ID: 948139872

View in Genome Browser
Species Human (GRCh38)
Location 2:235664644-235664666
Sequence AAACCAAGCTTGCTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948139872 Original CRISPR AAACCAAGCTTGCTTCTCAC TGG Intronic
903028122 1:20443812-20443834 GAACCAAGCCTGCTTCTCAGAGG + Intergenic
913449527 1:118983729-118983751 AAACCAAGGTTCCTTGTCCCTGG + Intronic
914324328 1:146596755-146596777 AAACCAAGATAGCATCTCCCAGG - Intergenic
915745438 1:158153101-158153123 AAACCCAGCTTGCTCGTCACTGG + Intergenic
916004504 1:160647003-160647025 ACACGAAGCTTGCTTCTGCCTGG - Exonic
916118208 1:161506100-161506122 AACCCAAGCTTGATTTTCAGTGG - Intronic
923407207 1:233673841-233673863 TGACCAAGCTCGCTTCTCCCTGG - Intergenic
1063525587 10:6781687-6781709 AAAACAAGCTTTCCTCTCTCTGG + Intergenic
1064948185 10:20816427-20816449 AAAGCCAGCATGCTTCTCACTGG + Intronic
1066994638 10:42552557-42552579 AATCCAACCTTACTTATCACAGG + Intergenic
1067339217 10:45387640-45387662 GAGCCAGGCTTGGTTCTCACTGG - Intronic
1067815391 10:49471675-49471697 AAAGGAAGCTCTCTTCTCACAGG + Intronic
1071318281 10:84424877-84424899 AAACTGGGCTTGCTTCCCACAGG + Intronic
1071954299 10:90741124-90741146 AAAGCAAGCTGTCCTCTCACAGG - Exonic
1075062909 10:119269303-119269325 GTACCATTCTTGCTTCTCACGGG - Intronic
1075955604 10:126520435-126520457 AAACCCAGCCTGCTTCCCACAGG + Intronic
1076025126 10:127105717-127105739 AAACAATGCTAACTTCTCACAGG - Intronic
1077574554 11:3372168-3372190 AACCCAAGCTTGCCACTTACAGG - Intronic
1078059193 11:8032409-8032431 AATCCAAACTTGCTGCCCACAGG - Intronic
1087509191 11:99068546-99068568 TAACCCAGCCTGCTTCTCACGGG - Intronic
1087637342 11:100717091-100717113 AAACCAAGACTGCTTCTCCGTGG - Intronic
1088356183 11:108946143-108946165 AAAACAAACTTATTTCTCACTGG - Intergenic
1088902682 11:114130068-114130090 AAACAAAGCCTGCTCCTCCCTGG - Intronic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1093255221 12:16858423-16858445 AAAACAAGCTTACTTCTCTGAGG - Intergenic
1096310123 12:50513421-50513443 AAACCAAGCTTATATGTCACAGG - Intronic
1096400327 12:51300638-51300660 AGACATAGTTTGCTTCTCACTGG - Intronic
1096686342 12:53290783-53290805 AAACCAAGCTTCTTTCTCACAGG - Intronic
1098289943 12:68948618-68948640 CAACCAAGCTTCATTCTGACTGG - Intronic
1100116991 12:91318568-91318590 AGACCAAGCTTCCAACTCACAGG - Intergenic
1101748682 12:107564711-107564733 TAACCATGCTTGCTCCTTACTGG - Intronic
1103930950 12:124450530-124450552 ACGGCTAGCTTGCTTCTCACTGG - Intronic
1107704531 13:43087423-43087445 AAAACAATCTTCCTTCTCAAAGG - Intronic
1109683281 13:65781802-65781824 ATACCCAGCTTTCTTTTCACTGG - Intergenic
1110893402 13:80717983-80718005 AAACTAAGCAAGTTTCTCACTGG - Intergenic
1111313459 13:86519650-86519672 AAACCAACCTTGCATCCCAGGGG + Intergenic
1112418635 13:99227287-99227309 AGACAAGGCTTGCATCTCACTGG + Intronic
1112662963 13:101534589-101534611 GAACTAAGATTTCTTCTCACTGG - Intronic
1113307937 13:109098301-109098323 AAACAAAACTTACTTCTCATTGG - Intronic
1113468172 13:110526327-110526349 GAACCAGGCTTACTTCTCCCAGG - Intronic
1115066211 14:29263914-29263936 GCACCAAGATTGCTGCTCACAGG + Intergenic
1117837642 14:59823898-59823920 ATACCAAGCTTGCAACTCATTGG - Intronic
1118054094 14:62060640-62060662 AAACCAACCTTGCCTCTCTAGGG + Intronic
1118357498 14:65026878-65026900 AAACAAAACTTGCTTCTTACTGG + Intronic
1119579000 14:75757340-75757362 AAACCAAGCTCAATTCTCATGGG - Intronic
1119659491 14:76440022-76440044 AAACCCTGGGTGCTTCTCACTGG + Intronic
1119959118 14:78834626-78834648 AAACGAAGCTTTGTTCTCAGTGG - Intronic
1120343238 14:83248626-83248648 AGACCACTCTTGGTTCTCACTGG + Intergenic
1120534965 14:85683464-85683486 AAGCCAAGCTTGCTCCTGAGAGG + Intergenic
1121123368 14:91390443-91390465 AAACCAAGCTGGCATCTCAGAGG + Intronic
1123035462 14:105470094-105470116 AAACCAAGCGTGCTGCCCGCCGG + Exonic
1123137053 14:106037845-106037867 AAACCCAGGCTGCTTCTCATTGG - Intergenic
1202890765 14_KI270722v1_random:155021-155043 AAACCTGGCTTGCTTCTGGCAGG - Intergenic
1124945403 15:34261037-34261059 AGACCAAGTTAGTTTCTCACTGG + Intronic
1125200447 15:37097578-37097600 AACCCAAAGTTGCTTCTCATCGG + Intronic
1129622700 15:77163452-77163474 AAACCAAGTGAGCTTCCCACAGG - Intronic
1130150995 15:81311547-81311569 CAACCAAGAATGCATCTCACTGG - Exonic
1130454571 15:84092404-84092426 AACCCAAGCTAGCTTGTCTCTGG - Intergenic
1130920442 15:88339549-88339571 GAACCCAGCGTCCTTCTCACTGG - Intergenic
1131048584 15:89332019-89332041 AAACAAATCTTTCTTGTCACTGG + Intronic
1131172809 15:90190555-90190577 AAACCAACCTTCCTTCCCAAAGG - Intronic
1133055472 16:3143543-3143565 AGACCTTGCTTGCTTCTTACGGG - Intergenic
1133700417 16:8303163-8303185 AAAAAAAAATTGCTTCTCACTGG + Intergenic
1134092732 16:11400115-11400137 AAAGCAACCGTGCTCCTCACTGG + Intronic
1135117775 16:19738261-19738283 AAACCCAGCTTCCTTCTATCTGG + Intronic
1135240526 16:20803583-20803605 AAACTAAGCATACTACTCACTGG + Exonic
1140009234 16:71114089-71114111 AAACCAAGATAGCATCTCCCAGG + Intronic
1143835064 17:9685044-9685066 AAACAATGCTTGCTTATCGCAGG - Intronic
1146948875 17:36892182-36892204 ACACCCAGCTTGCATCTCCCAGG + Intergenic
1147496841 17:40924743-40924765 AAACCAAGCTTGCAGCTGAAAGG - Intronic
1151087849 17:71401446-71401468 AAACCAAGCTTATTTTTCAAAGG + Intergenic
1151341459 17:73473562-73473584 AAACCAAACTGGCATCTCCCAGG - Intronic
1153371733 18:4324688-4324710 GAACCAACCTTGCTTCCCAGGGG - Intronic
1155377330 18:25174544-25174566 AGACCAAGCTTGCTTCTCTCAGG - Intronic
1156617238 18:38801815-38801837 ATAACAACCTTGCATCTCACTGG + Intergenic
1158447179 18:57531729-57531751 AAACCAAGCATGATACACACTGG + Intergenic
1164872340 19:31656511-31656533 GCACCAAGCTTGCTCCTCTCAGG - Intergenic
1202666186 1_KI270708v1_random:121858-121880 AAACCTGGCTTGCTTCTGGCAGG - Intergenic
925494190 2:4427554-4427576 AGACAAAGCTTGCTTCTGGCAGG - Intergenic
926385578 2:12332816-12332838 AATCCCAGCTTTCTGCTCACTGG + Intergenic
928397431 2:30953828-30953850 AAATCAAGCTTGCTTCCTACCGG - Intronic
932793133 2:74673168-74673190 AAATCAAGCTTGTTTCTCTGGGG - Intronic
934606584 2:95699794-95699816 ATGCCAAGCCTGCTTCTCCCAGG + Intergenic
936539988 2:113341922-113341944 ATGCCAAGCCTGCTTCTCCCAGG + Intergenic
937427031 2:121808650-121808672 AAACCAAGAATGAGTCTCACTGG + Intergenic
939274654 2:139985602-139985624 AAACCAACCTTGCATCCCTCTGG + Intergenic
939783698 2:146481719-146481741 AAACCAAACCTGCTTCTAATGGG + Intergenic
940420372 2:153474410-153474432 AAGCCATCCTGGCTTCTCACTGG - Intergenic
940522735 2:154771463-154771485 AAATCAAGTTAGCTTTTCACAGG - Intronic
943318562 2:186417873-186417895 ACATCAAGCTGGTTTCTCACTGG - Intergenic
944592254 2:201228719-201228741 AAACCAAGCCCATTTCTCACAGG - Intronic
946830603 2:223724563-223724585 AAACCATGCTCCTTTCTCACTGG - Intergenic
948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG + Intronic
948139872 2:235664644-235664666 AAACCAAGCTTGCTTCTCACTGG + Intronic
1168916738 20:1494722-1494744 AAGCCATGCTTGGTTCTCATGGG - Intergenic
1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG + Intronic
1169811605 20:9614198-9614220 AAATGAAGGATGCTTCTCACGGG + Intronic
1174100850 20:48125164-48125186 AAAACAACCTTGCTCCTCCCTGG + Intergenic
1175065219 20:56278510-56278532 AATCCAAGCTTATTTCTCCCTGG - Intergenic
1179682685 21:43035549-43035571 AAACCATTCTTGCTTTTTACAGG - Intergenic
1179943410 21:44654376-44654398 AAAACAGGCTTGCAGCTCACAGG + Exonic
1180816470 22:18792650-18792672 AAACCAAGCTTGGGGCTCATTGG - Intergenic
1181202657 22:21226982-21227004 AAACCAAGCTTGGGGCTCATTGG - Intronic
1181862315 22:25828666-25828688 AAACCAAGCTCACCTCTTACAGG - Intronic
1181979187 22:26753811-26753833 AAACCAAGTCTGTTTATCACTGG + Intergenic
1183189739 22:36314125-36314147 AAAGCAAGCCTGGTACTCACTGG + Exonic
1184431504 22:44443777-44443799 AGGCCCACCTTGCTTCTCACTGG - Intergenic
1184593140 22:45499204-45499226 AATCCAAGCTCGCTACTCTCTGG - Intergenic
1203224256 22_KI270731v1_random:68431-68453 AAACCAAGCTTGGGGCTCATTGG + Intergenic
1203266570 22_KI270734v1_random:18361-18383 AAACCAAGCTTGGGGCTCATTGG - Intergenic
949270757 3:2213699-2213721 AAACAAAACTTGCTTTTCAGGGG - Intronic
949323443 3:2837858-2837880 ATACCAAATTTGCTTCCCACTGG + Intronic
950967705 3:17157462-17157484 AAGCCAGGCTTCCTTCTCAAAGG - Intronic
952316950 3:32239389-32239411 AAGCCAAGCTTCCTGCTCCCAGG - Intronic
955778483 3:62459264-62459286 AAACCCAGCTGGCTTATAACAGG + Intronic
956471622 3:69573119-69573141 AAGCCATCCTTGCCTCTCACTGG - Intergenic
956607555 3:71088144-71088166 CAACCAAGCTTGTTTCTGATTGG + Intronic
956831990 3:73060041-73060063 AGTCCAATCTTGGTTCTCACAGG - Intronic
957089694 3:75717510-75717532 AAACCTGGCTTGCTTCTGGCAGG + Intronic
957458803 3:80490005-80490027 AAAGGAAACTTTCTTCTCACAGG + Intergenic
961713267 3:128843012-128843034 AAGCCAGGCCTGCTTCCCACAGG + Intergenic
962432829 3:135335857-135335879 AATCCAAGCTTGCATGTCCCTGG + Intergenic
966941437 3:184750440-184750462 AGCCCAGGCTTGCTTCTCTCTGG - Intergenic
969574416 4:8028228-8028250 GAGCCAAGCTTGCATCTCGCCGG - Intronic
969986245 4:11214047-11214069 AAACCAGGCTTGCTGCACACTGG - Intergenic
970768697 4:19583925-19583947 AAGCCAGGGTTGCTTCTGACTGG - Intergenic
972745522 4:41928474-41928496 GAGCCAGGCTTGATTCTCACTGG - Intergenic
973295920 4:48520549-48520571 AAATCTGGCTTACTTCTCACAGG + Intronic
973758192 4:54095169-54095191 AAAATAATCTTGCTTCTCCCTGG - Intronic
975297378 4:72750262-72750284 AAATCAAGCTGCCATCTCACAGG + Intergenic
980816233 4:137950092-137950114 AAACCAATCCTAGTTCTCACTGG - Intergenic
984320052 4:178184267-178184289 AAAACAATCTTGCTTTTCAGAGG - Intergenic
985753567 5:1699015-1699037 AAATGCAGCTTGCTTCTCATTGG + Intergenic
988305927 5:29494353-29494375 AACCCAAACTTGCACCTCACTGG + Intergenic
989115486 5:37948622-37948644 AAAAGAAGCTTACTTCCCACTGG - Intergenic
989332363 5:40274821-40274843 CAACCAAGCTTTCTACTCAAAGG + Intergenic
992137289 5:73759945-73759967 AAACAAATCTTGCTTCCTACTGG - Intronic
993602713 5:89948356-89948378 AAAACAATCTTGTTTCTCATGGG - Intergenic
993752423 5:91687437-91687459 AAACAAAGCTTGTTTATCAGGGG - Intergenic
994954649 5:106512104-106512126 AAAACAGGCTTCTTTCTCACAGG + Intergenic
997284021 5:132665523-132665545 AAAACAAGGTTGCTTCTAGCAGG + Intergenic
1000890422 5:166795400-166795422 AGACCAGCCTGGCTTCTCACAGG - Intergenic
1001380048 5:171299455-171299477 AAACAATGTTTGCTTTTCACTGG + Exonic
1004792354 6:19040835-19040857 AAACCAAGCTAGCTTATCTCTGG - Intergenic
1005102697 6:22190489-22190511 AAACAAAGCATGATTATCACAGG - Intergenic
1006261593 6:32878263-32878285 AAAACTAGCTTTTTTCTCACAGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1010812101 6:80312751-80312773 GAACCAACCTTGCATCCCACGGG + Intronic
1011734601 6:90297694-90297716 CCACCAAGCTTTCTTCTGACAGG - Intergenic
1013463298 6:110396085-110396107 AGACCAAGATTGCTACTCAATGG + Intronic
1014075065 6:117226171-117226193 GAACAAAGCTTTATTCTCACAGG + Intergenic
1014537571 6:122633608-122633630 AAACCAAGCTCACTTATCCCTGG - Intronic
1019490141 7:1308801-1308823 AAAACAAGGTTGATTTTCACAGG - Intergenic
1020098358 7:5380826-5380848 AGATCAAGCTTCCTTCTCCCAGG + Intronic
1021903365 7:25309838-25309860 AACCCAAGATTTCTTCTCAAGGG - Intergenic
1023290917 7:38668189-38668211 AAACCAACCTTGCATCCCAGGGG + Intergenic
1027124665 7:75547813-75547835 AAACCATGCTTCTTTTTCACAGG - Exonic
1028474914 7:91242638-91242660 AAAAAAAGCTTGCTTCACAAGGG - Intergenic
1036197554 8:6733574-6733596 ACACCAAGCTTGGTTCTCAAGGG - Intronic
1038154921 8:24980224-24980246 TAACCAAGCCTGATTCTTACTGG + Intergenic
1045799340 8:106083745-106083767 TAACCAAGTTTGCCTCTTACAGG - Intergenic
1047773215 8:128047278-128047300 ACACCAACCTCTCTTCTCACAGG - Intergenic
1047914486 8:129567387-129567409 AAACCAAATTTGCTTATGACTGG + Intergenic
1049415917 8:142495056-142495078 AAACCACTGTTGATTCTCACTGG - Intronic
1051237661 9:15018841-15018863 CAATCAAGTTTGCTACTCACTGG - Intergenic
1058259813 9:102814654-102814676 ACACCAAGCTTGATTGTCCCAGG - Intergenic
1059324172 9:113493562-113493584 AAACAAAACTAGCTTCTCACAGG - Intronic
1059433133 9:114261557-114261579 AAGCCAAGCCAGCTTCTCCCGGG + Intronic
1062190902 9:135247358-135247380 AAAACAAGCCTACTTCTCCCCGG - Intergenic
1062479283 9:136743997-136744019 AAACCAAGGATGCTTTTGACTGG - Exonic
1187643215 X:21317639-21317661 AAAACAAGATTACTTCTCAAAGG - Intergenic
1190432036 X:50387469-50387491 AAAGCAAACATGCCTCTCACTGG - Intronic
1190950085 X:55134923-55134945 AAATTAAGCTTGCTTCTCCATGG + Intronic
1190966418 X:55305568-55305590 TAACCAAGCTTGATTGTCCCAGG + Intergenic
1194190438 X:90829129-90829151 AAACCAACCTTGCATCTCAGGGG + Intergenic
1194751636 X:97691671-97691693 AACCCAACCTTATTTCTCACTGG - Intergenic
1195084086 X:101397912-101397934 AACCCTAGCTTCCTTTTCACAGG + Exonic
1195833926 X:109091199-109091221 GAACCAAGCTTGCATCCCAGGGG + Intergenic
1195844242 X:109209141-109209163 ACACCAAGCTTGATTATCCCAGG + Intergenic
1198483745 X:137065700-137065722 AAATCATTCTTGCTTCTCAATGG + Intergenic
1199603680 X:149559445-149559467 ACACCAGGCAGGCTTCTCACTGG + Intergenic
1199646707 X:149920029-149920051 ACACCAGGCAGGCTTCTCACTGG - Intergenic
1199929395 X:152503275-152503297 ATAACAAACTCGCTTCTCACGGG + Intergenic
1200537097 Y:4411551-4411573 AAACCAACCTTGCATCTCAGGGG + Intergenic
1201279381 Y:12327841-12327863 AAACCAAGCTAGGTTATCCCAGG - Intergenic