTGCTGGTCTGGG + Intronic
1063423922 10:5936782-5936804 TGTGCTGAAGCCGCAGGTCTGGG + Intronic
1063547326 10:6993892-6993914 TGGGATGATGGTGCTTATCTGGG - Intergenic
1063921391 10:10936837-10936859 TGTTCTGATTCAGCTGGTCTGGG + Intergenic
1065738610 10:28776174-28776196 GGTGCCAATGCTGCTGGTCTAGG + Intergenic
1066356974 10:34694426-34694448 TGTTCTGATGCTATTTTTCTTGG - Intronic
1067791644 10:49292886-49292908 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1068095605 10:52487440-52487462 GAAGCTGATGCTGCTGGTCTAGG + Intergenic
1068117282 10:52749160-52749182 TGTGGGGATGCTACTTGTCAAGG + Intergenic
1068222326 10:54059684-54059706 GATGCTGATGCTGCTTTTCCAGG + Intronic
1068729303 10:60338431-60338453 GATGCTGATGCTGCTGGCCTAGG + Intronic
1068800893 10:61138574-61138596 GATTCTGATGCTGCTGGTCTTGG + Intergenic
1069191651 10:65498555-65498577 GATGCTGATGCTGCTAATCTAGG + Intergenic
1069287887 10:66739347-66739369 GATGCTGATGCTGCTGCTCTGGG + Intronic
1069860368 10:71467432-71467454 GATGGTGATGCTGCTGGTCTGGG + Intronic
1069879678 10:71583954-71583976 GATGCTGATGCTGCTGCTCTGGG - Intronic
1070390086 10:75962332-75962354 GATGCTGATGCTGCTGGGCTGGG - Intronic
1070489477 10:76963257-76963279 GATGCTGATGCGGCTGGTCTGGG - Intronic
1070742676 10:78913115-78913137 GATGCTGATGCTGCTGGTCCTGG + Intergenic
1070829042 10:79407564-79407586 GGTGCAGCTGCTGCTGGTCTGGG + Intronic
1071509807 10:86254360-86254382 GATGCTGGTGCTGCTGGTCTGGG - Intronic
1072096025 10:92180792-92180814 AATGCTGATGCTGCTGGTCCAGG + Intronic
1072576377 10:96704383-96704405 GATGCTGATGCTGCTGGTCCAGG - Intronic
1072674388 10:97454540-97454562 TGTGGTGATGCCGCTGGGCTTGG + Intronic
1072774212 10:98173294-98173316 TGTGCTCATGTTGCCTGTCCTGG + Intronic
1073038776 10:100584303-100584325 GATGTTGATGCTGTTTGTCTGGG + Intergenic
1073123963 10:101138593-101138615 TGTGCTGATGGTGTATGTGTTGG + Intergenic
1073374302 10:103019560-103019582 TGTGCTAATGCAGATTATCTGGG + Intronic
1073417161 10:103393969-103393991 GATGCTAATGCTGCTGGTCTAGG - Intronic
1073444018 10:103570280-103570302 TGTGCTGCTGAGACTTGTCTTGG + Intronic
1073739948 10:106394879-106394901 AGGGCTGGTGCTGCTGGTCTGGG + Intergenic
1074143300 10:110695996-110696018 GATGCTGATGCTGCTGGTCCAGG - Intronic
1074703451 10:116111720-116111742 AGTGCTGCTGCTGCTGGTCTGGG - Intronic
1074963750 10:118470892-118470914 GATGTTGATGCTGCTGGTCTGGG + Intergenic
1075226788 10:120636806-120636828 GATGCTGATGCTGCTGATCTAGG + Intergenic
1075329256 10:121560932-121560954 GATGCTGATGCTGCTGGTCCAGG + Intronic
1075642545 10:124075255-124075277 TGTGCTGTTCCTGGGTGTCTGGG - Intronic
1075930703 10:126293012-126293034 GATGCTGATGCTGCTGGTCTGGG + Intronic
1075955294 10:126518198-126518220 CGTGTGGATGCTGCTGGTCTGGG - Intronic
1076141875 10:128086007-128086029 AGAGTGGATGCTGCTTGTCTAGG - Intergenic
1076705507 10:132299178-132299200 TGTGCTGCTGGGTCTTGTCTTGG - Intronic
1076705531 10:132299337-132299359 TGTGCTGCTGGGTCTTGTCTTGG - Intronic
1077684212 11:4275761-4275783 AATGCTAATGCTGCTAGTCTGGG + Intergenic
1077685829 11:4291003-4291025 AATGCTAATGCTGCTAGTCTGGG - Intergenic
1077690978 11:4342163-4342185 AATGCTAATGCTGCTAGTCTGGG - Intergenic
1077793604 11:5467703-5467725 TGTGCTTAAGCTTGTTGTCTGGG + Intronic
1077951501 11:6962668-6962690 GATGTTGATGCTGCTGGTCTGGG - Intronic
1078010366 11:7568986-7569008 TGTACTGCTGCTGCTCATCTGGG + Intronic
1079111766 11:17609299-17609321 TGTGCTGATCTTGCTTCTCTGGG - Intronic
1079139039 11:17795434-17795456 TATGCTGAGGCTGCTGGCCTGGG + Intronic
1079366190 11:19812222-19812244 CATGCTAATGCTGCTGGTCTGGG + Intronic
1079374484 11:19879921-19879943 GCTGCTGCTGCTGCTTGTATCGG - Exonic
1079567329 11:21899030-21899052 GGTGCTGATGCTGCTTGCTTAGG + Intergenic
1080544868 11:33306865-33306887 TGTGCTGCTGTTGCTTTTCAGGG + Intronic
1080923260 11:36730336-36730358 AAGGCTGATGCTGCTAGTCTGGG - Intergenic
1081483189 11:43507571-43507593 GATGCTGATGCTGTTGGTCTGGG - Intergenic
1081857588 11:46313358-46313380 GATGCTGATGTTGCCTGTCTGGG - Intronic
1084155081 11:67308714-67308736 TGCGCTGCTGCTTCTCGTCTTGG - Intronic
1084697042 11:70761925-70761947 GCTGCTGCTGCTGCTGGTCTGGG + Intronic
1085192398 11:74639121-74639143 AATGCTGATGCTGCTGGTCTGGG - Intronic
1085765521 11:79278568-79278590 TCTGCTGATGCTGCTTTGATGGG - Intronic
1085799205 11:79572539-79572561 GATGCTGATGCTGCTGGCCTGGG + Intergenic
1086279092 11:85164917-85164939 GGTGCTGATGCTGCTGGTCTGGG - Intronic
1086279183 11:85166010-85166032 GGCGCTGATGCTGCTGGTCTGGG - Intronic
1086338154 11:85820473-85820495 GATGCTGATGCTGCTTCTATGGG - Intergenic
1086597976 11:88597223-88597245 TCTGATGATGTTGCTTTTCTTGG + Exonic
1086825940 11:91496708-91496730 GTTCCTGATGCTGCTGGTCTGGG - Intergenic
1086974770 11:93119169-93119191 TGTGTTGATGCTGGTTTCCTAGG - Intergenic
1086980084 11:93186946-93186968 GCTGCTGATGTTGCTGGTCTGGG + Intronic
1087275867 11:96159855-96159877 GATACTGATGCTGCTGGTCTGGG + Intronic
1087627917 11:100618132-100618154 AGTACTAATGCTGCTTGTCTGGG - Intergenic
1087760772 11:102102189-102102211 GATGCTGATGCTGCTGGTTTAGG + Intergenic
1087837759 11:102891867-102891889 AAGGCTGATGCTGCTGGTCTGGG - Intergenic
1087866241 11:103229947-103229969 GATGCTGATGCTGCTGGTCTAGG - Intronic
1088169797 11:106982921-106982943 AATGCTGATGCTGCTTGTCCAGG - Intronic
1088574039 11:111252412-111252434 AATGCTGATGCTGCTGGTCCAGG + Intergenic
1089533291 11:119145670-119145692 GATGCTGATGCTGCTAGTCCAGG - Intergenic
1089626449 11:119754159-119754181 GATGCTGATGCTTCTGGTCTCGG - Intergenic
1089635858 11:119811229-119811251 GATGCTGATGCTGCTTGTCCAGG + Intergenic
1089696273 11:120218224-120218246 TGGACAGAGGCTGCTTGTCTTGG - Intronic
1090561760 11:127940069-127940091 ATTGCTGATACTGCTGGTCTGGG + Intergenic
1090886043 11:130877781-130877803 TGTCATGAGGCTGCTTGCCTGGG - Exonic
1091031368 11:132191187-132191209 AGTGCTGTTGCTGGTGGTCTGGG + Intronic
1091340427 11:134808308-134808330 TGATCTGATTCTGCTTGTGTAGG - Intergenic
1091778188 12:3198304-3198326 TGTGCTGATGGTGCTGGTGGTGG - Intronic
1091798318 12:3309653-3309675 TGTGCAGATGCTGCATGCATAGG + Intergenic
1092403474 12:8197830-8197852 TATGCTGCTGCTGCTTCTCTGGG + Intergenic
1092771084 12:11897357-11897379 AGTGCTGATGGTGCTGGTCCAGG + Intergenic
1093115560 12:15206518-15206540 GATGCTGATGCTGCTAGTCTAGG - Intronic
1095792727 12:46185239-46185261 GATGCTGATGCTACTGGTCTAGG + Intronic
1095902912 12:47346951-47346973 GATGTTGATGCTGCTGGTCTGGG + Intergenic
1096862192 12:54537748-54537770 AATCTTGATGCTGCTTGTCTGGG + Intronic
1097100188 12:56582550-56582572 GATGCTGATGCTGCTTGTTCAGG - Intronic
1097301545 12:58024480-58024502 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1097567807 12:61293239-61293261 TATGCTAATGCTGCTAGTCCAGG + Intergenic
1097749594 12:63337283-63337305 TGTGATGCTGCAGCTTGACTGGG + Intergenic
1098440384 12:70511513-70511535 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1099070261 12:78037246-78037268 TCTGCTGATGCTGCTTGGCTTGG - Intronic
1099840482 12:87958621-87958643 TTTGCTGATGCTACTGGTATTGG + Intergenic
1099987577 12:89685503-89685525 GATGCTGATACTGCTAGTCTGGG - Intronic
1101089794 12:101273606-101273628 GGTGCTGATACTGCTGGTCAGGG + Intergenic
1101415604 12:104505498-104505520 TATGTTGACGCTGCCTGTCTGGG + Intronic
1101706719 12:107227406-107227428 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1102178929 12:110896975-110896997 GAAGCTGATGCTGCTTGTCCTGG + Intronic
1102202272 12:111065760-111065782 GATGCTGATGCTGCTGGTCCAGG - Intronic
1102623810 12:114218472-114218494 TGATCTGATGCTACTGGTCTGGG + Intergenic
1102977625 12:117217930-117217952 GGTGCTGATGCTGCTGTTTTGGG + Intronic
1103065003 12:117890108-117890130 GATGCTGATGCTGCTGGTCCAGG + Intronic
1103335687 12:120187809-120187831 GATGCTGATGCTGCCTGTCCAGG + Intronic
1104159431 12:126164170-126164192 TGTACAGGTGCTGTTTGTCTTGG - Intergenic
1104265128 12:127225111-127225133 TTTGCTTATGGTGATTGTCTGGG - Intergenic
1104488105 12:129169214-129169236 GATGCTGATGCAGCTGGTCTGGG + Intronic
1106757803 13:32839974-32839996 TGTGCCAGTGCTGCTGGTCTGGG + Intergenic
1107095495 13:36530824-36530846 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1107583563 13:41818910-41818932 GATACTGATGCTGCTGGTCTGGG - Intronic
1108095111 13:46893403-46893425 GATGCTGATGCTGCTGGTCCAGG + Intronic
1108235802 13:48403755-48403777 GATACTGATGCTGCTGGTCTGGG + Intronic
1108379665 13:49843963-49843985 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1108382686 13:49869233-49869255 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1108575817 13:51789503-51789525 GATGCTGAGGCTGCTGGTCTGGG + Intronic
1108577420 13:51802288-51802310 GATGCTGATGCAGCTTGTCTGGG - Intronic
1108709142 13:53016030-53016052 TTTGCTGGTGCTGCTTCTGTGGG + Intergenic
1108772963 13:53727839-53727861 GATGTTGATGCTGCTGGTCTAGG + Intergenic
1109788925 13:67221937-67221959 GGTACTGATGCTGCTAGTCCAGG - Intronic
1110278975 13:73670667-73670689 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1110416266 13:75256542-75256564 AATGCTGATGCTGCTGGTCCAGG - Intergenic
1110873349 13:80479166-80479188 GATGCTGGTGCTGCTAGTCTAGG - Intergenic
1111380603 13:87445450-87445472 GTTGCTGGTGCTGCTTGCCTGGG + Intergenic
1111934942 13:94548960-94548982 GGTGCTGATGCTGCGGATCTGGG + Intergenic
1111962122 13:94823292-94823314 TGTGCTTATGGTGCTGGTCTGGG - Intergenic
1112353474 13:98655525-98655547 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
1112366000 13:98756001-98756023 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1112372177 13:98803555-98803577 GGTGCTGATGCTGCTGGTCCTGG + Intronic
1112680408 13:101758381-101758403 GATGCTGATGCTGTTTGTCTAGG + Intronic
1112781367 13:102904466-102904488 GATGCTGATGCTCCTGGTCTGGG + Intergenic
1112933279 13:104768272-104768294 GATGCTGATGCTGCTTGTATGGG - Intergenic
1113544445 13:111137279-111137301 AGTGCTGGTGCTGCTGGTCCTGG + Intronic
1114172488 14:20287295-20287317 GATGCTGATGCTGCTGGTCTGGG + Exonic
1115179384 14:30604590-30604612 GCTGCTGCTGCTGCTGGTCTGGG + Intronic
1115550717 14:34502765-34502787 GGTGCTGATTCTGCTGGTCTGGG + Intergenic
1117021030 14:51570596-51570618 GGTGTTGATGCTGCTGGTCTGGG - Intronic
1117331319 14:54715000-54715022 TGTGTTGATGTTGCTTCTTTGGG + Intronic
1118060004 14:62125976-62125998 GATGCTGATGCTGCCAGTCTGGG - Intergenic
1118621520 14:67618708-67618730 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1119628660 14:76206652-76206674 TGTGCTGATGCTGTTGGCCTAGG - Exonic
1119989451 14:79179474-79179496 TTTGCTAATGCTGCTGGTCCTGG - Intronic
1120726010 14:87942249-87942271 GATGCTGATGCTGCTCGTCCAGG + Intronic
1120804751 14:88735259-88735281 AATGCTGATGTTGCTCGTCTAGG + Intronic
1121226542 14:92325317-92325339 GGTGCTGATTCTGCTGGTCCAGG - Intronic
1122175091 14:99911390-99911412 TGTGCTAATGATGGTTTTCTTGG + Intronic
1122738700 14:103858489-103858511 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
1123171236 14:106374370-106374392 TGTGCTGAAGGAGCTGGTCTGGG + Intergenic
1123194926 14:106606829-106606851 TGTGCTGAAGATGCTGGTCTGGG + Intergenic
1123476551 15:20595489-20595511 TTTCCAGATGCTGCTTTTCTGGG + Intergenic
1123641460 15:22404875-22404897 TTTCCAGATGCTGCTTTTCTGGG - Intergenic
1124430457 15:29603286-29603308 GCTGCTGATGCTGCTGTTCTGGG - Intergenic
1124808362 15:32908677-32908699 GTTGTTGATGCTGCTAGTCTAGG - Intronic
1125281037 15:38042968-38042990 TGCCCTAATGCTGCTTGTTTTGG - Intergenic
1126924062 15:53562491-53562513 GATGCTGATGCTGCTGGTCCAGG + Intronic
1127377554 15:58398871-58398893 AACGCTGATGCTGCTGGTCTAGG - Intronic
1127386086 15:58468332-58468354 GATGCTGATGCTGCTGGTTTGGG - Intronic
1127428576 15:58880428-58880450 GGTGCTGCTGCTGCTGGTTTGGG - Intronic
1127473672 15:59312684-59312706 GTTGCTGATGCTGCTGGTTTGGG - Intronic
1127592564 15:60440577-60440599 CGTACTGATGCTGCTAGTTTAGG - Intronic
1127601786 15:60544904-60544926 TGTCCTGATGGTCCTTGACTTGG - Intronic
1127638675 15:60894731-60894753 GGAGCTGATGCTGCTGGCCTGGG + Intronic
1127643219 15:60934679-60934701 GATGCTGATGTTGCCTGTCTGGG + Intronic
1128234141 15:66056018-66056040 GGTGCTGCTGCTGCTGGTTTAGG - Intronic
1128343336 15:66837740-66837762 GGTGCTGATGCTGCCAGTCTAGG + Intergenic
1128522941 15:68387392-68387414 GGTGCTGGTGCTGCTGGTCTGGG - Intronic
1130230305 15:82091865-82091887 TGTGTTGATGCTGCATGGCCTGG - Intergenic
1130657140 15:85799546-85799568 TTTTCTGATGCTGATGGTCTGGG - Intergenic
1130795106 15:87199510-87199532 AATGCTGATGCTGCTGGTCCTGG + Intergenic
1131384131 15:91988727-91988749 GATGCTGATGCTGCTGGTCCAGG + Intronic
1131439949 15:92452199-92452221 GATGCTGATGCTGCTGGTCTGGG - Intronic
1131481647 15:92787427-92787449 GATGCTGATGGTGCTGGTCTGGG - Intronic
1131670056 15:94610341-94610363 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1131902491 15:97103737-97103759 TGCTCTGTTGCTGCTTGACTAGG - Intergenic
1132252122 15:100341839-100341861 CGTGCTGCTGCTGCTGGTTTGGG - Exonic
1132292122 15:100711137-100711159 TGTGGTGATGGTGCTTGTGGAGG - Intergenic
1132319293 15:100913766-100913788 GAGGCTGATGCTGCTGGTCTGGG + Intronic
1132765898 16:1534043-1534065 TGTGCTGAAGCTGCTCGCCTCGG - Exonic
1133864808 16:9632722-9632744 GATGCTGATGCTGCCTGTCTGGG + Intergenic
1133907527 16:10035664-10035686 GATGCTGATGCTGCTGGTCCAGG + Intronic
1134084445 16:11346721-11346743 GATGCTGATGCTGCTGGTCTGGG + Intronic
1134360350 16:13525173-13525195 GGTGCTGATGATGCTAGCCTGGG + Intergenic
1134567706 16:15265615-15265637 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1134734731 16:16490738-16490760 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1134751694 16:16630299-16630321 GATGCTGGTGCTGCTGGTCTGGG + Intergenic
1134761520 16:16718944-16718966 GGTGCTGATGCTGCTGGCCCAGG - Intergenic
1134932742 16:18221168-18221190 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1134984538 16:18640226-18640248 GGTGCTGATGCTGCTGGCCCAGG + Intergenic
1134993766 16:18723324-18723346 GATGCTGGTGCTGCTGGTCTGGG - Intergenic
1135046317 16:19158912-19158934 GATGCTGATGCTGCTGGTCCAGG + Intronic
1135183603 16:20295879-20295901 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1135635981 16:24076113-24076135 GATGCTGACGCTGCTAGTCTGGG + Intronic
1137580951 16:49633101-49633123 GGTGCAGATGCTGCCTGCCTGGG + Intronic
1138292552 16:55860358-55860380 GATGCTGATGCTGCTGGTCTAGG - Intronic
1138645150 16:58419243-58419265 GGTGCTGATGCAGCTGGCCTGGG - Intergenic
1138794334 16:59949789-59949811 TGTTCTGATTCTGCATCTCTGGG - Intergenic
1139354358 16:66358515-66358537 TTTGCTGATGCTGCTGGTTGAGG + Intergenic
1139656277 16:68388990-68389012 GGAGCTGATTCTGCTTGCCTGGG - Intronic
1139950538 16:70666206-70666228 TGTGCTGATGCTGCTGGGTGGGG + Intronic
1140378583 16:74465550-74465572 GCTGCTGCTGCTGCTCGTCTAGG + Intronic
1140436388 16:74950548-74950570 TGTGCAGTTGCTGCCTGTCTAGG - Intronic
1140687929 16:77451450-77451472 GATGCCGATGCTGCTGGTCTGGG - Intergenic
1140725744 16:77810253-77810275 AATGCTGATGCTGCTGATCTGGG - Intronic
1140785355 16:78336147-78336169 GATGTTGATGCTACTTGTCTTGG + Intronic
1140951298 16:79820403-79820425 GGTGTTGATGCTGCTGGTCTAGG + Intergenic
1141012597 16:80416906-80416928 GTTGCTGATGCTGCTGGTCCAGG + Intergenic
1141090064 16:81124023-81124045 GATGCTGATGCTGCTGGTGTGGG - Intergenic
1141968549 16:87463997-87464019 ACTGCTGATGCTGGTTGTCAAGG - Intronic
1141987503 16:87589401-87589423 GGTGCTGATGCTGCTGGTCTGGG - Intergenic
1142033135 16:87848335-87848357 CGTGCTGCTGCTGCTGGGCTGGG + Intronic
1143027947 17:3951970-3951992 GCTGCTGCTGCTGCTGGTCTGGG - Intronic
1143323310 17:6081842-6081864 GGAGCTGATGCTGCTGGTCAGGG - Intronic
1143351214 17:6289621-6289643 TGTGTGGATGCTGCTGGTCAGGG - Intergenic
1143877111 17:10000273-10000295 AACGCTGATGCTGCTGGTCTGGG + Intronic
1143942729 17:10559472-10559494 GATACTGATGCTGCTGGTCTGGG - Intergenic
1144061297 17:11584939-11584961 GTTGCTGATGCTGCCTGCCTGGG + Intergenic
1144088586 17:11833066-11833088 GATGCTGATGCTGCTGGTCCAGG + Intronic
1144099390 17:11930586-11930608 GATGCTGATGCTGCTGGTCCAGG - Intronic
1144194242 17:12875212-12875234 GATGCTGATGCTGCTGGTCCAGG + Intronic
1144366203 17:14547267-14547289 GGTACTGATGCTGCTGGTCTAGG + Intergenic
1144386073 17:14750397-14750419 TCTGTTAATGCTGCTGGTCTGGG + Intergenic
1144390607 17:14790184-14790206 GATGTTGATGCTGCTTATCTGGG + Intergenic
1144394103 17:14826843-14826865 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1144479603 17:15617993-15618015 AGTGCTGATGTTGCTGGACTGGG - Intronic
1144489889 17:15699788-15699810 TGTGGTGATGTCGCTCGTCTCGG + Exonic
1144583389 17:16473214-16473236 TGTGCTGATGCTCCCTGCCCTGG - Intronic
1144918700 17:18745746-18745768 AGTGCTGATGTTGCTGGTCTGGG + Intronic
1144992581 17:19243870-19243892 GCTGCTGATGCTGCCAGTCTAGG + Intronic
1145014430 17:19387290-19387312 TAAACTGATGCTGGTTGTCTGGG - Intergenic
1146105433 17:30031350-30031372 GATGCTGATGCTGTTGGTCTAGG + Intronic
1146488015 17:33259898-33259920 GATGCTGATGCTGCTGGTCCTGG + Intronic
1146564892 17:33904243-33904265 GATGCTGATGCTGCTTGCCTGGG - Intronic
1146806358 17:35868102-35868124 GATGCTGATGCTGCTGGTCATGG + Intronic
1147500867 17:40962351-40962373 TAAGCTGATGCTGCATTTCTAGG - Intronic
1147624605 17:41892022-41892044 TGGGCAGAGGCTGCTTATCTGGG - Intronic
1147788152 17:42995213-42995235 TATGGTGATGCTGCTGCTCTGGG + Intergenic
1147879378 17:43644045-43644067 AATGCTGATGCTGCTGATCTGGG - Intronic
1148081086 17:44968033-44968055 TGTGGTGATGCTGCTGGTGCTGG - Exonic
1148188245 17:45660184-45660206 GGTGCTGATGCTGCTGGTCTGGG + Intergenic
1148699871 17:49580931-49580953 TATGCTGATGCTGCTGCTCCAGG + Intronic
1148866115 17:50629623-50629645 TAACCTCATGCTGCTTGTCTGGG + Intergenic
1149220094 17:54407184-54407206 GATGCTGATGCTGTTTGTCTAGG + Intergenic
1149358159 17:55865595-55865617 GTTGATGATGCTGCTGGTCTAGG + Intergenic
1149462089 17:56837061-56837083 GATGCTGATGCTGCTGGTCTAGG - Intronic
1150556194 17:66256769-66256791 GATGGTGATGCTGCTGGTCTGGG - Intergenic
1150998748 17:70349694-70349716 GATGCTGATGCTGCTGGTTTTGG + Intergenic
1151269681 17:72984542-72984564 GTTGCTGATGCTGCTGGCCTTGG - Intronic
1152449416 17:80367553-80367575 TGTGATTATGCTGCTTGTCAGGG - Intronic
1152616072 17:81338492-81338514 TGTGCAGAGGCTGCTTGGCTGGG - Intergenic
1153555594 18:6310080-6310102 GATGCTGATGCTGCTGGTCCAGG + Intronic
1154006310 18:10530510-10530532 AGTGCTGATGGTGCTGGTCCAGG + Intronic
1156014327 18:32531068-32531090 GATGCTGATGCTGCTGGTTTGGG - Intergenic
1156206255 18:34889257-34889279 GTTGCAGATGCTGCTTGTCCGGG - Intronic
1156367182 18:36440168-36440190 GATGCTGATGCTGCTGGTCCAGG + Intronic
1156427867 18:37035271-37035293 GATGCTGATGCTGCTGGACTGGG - Intronic
1156734381 18:40235539-40235561 AGGGCTGATGCTGCTTGTTCAGG + Intergenic
1157120021 18:44900639-44900661 GATGCTGATGCTGCTGGTCTGGG - Intronic
1157215128 18:45776105-45776127 GATGCTGATGTTGCTGGTCTGGG - Intergenic
1157554194 18:48602647-48602669 TATGTTGGTGCTGCTTCTCTGGG + Intronic
1157710434 18:49846356-49846378 GATGCTGATGCTGCTGGTCCAGG + Intronic
1157742092 18:50102662-50102684 GGTGCTGCTGCTCCTGGTCTAGG - Intronic
1157921498 18:51717674-51717696 GATACTGATGCTGCTGGTCTGGG - Intergenic
1157930208 18:51813387-51813409 GGTGCTGCTGCTACTGGTCTGGG - Intergenic
1158010756 18:52724761-52724783 TGTGCTGAAGCTGTGTGTATAGG - Intronic
1158613093 18:58961230-58961252 GATGCTGATGCTGCTCATCTTGG + Intronic
1158688509 18:59638420-59638442 GGTGCTGATGCTGCTGGTCCAGG - Intronic
1158732931 18:60045584-60045606 GATGCTGATGCCGCCTGTCTGGG + Intergenic
1158857387 18:61556473-61556495 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1158928913 18:62301679-62301701 GGTGCTAATGCTGCAGGTCTAGG + Intronic
1159085252 18:63782803-63782825 GGTGCTGATGATCCTGGTCTGGG - Intronic
1159410575 18:68070342-68070364 TGTGCTGATACTATTTGTTTTGG - Intergenic
1159601804 18:70435133-70435155 TTTGCTGATGCTACTTCTCTGGG + Intergenic
1159783008 18:72681064-72681086 GCTGCTGATGTTGCTGGTCTGGG - Intergenic
1160099445 18:75906334-75906356 TATGCTGATGAAGCTTGTCGGGG - Intergenic
1161734305 19:5981513-5981535 CATGCTGATGCTGCTGGTGTGGG - Intergenic
1162316477 19:9941780-9941802 TTTGCTGATGCTGCTGAGCTTGG - Intergenic
1162786023 19:13035405-13035427 TGTGCTGGGGCTGCTGATCTGGG + Intronic
1163019911 19:14476416-14476438 TGTGCTGGTGGGGCCTGTCTGGG - Intergenic
1163984371 19:20931180-20931202 AGTGCTGATGTTGCTTCCCTTGG - Intronic
1165393699 19:35552421-35552443 GATGGTGATGCTGCTGGTCTGGG + Intronic
1165989728 19:39803335-39803357 CAAGCTGATGCTGCTGGTCTGGG - Intergenic
1167332342 19:48864030-48864052 GACGCTGATGCTGCTGGTCTGGG + Intronic
1167411786 19:49348483-49348505 TGCGTTGATGCAGCTGGTCTGGG - Intronic
1167434461 19:49471166-49471188 TGTGCTGAAGCGGCTCGTATTGG - Intronic
1167741197 19:51325892-51325914 TATGCTGATGCTTCGGGTCTGGG - Intronic
1168422172 19:56211594-56211616 GGTGCTGATGCTGCTGGTCTTGG + Intergenic
1168423385 19:56219789-56219811 GGTGCTCATGCTGCTGGTCTTGG - Exonic
1168427412 19:56249888-56249910 GATGCTGATGCTGCTGGTCTTGG + Intronic
1168545471 19:57246140-57246162 TGAGCTCATGCTGCTTGTTCAGG - Intronic
926665681 2:15519776-15519798 TTTTCTGATGCTGCTGGTCAGGG + Intronic
927513998 2:23661439-23661461 TGTGCAGATGCGGTCTGTCTGGG - Intronic
927553841 2:24019219-24019241 GTTGCTGATGCTGCTGGTCCAGG - Intronic
928205757 2:29282149-29282171 TTTGCTGCTGGTGCTTGTCTGGG + Intronic
929066538 2:37981169-37981191 GATGCTGATGCTTCTGGTCTTGG + Intronic
929125413 2:38519052-38519074 CATGCTGATGCTGCTGGTCTAGG - Intergenic
929259396 2:39847856-39847878 TATGTTGATGCTGCTGGCCTGGG + Intergenic
929282897 2:40101917-40101939 GTTGCTGATGCTGCTTGTTTGGG + Intronic
929285604 2:40131829-40131851 TGTGCTGATGAGGATTATCTTGG + Intronic
929389948 2:41458590-41458612 TCTGATGATGCTGCTGGTCCAGG - Intergenic
929803067 2:45120906-45120928 TGAGCTCATGCTGCATGGCTGGG + Intergenic
929849530 2:45571426-45571448 TTTGTTGTTGCTGCTTGTTTTGG - Intronic
929942381 2:46344411-46344433 TGTGTTGATGATGCTTTTGTTGG + Intronic
930081073 2:47449259-47449281 TTTGTTGATGCTGTTTGTCTGGG + Intronic
930129506 2:47835168-47835190 TGTGCTGCTGCTATTTGGCTGGG - Intronic
930395061 2:50811614-50811636 AGTGCTCCTGCTACTTGTCTAGG - Intronic
930804741 2:55479160-55479182 GATGCTGATGCTGCTGGTCCAGG + Intergenic
930924985 2:56806637-56806659 TGATATGATGATGCTTGTCTAGG - Intergenic
931551377 2:63450318-63450340 TGTGGTGCTGCTACCTGTCTGGG + Intronic
931731144 2:65154472-65154494 GATGCTGATGCTGCTGGTCCAGG - Intergenic
932132341 2:69199281-69199303 GATGCTGATGCTGCTGGTCTGGG + Intronic
932416744 2:71578199-71578221 GATGCTGATGCTGCTGGTCCAGG + Intronic
932443104 2:71750471-71750493 GATGCTGATGCTGCTGGTCCAGG + Intergenic
932896300 2:75643903-75643925 TGTGCTGATGTTGCTAGTCAAGG + Intergenic
933396046 2:81732608-81732630 TATGCTGATACTGCTGGTCTGGG - Intergenic
933706465 2:85294463-85294485 GATGCTTATGCTGCTGGTCTGGG + Intronic
934578924 2:95422721-95422743 AATGCTGATGCTGCTAGTCTGGG + Intergenic
934600523 2:95653982-95654004 AATGCTGATGCTGCTAGTCTGGG - Intergenic
934628273 2:95884004-95884026 GACGCTGATGCTGCTGGTCTTGG - Intronic
934628520 2:95887755-95887777 GACGCTGATGCTGCTGGTCTTGG - Intronic
934631092 2:95923325-95923347 GACGCTGATGCTGCTGGTCTTGG - Intronic
934802953 2:97185658-97185680 GATGCTGATGCTGCTGGTCTTGG + Intronic
934805007 2:97213762-97213784 GACGCTGATGCTGCTGGTCTTGG + Intronic
934832229 2:97539863-97539885 GACGCTGATGCTGCTGGTCTTGG - Intronic
934832476 2:97543620-97543642 GACGCTGATGCTGCTGGTCTTGG - Intronic
934833246 2:97554889-97554911 GATGCTGATGCTGCTGGTCTTGG - Intronic
934851014 2:97701254-97701276 CGTGCTGTTGCTGCTTGGGTTGG + Intergenic
935232171 2:101108609-101108631 TGGCCTGATGTTGCTGGTCTTGG - Intronic
935322362 2:101901581-101901603 GGTGCTGAGGCTGCTGGTTTGGG + Intergenic
935557492 2:104526257-104526279 GATGCTGATGCTGCTGGTCCAGG + Intergenic
935623442 2:105148289-105148311 GGTGCTGCTGCTGCTGGTCTGGG - Intergenic
936131763 2:109849985-109850007 GTTGCTGATGCTTCTGGTCTGGG + Intronic
936212934 2:110521500-110521522 GTTGCTGATGCTTCTGGTCTGGG - Intronic
936533885 2:113296042-113296064 AATGTTGATGCTGCTAGTCTGGG - Intergenic
936652762 2:114448493-114448515 GATGCTGATACTGCTGGTCTAGG - Intronic
936880757 2:117247730-117247752 GGTGCTGATACTGCTGGTCAGGG + Intergenic
936918542 2:117664213-117664235 GATGCTGATGCTGCTGGCCTGGG - Intergenic
937126660 2:119478922-119478944 TTGTCTGATGCTGCTTTTCTTGG - Intronic
937126758 2:119479577-119479599 GATGCTGATGCTGTTTGTCCTGG + Intronic
938566548 2:132523949-132523971 GATGCTGATACTGCCTGTCTGGG - Intronic
938645146 2:133322933-133322955 GATGTTGATGCTGCTTGTCCAGG + Intronic
938842880 2:135180088-135180110 GATACTGATGCTGCTGGTCTAGG - Intronic
938904065 2:135822437-135822459 AATGTTGATGCTGCTGGTCTGGG + Intronic
940126062 2:150326261-150326283 GCTGCTGATGCTGCTAGTCTGGG - Intergenic
940170473 2:150824709-150824731 TGTGCTGATGCTACTAGTCTGGG - Intergenic
940380200 2:153007132-153007154 TGTGCTTATGCATCTTGTCTAGG + Intergenic
940514470 2:154663791-154663813 TATGCTGATGCTGCTGGTCTGGG - Intergenic
940635412 2:156292780-156292802 AGGGCTGATGCAGCTTGTATAGG + Intergenic
940969948 2:159884811-159884833 GATGCTGATGCTGTTGGTCTGGG + Intronic
940970538 2:159892060-159892082 AGTGCTGATAATGCTGGTCTGGG - Intronic
941656835 2:168153528-168153550 TATGCTGCTGCTGCTGCTCTAGG + Intronic
941689439 2:168483952-168483974 TATGCTGATGTTGCTAGTCCAGG + Intronic
941746762 2:169095197-169095219 GATGCTGATGCTGCTGGTCCAGG - Intronic
941906828 2:170724760-170724782 GATGCTGATGCTGCAGGTCTGGG - Intergenic
942231169 2:173862012-173862034 GGTGCTGATGCTGCTGAACTGGG - Intergenic
942364365 2:175208007-175208029 GGTGCTGGTGCTGCTGGTCCAGG + Intergenic
942577056 2:177374804-177374826 AATGCTGATGTTGCTGGTCTGGG + Intronic
942657504 2:178229494-178229516 GATGCTAATGCTGCTGGTCTGGG - Intronic
942719128 2:178929807-178929829 GGTAATGATGCTGCTGGTCTCGG - Intronic
942851718 2:180495155-180495177 TTTGCTCATGCTGCTTACCTGGG - Intergenic
943056818 2:182992118-182992140 GTTGCTGATGTTGCTGGTCTAGG + Intronic
944353774 2:198760821-198760843 TTTGCTGGTGCTGCTGGTCTGGG - Intergenic
944979390 2:205097561-205097583 GTTTCTGATGCTGCTTGTCCAGG - Intronic
945195153 2:207230553-207230575 TCTGCTGATTTTGCCTGTCTGGG + Intergenic
945435824 2:209816630-209816652 GATGCTGATGCTGCTGGTCCAGG + Intronic
945661968 2:212697588-212697610 GATGCTGATACTGCTGGTCTAGG + Intergenic
945802537 2:214451074-214451096 AATACTGATGCTGCTGGTCTGGG - Intronic
946134199 2:217632197-217632219 TGTGCTGAGTCTGTGTGTCTGGG - Intronic
946196577 2:218035780-218035802 TGAGCAGATGCTGCGTGTGTGGG - Intronic
946398904 2:219458345-219458367 GATGCTGATGCTGCTGGTCTGGG - Intronic
946456465 2:219830631-219830653 GGTGCTGATGCTGCTGCTCAGGG - Intergenic
946461250 2:219870787-219870809 TCTCCTGATGCTGCCAGTCTAGG + Intergenic
946736006 2:222755231-222755253 GATGCTGATGCTGCTGCTCTAGG - Intergenic
946854417 2:223939119-223939141 GATGCTGATGCTGCTAGTCCAGG - Intronic
947315903 2:228857939-228857961 GATGCTGATGCTCCTGGTCTGGG + Intronic
947369717 2:229432642-229432664 GGTGTTGATGCTGCTGGTCTGGG - Intronic
947374994 2:229486807-229486829 AGGGCTGATGCTGCTGATCTGGG - Intronic
947532773 2:230923356-230923378 TGTGCCAATGCTGCTTTTTTAGG - Intronic
947940065 2:234045888-234045910 GGTGCTGAAGCTGCTGGTCTGGG + Intergenic
948029886 2:234808723-234808745 GGTGCTGCTGCTGCTGATCTGGG + Intergenic
948084773 2:235238291-235238313 GGTGCTGATGCTGCTGGTGCAGG - Intergenic
948137787 2:235649705-235649727 TGTGCTGATGCTGCTTGTCTGGG + Intronic
948239727 2:236420017-236420039 AGAGCTTATGCAGCTTGTCTTGG - Intronic
948392247 2:237620746-237620768 TTTCCTGATTCTTCTTGTCTAGG + Intergenic
948573185 2:238930266-238930288 TGTCCTGATGGTGCTTCACTAGG + Intergenic
949010116 2:241673461-241673483 GCTGCTGCTGCTGCTTGTGTAGG + Exonic
1168850202 20:971324-971346 GATGCTGATGCTGCTGGTCCAGG + Intronic
1168906238 20:1406107-1406129 GATGCTGATGCTGTTAGTCTGGG + Intergenic
1169367462 20:5002330-5002352 GATGCTGATGCTACTGGTCTGGG + Intronic
1169714821 20:8603569-8603591 GATGCTGATGTTGCTGGTCTAGG - Intronic
1169871186 20:10250036-10250058 TATGCTGCTGCTGCCTGTCCTGG + Intronic
1169950935 20:11042435-11042457 GATGCTGATGCTGCTGATCTTGG + Intergenic
1170091676 20:12596082-12596104 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1170238618 20:14136548-14136570 GGTGCTAATGCTGCTGGTCCAGG - Intronic
1170307754 20:14958890-14958912 GTTGTTGATGCTGCTAGTCTGGG + Intronic
1170331196 20:15212816-15212838 GCTGCTGATGCTGCTGGCCTAGG - Intronic
1170672992 20:18452296-18452318 GATGCTGATGCTGCAGGTCTGGG + Intronic
1171047225 20:21821554-21821576 AATGCTGATGCTGCTGGTTTTGG - Intergenic
1171177339 20:23062431-23062453 TGCAGTGATGCTGCTGGTCTGGG - Intergenic
1171178697 20:23075292-23075314 TCTGCTGATGCTGCTGGTCCAGG - Intergenic
1171247774 20:23626525-23626547 GGTGCTGCTGCTGCTGGTCCAGG + Intergenic
1171252150 20:23656516-23656538 GATGCTGATGTTGCTGGTCTGGG + Intergenic
1171377674 20:24704490-24704512 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1172173960 20:32961216-32961238 TGTGCTGGTCTTGCTGGTCTGGG - Intergenic
1172490966 20:35337517-35337539 GATGCTGAGGCTGCTGGTCTGGG + Intronic
1172850367 20:37958094-37958116 AATGCTGATGCTGCTGGTGTTGG + Intergenic
1172884830 20:38223872-38223894 GTTGCTGATGCTGCTGGCCTGGG + Intronic
1173158479 20:40634883-40634905 GATGCTGATGCTGCTTCTGTGGG - Intergenic
1173158616 20:40636060-40636082 AATGCTGATGCTGCTGGTCTGGG + Intergenic
1173478620 20:43381929-43381951 GCTGCTGCTGCTGCTGGTCTGGG - Intergenic
1173549603 20:43923517-43923539 GGTGCTGATGGTGCCAGTCTGGG + Intronic
1173704392 20:45099215-45099237 GATGCTGATGCTGCTGGTCCGGG - Exonic
1173832193 20:46097723-46097745 GTTGCTGATGCTGCTAGTCCAGG - Intergenic
1174845437 20:53938749-53938771 GGTGCTGAGGCTGCTGGTCCTGG + Intronic
1174930533 20:54809100-54809122 GGTGCTGATACTGCTAGTCTGGG - Intergenic
1175612292 20:60361798-60361820 TGATCTGCTGCTGCTTGTCCAGG - Intergenic
1175811443 20:61860581-61860603 GGTGCTGTTTCTGCTTGTCAGGG - Intronic
1176677197 21:9790437-9790459 TGAGGTGATGCTGCTGGCCTGGG - Intergenic
1177139914 21:17346818-17346840 TGTGCTTTTGCTTCTTTTCTGGG - Intergenic
1177856260 21:26403922-26403944 GATGCAGATGATGCTTGTCTGGG + Intergenic
1178298553 21:31431421-31431443 GATGCTGATGTTGCTGGTCTGGG + Intronic
1178523893 21:33308731-33308753 GGTGCTGATGCTGCTGGTCTAGG - Intergenic
1181507147 22:23367072-23367094 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1181856786 22:25787407-25787429 AATGCTGATGCTGCTGGTCCAGG + Intronic
1181868136 22:25875557-25875579 GATGCTGATGCTGCTGGTCTGGG - Intronic
1181913166 22:26256683-26256705 GATGCTGATGCTGCTGGTCCAGG - Intronic
1182050116 22:27306213-27306235 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1182162970 22:28141858-28141880 TGTGTTGATGTGGCTTTTCTTGG - Intronic
1182251866 22:29007137-29007159 TGTGGTCATGCAGCTGGTCTGGG + Intronic
1182678099 22:32055901-32055923 CTTGCTGATGCTGCTGGTCTGGG - Intronic
1182733497 22:32513791-32513813 TGTGCTGAGGCTGTTAGTCAGGG + Exonic
1182933044 22:34193135-34193157 GATGCTGATGTTGCTGGTCTGGG + Intergenic
1182946689 22:34330872-34330894 CTGGCTGATGCTGCTGGTCTAGG - Intergenic
1183089668 22:35513007-35513029 GATGCTGATGCAGCTGGTCTGGG + Intergenic
1183093109 22:35536837-35536859 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1183816609 22:40307197-40307219 TGTGCTTATCCTAGTTGTCTGGG - Intronic
1184074663 22:42168674-42168696 TGTGCTGAGGCTGCCTTTCGCGG + Exonic
1184110196 22:42389706-42389728 TGGGCTGCGGCTGTTTGTCTGGG + Intronic
1184524023 22:45010892-45010914 TTTGCTGATGGTGCTTGCTTGGG - Intergenic
949328338 3:2892311-2892333 AATGCTGATGCTGCTTGTCTGGG + Intronic
949744273 3:7270116-7270138 GATGCTGATGCTGCTGATCTGGG + Intronic
949830001 3:8204116-8204138 AATGCTGATGCTGCTGGTCCAGG + Intergenic
949887690 3:8709493-8709515 GATGCTCATGCTGCTGGTCTGGG + Intronic
949961711 3:9317772-9317794 GATGCTGATGCTGCTGGTCCAGG + Intronic
950421212 3:12900992-12901014 TGTGCTGATGCCGCTGGGTTTGG + Intronic
950575523 3:13829987-13830009 TGTGCTGCTGCTGCCTGGCATGG + Intronic
950884755 3:16353492-16353514 TGAGCTGCTGCTGCTGGTGTGGG - Intronic
950899420 3:16483814-16483836 AATGCTGATGCTGCTGGTCTGGG - Intronic
950958948 3:17084303-17084325 TGTGCTGGTGCTTTTTGTTTTGG - Intronic
951040279 3:17982020-17982042 GATGCTGATGCTGCTGGTCTAGG + Intronic
951049868 3:18082296-18082318 GATGCTGATGCTGCTGGTCTAGG - Intronic
951530986 3:23697928-23697950 TATGGTGATGCTGCTGGTCCAGG - Intergenic
951578247 3:24135089-24135111 TGTGCTGATGAAGCTGCTCTGGG + Intronic
951590657 3:24261011-24261033 GATGCCGATGCTGCTGGTCTGGG + Intronic
951663374 3:25095341-25095363 GGTGCTGATGTTGCTGGTCCAGG - Intergenic
951696803 3:25453573-25453595 GATGCTGATGCTGCTTGTCCAGG + Intronic
951844618 3:27072270-27072292 GGTGCTGATGCTGCTTGTCTGGG - Intergenic
951995200 3:28719751-28719773 GCTGCTGCTGCTGCTGGTCTGGG + Intergenic
952019627 3:29001939-29001961 TATGCTACTGCTGCTGGTCTGGG - Intergenic
952123096 3:30267772-30267794 GATGCTGATGCTGCTGGTCTAGG + Intergenic
952348303 3:32509470-32509492 GATGATGATGCTGCTGGTCTAGG + Intergenic
952576554 3:34781134-34781156 GATGCTGATGCTGCTGGTCTTGG + Intergenic
952622482 3:35362161-35362183 AATGCTGATGCTGCTAGTCCAGG + Intergenic
952655503 3:35780667-35780689 GATGCTGATGCTTCTTGTCTGGG - Intronic
953137129 3:40190698-40190720 GGTGCTGATGCTGCTGGTCTGGG - Intronic
953308485 3:41853243-41853265 AATGCTCATGCTGCTGGTCTAGG + Intronic
953781243 3:45872645-45872667 AATACTGATGCTGCTGGTCTGGG + Intronic
954372538 3:50176374-50176396 TTTGCTGTGGCTGCCTGTCTTGG - Intronic
954408902 3:50360915-50360937 GGTGCTGATGCTTTTTTTCTGGG + Intronic
955531156 3:59874510-59874532 GATGCTGATGCTGCTGGTCCAGG + Intronic
955661825 3:61307659-61307681 AATGCTGATGCTGCTGGTCTGGG - Intergenic
956065563 3:65393828-65393850 TGTGCTGCTGCTTCTTTTGTAGG + Intronic
956362215 3:68460807-68460829 GATGCTGATGCTGCTAGTCTGGG + Intronic
956522690 3:70123190-70123212 TCTACTGATGCTGCTGGACTGGG + Intergenic
956525029 3:70149428-70149450 GAAGCTGATGCTGCTGGTCTAGG - Intergenic
956583793 3:70842667-70842689 GATGCTGATACTGCTAGTCTGGG + Intergenic
956716214 3:72082413-72082435 GATGCTGATGCTGCTTGTCTAGG - Intergenic
956998108 3:74851304-74851326 GATGCTTATGCTGCTGGTCTAGG + Intergenic
957031702 3:75249835-75249857 AATGCTGATGCTGTTGGTCTGGG - Intergenic
957337984 3:78857562-78857584 GATGCTGATGCTGCTGGTCTGGG - Intronic
958686882 3:97409551-97409573 TCTGCTGATGCTGATTTTCTAGG + Intronic
959374456 3:105571260-105571282 GATGCTGATACTGCTGGTCTGGG + Intronic
959632745 3:108527158-108527180 CCTGTTGATGCTACTTGTCTGGG + Intronic
960165299 3:114394665-114394687 GATGCTGATGCTACTGGTCTGGG + Intronic
960536973 3:118825534-118825556 GATGCTGGTGCTGCTTGTCTGGG - Intergenic
961093570 3:124136378-124136400 GATGCTGATGCTGCTGGTCTGGG + Intronic
961189165 3:124943034-124943056 CATGCTGGTGCTGCTGGTCTGGG - Intronic
961924104 3:130458414-130458436 GATGCTGATGCTGCTTGTGTAGG - Intronic
962028717 3:131575933-131575955 TGTGATTTTGCTGCTTGGCTTGG + Intronic
962302306 3:134253187-134253209 GGTGATGATACTGCTGGTCTGGG - Intergenic
962394129 3:134999990-135000012 TGTGGAGATGCTCCTTGTCCTGG + Intronic
962425028 3:135262136-135262158 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
962469773 3:135695915-135695937 AATGCTGATGCTGCTGGTCTGGG - Intergenic
962483001 3:135814114-135814136 TGGGCTAATACTGCTTGCCTGGG - Intergenic
962897566 3:139729994-139730016 GCTGCTGGTGCTGCTTGTCTGGG + Intergenic
963103529 3:141626277-141626299 AATGCTGATGCTGCTAGTCTTGG - Intergenic
963106598 3:141652808-141652830 GATGCTGAGGCTGCTGGTCTTGG + Intergenic
963204219 3:142615864-142615886 AATGCTAATGCTGCTTGTCTGGG - Intronic
963247363 3:143075321-143075343 GATGCTGATGCCGCTTGTTTAGG - Intergenic
964663516 3:159147950-159147972 GCTGTTGATGCTGCTGGTCTGGG - Intronic
965226159 3:165994508-165994530 TATGCTGAAGCTGCTGGCCTGGG - Intergenic
965403431 3:168241208-168241230 AATGCTGATGCTGCTGGTTTGGG + Intergenic
965408078 3:168295283-168295305 GTTGCTGATGCTGCTAGTCCAGG + Intergenic
965641007 3:170829019-170829041 AATGCTGATGCTGCTGGTCCAGG - Intronic
965733525 3:171797395-171797417 AATGCTGATGCTGCTGGTTTGGG - Intronic
965740842 3:171872980-171873002 GATGCCGATGCTGCTGGTCTGGG - Intronic
966279965 3:178214660-178214682 AATGGTGATGCTGCTTGTCTAGG + Intergenic
966755561 3:183368136-183368158 GATGCTGATGCTGCTGGTCTGGG - Intronic
966825873 3:183964559-183964581 GATGCTGATGCTGCTGATCTGGG + Intronic
967035161 3:185643524-185643546 ATAGCTGATGCTGCTGGTCTGGG + Intergenic
967113197 3:186313572-186313594 GATGCTGATGCTGCTGGTCCAGG - Intronic
967970836 3:194998393-194998415 GATGCTGATGCTGCTGGTCCTGG - Intergenic
968019017 3:195367270-195367292 GGTGCTGATGCTGCTGGTCCAGG + Intronic
968298676 3:197596744-197596766 GCTGGTGATGCTGCTGGTCTGGG + Intergenic
969156567 4:5216232-5216254 AATGCTGATGCTGCTGGTCTGGG + Intronic
969172080 4:5372197-5372219 TGTTCTGTTGCTGCTTGCCACGG - Intronic
969762586 4:9199962-9199984 TATGCTGCTGCTGCTTCTCTGGG - Intergenic
970453060 4:16191122-16191144 GGGGCTCATGCTGCTGGTCTGGG - Intronic
970545160 4:17121943-17121965 AATGCTGATGCTGCTTGCCAGGG - Intergenic
970730085 4:19092215-19092237 AGTGCTGATGCTTCTGGCCTAGG + Intergenic
971247807 4:24945946-24945968 GATGCTGATGCTGTTGGTCTGGG + Intronic
971464475 4:26940944-26940966 AGTGCTGATACTGCTGGTCCAGG + Intronic
972578296 4:40372320-40372342 TGTGCTGATGCTGCTGGTCCGGG - Intergenic
972613724 4:40678774-40678796 TATGTTGATGCTGCTGGTCAGGG + Intergenic
973201279 4:47505337-47505359 AGTACTGATGCTGCTGGTCCTGG - Intronic
973575866 4:52288728-52288750 AATGCTGATGTTGCTGGTCTGGG + Intergenic
974033259 4:56795182-56795204 GCTGCTGATGCTGCTGGTCAGGG - Intergenic
975063067 4:70027484-70027506 TGAGCTGATGCTGATTGTGATGG + Intergenic
975201873 4:71600138-71600160 TGTGCTGTTTTTGCTTGTCATGG + Intergenic
975372764 4:73607618-73607640 GGTACAGATGCTGCTGGTCTGGG - Intronic
975383191 4:73726477-73726499 GATGCTGATGATGCTTGTCCAGG - Intergenic
976088018 4:81425956-81425978 AATGCTGATGCTGCTGGTCCTGG - Intergenic
977667968 4:99662917-99662939 TGTGATGGTGCTGGTAGTCTGGG - Intergenic
977876731 4:102158485-102158507 GATGCTGATACTGCTTGTGTGGG - Intergenic
978642823 4:110891644-110891666 GTTGCTGATACTGCTAGTCTGGG - Intergenic
979341503 4:119529906-119529928 GATGCTGATGCTGCTGGTCCAGG - Intronic
979559034 4:122081556-122081578 GATGCTGATGCTGCTGATCTGGG - Intergenic
979753376 4:124307226-124307248 GGGGCTGACACTGCTTGTCTAGG + Intergenic
979838556 4:125406047-125406069 TTTGCTTATGTTGCTTGTTTTGG + Intronic
980295718 4:130913278-130913300 TGTCATGATGAGGCTTGTCTAGG - Intergenic
981490830 4:145337558-145337580 TGTGGAGTTGCTGCTTTTCTTGG + Intergenic
981895685 4:149796200-149796222 TGTGGTGATGCTGCCTGTCTTGG - Intergenic
982402402 4:154982795-154982817 TGTGTTGATGCTGCTTTTCTTGG + Intergenic
983091499 4:163508359-163508381 GGTGCTGTTGCTGCTGGTTTAGG + Intronic
983760871 4:171404892-171404914 TGTGCTAATGCTGCTAGGCTGGG + Intergenic
983898573 4:173108021-173108043 GATGCTGATGCTGCTGGCCTGGG - Intergenic
983905506 4:173177228-173177250 GATGCTGATGCTGCTGGTCCAGG + Intronic
984432307 4:179664772-179664794 TGAGCTGCTGCTGCTGCTCTGGG + Intergenic
984663336 4:182397815-182397837 GATGTTGATGCTGCTGGTCTGGG + Intronic
985398347 4:189568343-189568365 TGAGGTGATGCTGCTGGCCTGGG + Intergenic
986249523 5:6043875-6043897 TGTGCTGTTAATGCTTATCTGGG + Intergenic
986771347 5:10976922-10976944 GATGCTGATGCTGCTGGTCTTGG - Intronic
987977168 5:25029181-25029203 TGTGGTGCTGCTGGCTGTCTTGG - Intergenic
988459731 5:31423402-31423424 GATGCAGATGCTGCTGGTCTGGG + Intronic
988625126 5:32866697-32866719 GATGCTGATGCTGCTGGTCCAGG + Intergenic
988706880 5:33735313-33735335 GATGCTGATGCTGCTGGTCCGGG + Intronic
989475284 5:41867976-41867998 GATGTTGATGCTGCTGGTCTGGG - Intronic
989524183 5:42434200-42434222 TGTGCTGATGCTGACAGTCCTGG + Intronic
990356763 5:54975419-54975441 GGTGCAGATGCTGCTGGTCTAGG - Intergenic
990823504 5:59870902-59870924 TGTGCAGTTGCCGCTTGTTTTGG + Intronic
991164461 5:63547505-63547527 TATGCTAATGCTGCTGGTTTGGG + Intergenic
992097101 5:73373014-73373036 GATGCTGATGCTTCTTGTCTGGG + Intergenic
992371586 5:76149492-76149514 GGTGCTGCTGCTTCTTGGCTGGG - Intronic
992714628 5:79497864-79497886 CATGCTGATGCTGCTGGTCCAGG - Intronic
993486712 5:88495972-88495994 GCTGCTGATGCTGCCGGTCTGGG + Intergenic
994188991 5:96846636-96846658 CATGCTGTTGCTGCTGGTCTGGG + Intronic
994323865 5:98426158-98426180 GCTGCTGCTGCTGCTGGTCTTGG - Intergenic
995127504 5:108593172-108593194 GGAGCTAATTCTGCTTGTCTTGG - Intergenic
995133877 5:108659828-108659850 GGTGCTGATGCTGCTTTTGCTGG - Intergenic
995357269 5:111253306-111253328 TGTGCTGATGGTGCTTTTCTAGG + Intronic
995385996 5:111589621-111589643 GATGCTGATGCTGCTGGTCTGGG - Intergenic
996172020 5:120305164-120305186 GATGCTGATGCTGCTGGTCTGGG + Intergenic
996588546 5:125119319-125119341 GATGCTGATGCTGCTGGTCTCGG - Intergenic
997082874 5:130761561-130761583 GTTGCTGATGCTGCTGGTCCAGG - Intergenic
997229923 5:132234765-132234787 ATTGCTGACTCTGCTTGTCTTGG - Intronic
997257790 5:132442596-132442618 GATGCTGATGCTGCTGGTCTGGG + Intronic
997691486 5:135830425-135830447 AGTGCTGCTGCTGCCTCTCTGGG - Intergenic
997736182 5:136214154-136214176 GGTGGTGCTGCTGCTTGTGTGGG - Intronic
997840849 5:137237860-137237882 GTTGCAGATGCTGCTGGTCTGGG + Intronic
998946786 5:147348499-147348521 GATGCTGATGCTGCTGATCTGGG + Intronic
999041765 5:148421295-148421317 GGAGCTGATACTGCTGGTCTGGG + Intronic
999101649 5:149030290-149030312 TGTTCTCCTGCTGCTTGTCTTGG + Intronic
999142720 5:149373119-149373141 GATGCTGGTGCTGCTGGTCTGGG - Intronic
999418402 5:151419709-151419731 GGTGCTGATGCAGCTGGACTGGG + Intergenic
999530742 5:152460927-152460949 TGTTCTGATGCTGCTTTAGTTGG + Intergenic
999626677 5:153528581-153528603 GATGCTGATGCTGCTGGTCCAGG + Intronic
999960706 5:156753046-156753068 GATGCTGATGCTGCTTGTTTCGG - Intronic
1000849753 5:166325455-166325477 AATGCAGATGCTGCTTGTCCTGG + Intergenic
1001003625 5:168030550-168030572 GATGCTGATTCTGCTGGTCTGGG + Intronic
1001498481 5:172208465-172208487 TGTGCTGCTTCTGCTGATCTGGG - Intergenic
1002763120 6:217268-217290 TGTGCTGATGGCGCCTGCCTGGG + Intergenic
1003500255 6:6697240-6697262 GGTGCTGATGCTGCTGGTCTGGG - Intergenic
1003557531 6:7154232-7154254 GATGCTAATGCTGCTTGTCTGGG - Intronic
1004170429 6:13291656-13291678 CCTGCTGATGCTGCTGGTCCAGG + Intronic
1004171463 6:13298732-13298754 GATGCTGATGCTGCTTGTCCAGG - Intronic
1004518900 6:16344036-16344058 GCTGCTGATGCTGCTGGTCCAGG + Intronic
1004684714 6:17931977-17931999 GATGCTGATGCTGTTAGTCTGGG - Intronic
1005148560 6:22721343-22721365 TATGCTGATGCTGCTGGTTTGGG + Intergenic
1006226098 6:32537744-32537766 TGTGCTTATTTTGCTTTTCTAGG - Intergenic
1006305257 6:33214774-33214796 GATGCTGATGCTGCTAGTCTGGG - Intergenic
1006470608 6:34226726-34226748 GGTCCTGCTGCTGCTTGTCTGGG - Intergenic
1006806971 6:36794852-36794874 CATGCTGGTGCTGCTGGTCTGGG - Intronic
1006844390 6:37052222-37052244 TGTGCTGATGCTTCGGGCCTGGG + Intergenic
1007034262 6:38658515-38658537 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1007240141 6:40418953-40418975 GATGCTGATGCTGCTGGTCTTGG - Intronic
1007311730 6:40952086-40952108 GATGCTGATGCTGCTAGTCCAGG - Intergenic
1007812534 6:44496602-44496624 GATGCTGATGCTGCCTGTCCAGG + Intergenic
1008018825 6:46552744-46552766 GCTGCTGCTGCTGCTTGTCTGGG - Intronic
1008191914 6:48469197-48469219 TGTGATAATGCTGCTGATCTGGG - Intergenic
1008200127 6:48576243-48576265 TTTGCTGTTTTTGCTTGTCTGGG - Intergenic
1008487259 6:52049885-52049907 GATGCTGATTCTGCTGGTCTGGG - Intronic
1008496407 6:52138457-52138479 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1008617887 6:53243698-53243720 GGTGCTGAGGCTGCTGGTCTGGG + Intergenic
1008670296 6:53761427-53761449 GATGCTGATGCTGCTGGTCTTGG + Intergenic
1008857211 6:56103901-56103923 GGTGCTGAGACTGCTAGTCTTGG + Intronic
1008920698 6:56842676-56842698 ATTGCTGCTGCTGCTTGGCTAGG - Intronic
1009923863 6:70096787-70096809 AATGCTGATGCTGCTGGTCTGGG - Intronic
1010003500 6:70971387-70971409 GATGCTGATGCTGCTAGTCAGGG + Intergenic
1010298021 6:74223032-74223054 TGTGATGCTGCAGCTTGACTGGG - Intergenic
1011026194 6:82872137-82872159 GATGCTGATGTTGCTGGTCTGGG - Intergenic
1012397027 6:98810407-98810429 TGTGTTGATGCTGTGGGTCTGGG + Intergenic
1012771812 6:103447334-103447356 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1012988297 6:105898463-105898485 GATGCTGATGCTGCTGATCTGGG + Intergenic
1013309920 6:108884264-108884286 GATGCTGATGCTGCTGGTCCAGG - Intronic
1013646458 6:112146409-112146431 GATGCTGCTGCTGCTTGTCTGGG - Intronic
1013742697 6:113306555-113306577 GGTGCTGATGCTGCTAATCTGGG + Intergenic
1014015333 6:116523072-116523094 GATACTGATGCTGCTGGTCTAGG + Exonic
1014080212 6:117277742-117277764 TATGCTGCTGCTGCTTTTCTAGG - Intergenic
1014209721 6:118695569-118695591 GATGCTGATGTTGCTGGTCTTGG + Intronic
1014306754 6:119752624-119752646 TCTGCTCATGCTGCTTGCCTAGG - Intergenic
1014558021 6:122856586-122856608 GATGCTGATGTTGCTGGTCTGGG + Intergenic
1014570195 6:122997846-122997868 TGTCCTGGTGCAGCGTGTCTGGG - Exonic
1015029460 6:128576810-128576832 GATGCTGATGCTGCTGGCCTGGG - Intergenic
1015344784 6:132143485-132143507 AGTGCTGCTGCTGCTGTTCTAGG - Intergenic
1016746505 6:147586186-147586208 AGTGCTGCTGCTGCTTCTCTTGG + Intronic
1016884928 6:148950267-148950289 GATGCTGATGCTGCAGGTCTGGG + Intronic
1017275984 6:152569094-152569116 GGTGCTGATGCTGCTGCTCTGGG - Intronic
1017703135 6:157095191-157095213 TCTGCTGAAGCTGCTGGTCTGGG + Intronic
1017795126 6:157836921-157836943 GATGCTGATGCTGCTGGTCTAGG + Intronic
1017936087 6:159006536-159006558 TATGCTGCTGCTTCTTTTCTTGG - Intergenic
1018165066 6:161085838-161085860 TGTGCTGGAGCTGCTTCTCCCGG + Intronic
1018201320 6:161398376-161398398 GATGCTGATGGTGCTAGTCTGGG - Intronic
1018913788 6:168120567-168120589 GGTGCTGTTGCTGCTGGCCTGGG - Intergenic
1018937693 6:168284329-168284351 GGTGCTGAAGGTGCCTGTCTGGG - Intergenic
1020582155 7:10016577-10016599 GCTGTTGATGCTGCTGGTCTTGG + Intergenic
1021164001 7:17311384-17311406 GATGCTGATCCTGCTGGTCTAGG + Intronic
1021614158 7:22485900-22485922 GATGCTGATGCTGCTGGTTTGGG + Intronic
1021746037 7:23742237-23742259 CTTGCTCATGCTGCTTGGCTGGG - Intronic
1021822654 7:24513547-24513569 AATGCTGATGCTGCTAGCCTGGG + Intergenic
1021903396 7:25310085-25310107 GGTGCTGATGCTGCTGGTTCAGG - Intergenic
1021952525 7:25789375-25789397 GATGCTGATGCTGCTGGCCTGGG - Intergenic
1022128498 7:27380467-27380489 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1022242597 7:28527472-28527494 GATGCTGATGCTGCTGGTCTGGG + Intronic
1022429619 7:30303716-30303738 GATGCTGATGCTGCTGGTCTGGG - Intronic
1022463347 7:30633191-30633213 GATACTGATGCTGCTGGTCTAGG - Intronic
1022639250 7:32165852-32165874 TATACTGATGCTGCTGGTCCAGG - Intronic
1023044842 7:36201963-36201985 GATGCTGATGCTGCTGGTCCAGG - Intronic
1023325662 7:39052959-39052981 GATGCTGATGCTGCTAATCTGGG - Intronic
1023488244 7:40709901-40709923 GGTGCTGCTGCTGCTAGTCAGGG + Intronic
1023567653 7:41539548-41539570 GATGCTGATGCTGTTTGTCAAGG - Intergenic
1023576048 7:41628080-41628102 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1023689151 7:42768291-42768313 GATGCTGATGCTGCTAGCCTGGG - Intergenic
1023727478 7:43159026-43159048 GGTGCTGGAGCTGCTGGTCTAGG + Intronic
1023827185 7:44017512-44017534 GATTCTGATGCTGCTTATCTGGG - Intergenic
1024672847 7:51612466-51612488 GATGTTGATGCTGCTGGTCTGGG - Intergenic
1026282845 7:68937032-68937054 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1026402364 7:70027491-70027513 GATGCTGCTGCTGCTGGTCTGGG - Intronic
1026566230 7:71491782-71491804 GGTGCTGATGCTGCTGGCCTGGG + Intronic
1026672611 7:72403148-72403170 TTTGCCGCTGCTGCGTGTCTAGG - Intronic
1026677049 7:72436740-72436762 GATGCTGAGGCTGCTTGTTTGGG - Intronic
1027580784 7:79992709-79992731 TGTGCTGATGCTGTCAGGCTTGG - Intergenic
1028125776 7:87111457-87111479 GATGCTGATGCTGCTGGTGTGGG - Intergenic
1028144081 7:87302744-87302766 AATGCTGATGCTGCAGGTCTGGG - Intergenic
1028171412 7:87600954-87600976 TGTGGTGAGGCTGATTGGCTGGG - Exonic
1028235395 7:88355059-88355081 GGTGCTGATGCTGGCAGTCTGGG + Intergenic
1028243190 7:88446006-88446028 GATACTGATGCTGCTGGTCTGGG - Intergenic
1028342321 7:89736526-89736548 CATGCTGATGCTGCTTGTCAAGG + Intergenic
1028663908 7:93317667-93317689 AATGTTGATGCAGCTTGTCTAGG + Intronic
1029033969 7:97499161-97499183 GTTGTTGATGCTGCTGGTCTGGG + Intergenic
1029738337 7:102477258-102477280 GATTCTGATGCTGCTTATCTGGG - Intronic
1029755467 7:102570914-102570936 GATTCTGATGCTGCTTATCTGGG - Intronic
1029773416 7:102669994-102670016 GATTCTGATGCTGCTTATCTGGG - Intronic
1030060263 7:105615941-105615963 GGTGCTGCTGCTGCTACTCTGGG + Intronic
1030110544 7:106023069-106023091 GGTGCTGATTCTGATGGTCTAGG - Intronic
1030111746 7:106032581-106032603 TGGGCTGAGGATGCTGGTCTGGG + Exonic
1030261678 7:107571615-107571637 AATACTGATGCTGCTGGTCTGGG - Intronic
1030655047 7:112158181-112158203 TGTGCTGATGCTTCTGGTCTTGG + Intronic
1031041368 7:116841772-116841794 GGTGCTGATGCTGCTTGTCAGGG - Intronic
1031126426 7:117778513-117778535 GATACTGATGCTGCTGGTCTGGG - Intronic
1031700300 7:124917169-124917191 TGTTCTGATGAAGCCTGTCTTGG - Intronic
1031977810 7:128104851-128104873 GATGCTGATGCTGCTGTTCTGGG - Intergenic
1032609438 7:133396060-133396082 GATGCTGATGCTGCTGGTCTGGG - Intronic
1033171079 7:139085070-139085092 AGTGCTGATGGTGCTGGTCCGGG - Intronic
1033257713 7:139816581-139816603 GATGCTGATGCTGCTGGTCTGGG - Intronic
1033301757 7:140192441-140192463 TGTGCTGATGCCACTGGTCTGGG + Intergenic
1033311467 7:140264941-140264963 TGTTCTTCAGCTGCTTGTCTAGG + Intergenic
1034517086 7:151589468-151589490 GATGCTGAAGCTGCTAGTCTGGG + Intronic
1035933392 8:3809662-3809684 GATGCTGATGCTGCTAATCTGGG + Intronic
1036272673 8:7321697-7321719 TATGCTGCTGCTGCTTCTCTGGG - Intergenic
1036348675 8:7988647-7988669 TATGCTGCTGCTGCTTCTCTGGG + Intergenic
1036568912 8:9962425-9962447 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1036843942 8:12149119-12149141 TATGCTGCTGCTGCTTCTCTGGG + Intergenic
1036865311 8:12391440-12391462 TATGCTGCTGCTGCTTCTCTGGG + Intergenic
1036905979 8:12708742-12708764 GGGGCAGATGCTGCTTGTCGAGG + Intergenic
1037100736 8:15042292-15042314 TGTGCTGATGCCTCTCTTCTGGG + Intronic
1037340415 8:17838821-17838843 GCTGCTGCTGCTGGTTGTCTGGG + Intergenic
1038772945 8:30500988-30501010 AATGCTGATGCTGTTTGTGTAGG - Intronic
1038815714 8:30902002-30902024 TGTGCTGATGCTGCTGATCTAGG - Intergenic
1038887759 8:31684086-31684108 GGTATTGATGCTGCTGGTCTGGG - Intronic
1039078739 8:33715500-33715522 GATGCTGATGCTGGTGGTCTGGG + Intergenic
1039371954 8:36994027-36994049 GATGGTGATGCTGCTGGTCTGGG + Intergenic
1039844856 8:41318789-41318811 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1041203165 8:55471387-55471409 CGTGCTGATGCTGCTGGTTGAGG - Intronic
1041790624 8:61692810-61692832 TGATCTGATGTTGCTGGTCTAGG + Intronic
1042095961 8:65216327-65216349 GGTGCTGCTGCTGCTCCTCTGGG - Intergenic
1042225758 8:66513274-66513296 TGTGCTGGTGCTGCTAGTCCTGG - Intronic
1042274677 8:66991919-66991941 TCTGCTGCTGCTGCTGGTCTAGG + Intronic
1042404546 8:68388858-68388880 CATGCTGATGCTGCTGGTCCAGG + Intronic
1043822916 8:84890654-84890676 TATACTGATGCTGCTGGTCTGGG + Intronic
1044107564 8:88230224-88230246 GATGCAGATGCTGCTGGTCTAGG + Intronic
1044199619 8:89418349-89418371 GATGTTGATGCTGCTGGTCTGGG + Intergenic
1044203969 8:89470013-89470035 TCTGCTCAGGCTGCTGGTCTGGG - Intergenic
1044407126 8:91840409-91840431 GATGCTGATGCTGCTGGACTGGG + Intergenic
1045183433 8:99811532-99811554 GCTGCTGATGCTGCTGGTCCAGG + Intronic
1045327089 8:101125644-101125666 TCAGCTGATGCTGCTTATTTCGG + Intergenic
1045403970 8:101846818-101846840 TCAGCTGATGCAGCTGGTCTGGG + Intronic
1045642579 8:104268314-104268336 GGTGCTAATGCTGCTGATCTGGG + Intergenic
1045679067 8:104639590-104639612 GATGCTGATGCTGCTATTCTGGG - Intronic
1046154280 8:110266922-110266944 GATGCTGATGATGCTGGTCTAGG - Intergenic
1046503296 8:115106518-115106540 AATGCTGTTGCTGCTAGTCTGGG - Intergenic
1046868709 8:119179894-119179916 GGTGCTGATGTTGCTAGTCCAGG + Intronic
1047018051 8:120744722-120744744 TTTGCAGTTGCTGCTTGTTTTGG - Intronic
1047064738 8:121268376-121268398 GATGCTGATGCTGCTTGTCTGGG - Intergenic
1047570039 8:126087803-126087825 AATGCTGATGCTGCTGGTCTGGG - Intergenic
1047807263 8:128373456-128373478 GGTGCTGCTGCTGCTGGTGTAGG + Intergenic
1048215521 8:132490741-132490763 CCTGCTCATGCTGCTTCTCTGGG + Intergenic
1048481691 8:134801893-134801915 ACTGCTGATGCTGCTCCTCTAGG - Intergenic
1048488435 8:134869840-134869862 GATGCTGATGCTGCTAGTCCGGG - Intergenic
1049491949 8:142909814-142909836 TGTGCTTCTGATGCTTTTCTGGG + Intronic
1049737977 8:144220150-144220172 TGAGCTAATGCTGCTGGTCTGGG - Intronic
1049952548 9:659470-659492 AATGCTGATGCTGCTGTTCTGGG + Intronic
1050003006 9:1098572-1098594 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1050054633 9:1639093-1639115 AGAGCTGATGCTGCTGGTCCTGG - Intergenic
1050109158 9:2196898-2196920 CATGCTGATGCTGCTAGTTTGGG - Intergenic
1050247265 9:3703731-3703753 GGTGCTGATGCTGCTGGTCCAGG - Intergenic
1050249159 9:3725628-3725650 AATGCTGATTCTGCTTATCTGGG - Intergenic
1050280036 9:4040880-4040902 AGTGCTGATGCTGCTGGACCAGG - Intronic
1050702739 9:8359210-8359232 GCTGCTGATGCTGCTGGTCATGG - Intronic
1051125579 9:13800865-13800887 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1051185326 9:14454352-14454374 TGTGCTAATTCTGCTCATCTTGG + Intergenic
1051243056 9:15080526-15080548 TGGGCTGTTCCTGCTTCTCTTGG + Intergenic
1051513641 9:17906577-17906599 TGTGAATGTGCTGCTTGTCTTGG - Intergenic
1052024453 9:23559070-23559092 GATGCTGATGCTGCTAGTCTAGG + Intergenic
1052086548 9:24273725-24273747 GATACTGATGCTGCTGGTCTGGG + Intergenic
1052349405 9:27443145-27443167 GATCCTGATGCTGCTGGTCTAGG + Intronic
1053257702 9:36632197-36632219 GATGCTGATGCTGCAGGTCTTGG + Intronic
1053490809 9:38500319-38500341 TGTGCTGCTGCTTCATGCCTGGG - Intergenic
1053598906 9:39590659-39590681 GGTGCTCATGCTGCTGGTCTGGG + Intergenic
1053856660 9:42345176-42345198 GGTGCTCATGCTGCTGGTCTGGG + Intergenic
1054711607 9:68516536-68516558 GGTGGTGATGCTGCTTCTCCGGG - Intronic
1054870894 9:70046236-70046258 GATGCTGATGATGCTGGTCTCGG + Intronic
1054921388 9:70546245-70546267 AATGTTGATGCTGCTTGTCTGGG - Intronic
1055023756 9:71697186-71697208 GATCCTGATGCTGCTGGTCTGGG + Intronic
1055219633 9:73913095-73913117 AATGCTGATGTTGCTGGTCTGGG - Intergenic
1055257110 9:74384600-74384622 AGTGCTAATGCTTCTGGTCTAGG - Intergenic
1055296316 9:74837349-74837371 GATGCTGATGCTGCTGGTCCAGG + Intronic
1055604389 9:77953164-77953186 TAAGCTGCTGCTGCTGGTCTGGG + Intronic
1055715532 9:79113589-79113611 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1055868197 9:80841320-80841342 GATGCTGATGCTGCTGGTCCTGG - Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056464490 9:86840258-86840280 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1056545736 9:87611824-87611846 GATGCGGATGCTGCTGGTCTGGG + Intronic
1056580722 9:87886752-87886774 TTTCCAGATGCTCCTTGTCTGGG - Exonic
1056823260 9:89859462-89859484 GATGCTGATGTTGCTGGTCTAGG + Intergenic
1056825443 9:89873534-89873556 TGTCCTGATGCTGCAGGTCTGGG + Intergenic
1056928635 9:90855852-90855874 GATGCTGATGCTGCTGGTCTGGG + Intronic
1057671125 9:97089536-97089558 TGTGCTGCTGCTTCATGCCTGGG - Intergenic
1057966271 9:99506355-99506377 TGTGCTAATGCTACTGGTCTTGG - Intergenic
1057985617 9:99710718-99710740 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1058000176 9:99856837-99856859 GATGCTGATGCTGCTGGTCTGGG + Intronic
1058623657 9:106911571-106911593 GATGCTGATGCTGCTGGTCCAGG + Intronic
1058867759 9:109177246-109177268 AATGCTGATGCTGCTAGTCTGGG - Intronic
1059107664 9:111525374-111525396 TGCGCTGCTGCTGCTTCTGTGGG + Intronic
1059522928 9:114960903-114960925 AATGCTGATGCTGCTTATCTAGG + Intergenic
1059952969 9:119486994-119487016 GATGCTGCTGCTGCTGGTCTGGG - Intergenic
1061039696 9:128132821-128132843 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1061164764 9:128915968-128915990 TGTGCTGATGCTGGGGGCCTGGG + Intronic
1061298080 9:129687801-129687823 AGAGCTGATGCTGCCTGCCTAGG - Intronic
1062146299 9:134991613-134991635 GGATCTGCTGCTGCTTGTCTCGG + Intergenic
1203768142 EBV:37101-37123 TGTGCTGGTGCTGCTGGTGGTGG - Intergenic
1186083514 X:5959816-5959838 CGTGGTGATGCTGTTTGTTTTGG + Intronic
1186276051 X:7939169-7939191 TGTGCTGTCTCTGCTGGTCTGGG - Intergenic
1186470828 X:9821036-9821058 GATACTGATGCTGCTGGTCTGGG - Intronic
1186764932 X:12761072-12761094 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1186839343 X:13469522-13469544 GATGCTGATGCTGCTAGTCCAGG + Intergenic
1186974501 X:14886699-14886721 ACTGCTGATGCTGCTGGTCAGGG - Intronic
1186996405 X:15128226-15128248 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1187067985 X:15859514-15859536 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1187105647 X:16238790-16238812 GATGCTGATGCTGCTGATCTGGG + Intergenic
1187117870 X:16371774-16371796 GATGCTGATACTGCTGGTCTGGG + Intergenic
1187246291 X:17555506-17555528 GGGGCTGATGCTGCTGGTCTGGG + Intronic
1187293067 X:17973833-17973855 TTTGTTGGTGCTGCTGGTCTGGG - Intergenic
1187345776 X:18462352-18462374 GATGCTGATGCTGCTGGTCTGGG - Intronic
1187510535 X:19913642-19913664 GATGCTGATGTTGCTGGTCTGGG + Exonic
1187528597 X:20076138-20076160 GATGCTGATGCTGCTAGTCTAGG + Intronic
1187629460 X:21152848-21152870 GATGCTGATGCTGCTGCTCTTGG + Intergenic
1187638090 X:21255520-21255542 GATGTTGATGCTGCTTGTTTTGG - Intergenic
1187707577 X:22023533-22023555 GATGCTGATGCTGCTAGTCTGGG - Intergenic
1187719989 X:22140087-22140109 AATTCTGATGCTGCTGGTCTGGG + Intronic
1187830802 X:23379389-23379411 TATGCTGCTGCTGCTGTTCTAGG + Intronic
1188004826 X:25010126-25010148 TTTTCTGATCCTGCTTCTCTTGG + Intronic
1188022655 X:25175547-25175569 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1188118301 X:26273230-26273252 TGCACTGATGCTTCTTTTCTAGG + Intergenic
1188138013 X:26513309-26513331 CATGCTGATGCGGCTGGTCTAGG + Intergenic
1188143995 X:26587066-26587088 TCTGCTGATGCTCCTTCTCTGGG + Intergenic
1188350677 X:29127375-29127397 GATGCTGATGCTGCTGGTCCAGG + Intronic
1188354694 X:29176405-29176427 GATGTTGATGCTGCTGGTCTAGG + Intronic
1188538721 X:31225752-31225774 GATGCTGATGCTGCTGGTCCAGG + Intronic
1188650106 X:32621823-32621845 TGGGCTGATGCTGTTGGTCCAGG - Intronic
1189124035 X:38426442-38426464 GATGCTGATGCTGCTGGTCCAGG + Intronic
1189124203 X:38428702-38428724 TCTGCTGATGCTGCTGTTCCAGG + Intronic
1189171752 X:38916242-38916264 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1189198207 X:39169274-39169296 GATGCTGATGCTGCTTCTCAGGG - Intergenic
1189211932 X:39290987-39291009 GCTGCTGATGCTGCTGGTCGAGG + Intergenic
1189225937 X:39413412-39413434 TGTGCCTCTGCTGGTTGTCTGGG + Intergenic
1189250721 X:39599058-39599080 GATGTTGATGCTGCTGGTCTGGG + Intergenic
1189302696 X:39963929-39963951 TGTGCTGGTGCAGCTGGGCTTGG + Intergenic
1189600500 X:42619733-42619755 GATGCTGAGGCTGCTTCTCTGGG + Intergenic
1189741392 X:44120588-44120610 GATGCTGAGGCTGCTGGTCTAGG - Intergenic
1189862893 X:45291593-45291615 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1189943913 X:46157403-46157425 GATGCTGATGCTGCTGGTCCGGG - Intergenic
1190104560 X:47550118-47550140 TATTCTGAGGCTACTTGTCTGGG + Intergenic
1190367315 X:49708499-49708521 GATGCTGAGGCTGCTGGTCTGGG + Intergenic
1190399344 X:50016071-50016093 GATGCTGATGCTGCTAGTCTTGG - Intronic
1190732316 X:53234228-53234250 GGTGCTGATCCGGCTTGGCTTGG + Exonic
1190827604 X:54031956-54031978 GATGCTGATGCTGCTGGTCCAGG + Intronic
1190827648 X:54032291-54032313 AATGCTGATCCTGCTGGTCTGGG + Intronic
1191668853 X:63730620-63730642 GATACTGATGCTGCTGGTCTGGG + Intronic
1192108071 X:68335458-68335480 GATGCTGATGCTGTTTTTCTAGG + Intronic
1192150672 X:68710482-68710504 GATGTTGATGCTGCTAGTCTGGG + Intronic
1192175742 X:68884168-68884190 GGTGTTGAAGCTGCTGGTCTGGG - Intergenic
1193801421 X:85941272-85941294 GTTGCTCATGCTGCTGGTCTAGG - Intronic
1194425184 X:93728465-93728487 AATACTGATGCTGCTTGTCAGGG - Intergenic
1194872076 X:99144811-99144833 GATGCTGATGCTGCTGATCTAGG + Intergenic
1195652484 X:107299843-107299865 TGAGCTGAAGCTGCTGGTCCGGG - Intergenic
1195821782 X:108953518-108953540 GGTGCTGATGCTGCTGGTAAAGG - Intergenic
1196111442 X:111951269-111951291 AATGCTGATGCTGCTAGTCAAGG + Intronic
1196963944 X:121035093-121035115 AATGCTGATGCTGCTGGCCTAGG - Intergenic
1197328882 X:125128852-125128874 TGTGCTGATGCTGTTGGTGTTGG + Intergenic
1197440952 X:126489426-126489448 TATTCTGATGCTGCTGGTCTGGG - Intergenic
1197760469 X:130024459-130024481 TGTGATGATTCTGCTTGGCCGGG + Intronic
1198167269 X:134070384-134070406 TTTGCCCATGCTGCTTGCCTGGG + Intergenic
1198228018 X:134664266-134664288 AATGCTGATGCTGTTGGTCTGGG + Intronic
1198342933 X:135732517-135732539 TGGGCAGAGGCTGCTTGGCTGGG - Intergenic
1198345056 X:135750778-135750800 TGGGCAGAGGCTGCTTGGCTGGG + Intergenic
1198464597 X:136893570-136893592 GGTGTTGATGCTGCTATTCTGGG - Intergenic
1198562068 X:137861147-137861169 GATGCTGATGCTGCTGGTCGGGG + Intergenic
1198651159 X:138865079-138865101 GGTGCTGATGCTGCTGGTCAAGG + Intronic
1198950854 X:142070521-142070543 GATGCTGACGCTGCTGGTCTGGG - Intergenic
1199766362 X:150944492-150944514 GATGCTGATGCTGCTGGTCCGGG + Intergenic
1199870566 X:151894594-151894616 TATCCTGATGCTGATGGTCTGGG - Intergenic
1200013745 X:153142317-153142339 TTTGCAGATGCAGCTTGTTTTGG + Intergenic
1200025856 X:153257638-153257660 TTTGCAGATGCAGCTTGTTTTGG - Intergenic