ID: 948140444

View in Genome Browser
Species Human (GRCh38)
Location 2:235669379-235669401
Sequence GCCAAGCCCCAGAGTGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948140440_948140444 -3 Left 948140440 2:235669359-235669381 CCCTCGTTTTGTTCTTGCAGGCC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 948140444 2:235669379-235669401 GCCAAGCCCCAGAGTGGGCGTGG 0: 1
1: 0
2: 3
3: 19
4: 218
948140439_948140444 -2 Left 948140439 2:235669358-235669380 CCCCTCGTTTTGTTCTTGCAGGC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 948140444 2:235669379-235669401 GCCAAGCCCCAGAGTGGGCGTGG 0: 1
1: 0
2: 3
3: 19
4: 218
948140441_948140444 -4 Left 948140441 2:235669360-235669382 CCTCGTTTTGTTCTTGCAGGCCA 0: 1
1: 0
2: 0
3: 6
4: 151
Right 948140444 2:235669379-235669401 GCCAAGCCCCAGAGTGGGCGTGG 0: 1
1: 0
2: 3
3: 19
4: 218
948140437_948140444 29 Left 948140437 2:235669327-235669349 CCTCATTTAAACGCGCAGCAGGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 948140444 2:235669379-235669401 GCCAAGCCCCAGAGTGGGCGTGG 0: 1
1: 0
2: 3
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948140444 Original CRISPR GCCAAGCCCCAGAGTGGGCG TGG Intronic
900607264 1:3529396-3529418 GCCAAGCCCCACACGGGGCAGGG + Intronic
901181838 1:7347307-7347329 GCCAAGCTCCGGAGAGGGAGTGG + Intronic
901630890 1:10647670-10647692 GCCATGCCCCAGAGAGGCTGGGG + Intronic
902222611 1:14976599-14976621 GCCCAGCCCCAGAGGAGGCCGGG + Intronic
902388267 1:16088407-16088429 ACCAAGGCTCAGAGAGGGCGTGG + Intergenic
902564689 1:17303654-17303676 GCATAGCCCTAGAGTGGACGAGG + Intergenic
903287363 1:22285527-22285549 ACCAAGGCCCGGAGAGGGCGGGG - Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903771468 1:25767035-25767057 ACCAAGGCCCAGAGTGGGCAGGG + Intronic
903780937 1:25819828-25819850 GCGCGGCCCCCGAGTGGGCGAGG - Intronic
903885331 1:26537604-26537626 GCCAAGGCCCAGAGTGTACAAGG - Intronic
905226462 1:36482287-36482309 GCCGACCCAGAGAGTGGGCGGGG + Intronic
905662841 1:39740632-39740654 GCCTAGCCCCATAATGGGGGTGG + Intronic
905902144 1:41588717-41588739 GCCAGGGCGCAGAGTGAGCGAGG + Intronic
907325384 1:53634761-53634783 GTCCAACCCCAGAGTGGGTGGGG + Intronic
907469538 1:54664371-54664393 GCAGAGCCCCAGGGTGGGGGTGG + Intronic
907481237 1:54746826-54746848 ACCAAGGCCCAGAGAGGGCAGGG - Intergenic
908053085 1:60254269-60254291 GCCAAGCCCCAAAGTTGACATGG - Intergenic
912377295 1:109220640-109220662 GGCAAGCCACAGAATGGGAGAGG - Intronic
912544429 1:110440671-110440693 GAGAAGCCCCAGAGTAGGAGGGG + Intergenic
912764508 1:112396384-112396406 GCCCATCCCCTGAGGGGGCGGGG + Intronic
912953072 1:114133963-114133985 GTCAAGCACCAGGGTGGGGGTGG + Intronic
920341171 1:205276073-205276095 GCCAAGCCCCAGCTTGAGAGAGG + Intergenic
1063347540 10:5325728-5325750 GCCAACCCCCAGAGTAGCCTGGG - Intergenic
1065158605 10:22895450-22895472 GCCACTCCCCAGAGTGTGAGAGG - Intergenic
1069743383 10:70699756-70699778 ACCAAGCCCCAGAATGGGGGAGG + Intronic
1070770924 10:79081952-79081974 GTCAAACCCCAGAGGGGACGAGG + Intronic
1071563539 10:86660211-86660233 GCCCAGCCCCGGGGTGGGTGGGG + Intronic
1072786410 10:98286087-98286109 GCCAAGTCCCAGAATGGGTGGGG + Intergenic
1074363071 10:112838240-112838262 GCCAATCCCCAGGGAGGGCCTGG + Intergenic
1074781079 10:116802789-116802811 GCCAAGCCCAACAGTGGGCAGGG - Intergenic
1075022862 10:118964236-118964258 CCCAAGCCTCAGATTGGGTGGGG + Intergenic
1075945636 10:126430736-126430758 GCCAAGCATCAGAGTTGGAGTGG + Intronic
1077104086 11:834464-834486 CCCAAGGGCCAGAGTGGGCCGGG - Intronic
1077110054 11:858349-858371 GCACAGCCCCAGGGTGGGCAGGG - Intronic
1077125488 11:933683-933705 GCCCAGCACCAGGGTGGGAGAGG + Intronic
1077197617 11:1289140-1289162 GTCAAGCCCCAGAGCAGCCGGGG + Intronic
1077415161 11:2421347-2421369 GCCGAGGCCCAGAGAGGGCAAGG + Intronic
1078326130 11:10382675-10382697 GCCAAGACTCAGAGTGGGAGAGG - Intronic
1078341353 11:10499822-10499844 GCCAAGCCCCTGTGTGGTGGTGG - Intronic
1080432804 11:32214276-32214298 GCAAAGCCCTAGAGTGGCAGGGG + Intergenic
1081660946 11:44888038-44888060 GCCAAGCCTCAGAGTGGGGCAGG - Intronic
1083150174 11:60786999-60787021 GCAAAGCAGCAGAGTGGGCACGG - Intronic
1083802901 11:65057240-65057262 ACCAAGCCCCAGGGTGGGGCAGG - Intronic
1085255111 11:75168229-75168251 ACCAAGGCCCAGAGTGGGTAAGG + Intronic
1086334275 11:85783903-85783925 GCCAGGCCACAGAGTGTGCAGGG - Intronic
1086454098 11:86944535-86944557 GCCAAGACGTAGAGAGGGCGAGG - Intronic
1089615698 11:119693554-119693576 GTCATGGCCCAGAGTGGGAGGGG - Intronic
1090660905 11:128880847-128880869 GCCAAGCCCCAGAGCTGTGGGGG - Intergenic
1090736597 11:129616655-129616677 GCCAAGAGCTAGAGTGGGCAGGG + Intergenic
1091589746 12:1836138-1836160 GCCAAACCAGAGAGTGGGTGGGG + Exonic
1096786287 12:54018879-54018901 GCCAAGTCCCAGTGGGGGAGGGG + Intronic
1101878511 12:108610830-108610852 TCCAAGCCCCTGAGAGGGAGAGG - Intergenic
1101882059 12:108632263-108632285 GCCAGGCCCCTCAGTGGGCCGGG - Intronic
1102575904 12:113856045-113856067 CACAAGCCCCAGTGTGGGAGAGG + Intronic
1103241063 12:119413773-119413795 GCCAGGCCCCAAGGTGGGCTGGG - Intronic
1103797625 12:123515742-123515764 GCCAAACACCAGGCTGGGCGTGG + Intronic
1104704516 12:130933494-130933516 GACAAGCCCCACAGTAGACGAGG + Intergenic
1105964143 13:25370128-25370150 GCTAAGCTTCAGAGTGGGAGAGG - Intergenic
1106327518 13:28708353-28708375 GCAAAACCACAGAGTGGGCTGGG - Intronic
1108363141 13:49685955-49685977 GCCCAGCTTCAGAGAGGGCGTGG + Intronic
1111541444 13:89672293-89672315 GCCAAGGAACAGAGTGGGAGTGG - Intergenic
1112222549 13:97505870-97505892 TCCAAGACCCAGTGTGGGAGGGG - Intergenic
1112727331 13:102319452-102319474 GGCAAGCCCCAGAGAGGGATGGG - Intronic
1113890043 13:113730940-113730962 GCCCAGCACTAGAGTGGGCATGG + Intronic
1114211613 14:20620384-20620406 GCCATGCCCCAGTCTGGGCATGG - Intergenic
1116436267 14:44897770-44897792 GCCCAGGGCCAGGGTGGGCGTGG + Intronic
1118723315 14:68609239-68609261 GCCAGGCCCCAGAGGAGGTGCGG + Intronic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121235817 14:92390614-92390636 CCCCTGCCCCAGAATGGGCGGGG + Intronic
1122037826 14:98961349-98961371 GCCAAGGGCCAGGGTGGGAGAGG + Intergenic
1122556512 14:102583625-102583647 GCACAGCCCCGGAGTGGGCAGGG + Intergenic
1123071056 14:105642741-105642763 GGCATGCCCCCGAGTGGGCATGG + Intergenic
1123076016 14:105667782-105667804 GGCATGCCCCCGAGTGGGCATGG + Intergenic
1124142577 15:27089597-27089619 GCCAGGCCTCAGGGTAGGCGGGG + Intronic
1124614290 15:31230471-31230493 GCCAGGCCACAGACTGTGCGGGG - Intergenic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1127612460 15:60650437-60650459 TCCCACCCCCAGAGTGGGGGAGG + Intronic
1127862211 15:63003824-63003846 GCCTAGCCACAGAGAGGGCCAGG - Intergenic
1128398602 15:67254470-67254492 GACAAGGCCCAGAGAGGCCGTGG + Intronic
1130657082 15:85799209-85799231 GGCAAGGCCCTGAGTGGGAGTGG - Intergenic
1132949165 16:2550940-2550962 GCCAAGGACCAGCGTGGGCAGGG + Intronic
1132965423 16:2651188-2651210 GCCAAGGACCAGCGTGGGCAGGG - Intergenic
1133195919 16:4170091-4170113 GCCAAGCGGCTGAGCGGGCGTGG - Intergenic
1133215964 16:4292683-4292705 TCCAAGCCCCAGTGTGGGTCCGG + Intergenic
1133233748 16:4378374-4378396 GCCAGGTTCCAGAGTGGGAGGGG - Intronic
1133718461 16:8471644-8471666 GCCAAGCCCCAGTTTGGGCACGG - Intergenic
1134395414 16:13858120-13858142 GGAAGGCCCCAGAGTGGGAGAGG - Intergenic
1135328501 16:21542884-21542906 GCCCAGCCCCAGTGTGGCCCCGG - Intergenic
1135424744 16:22326820-22326842 GCCACGCCCCAGCTTGGGCCTGG + Intronic
1136338847 16:29628857-29628879 GCCCAGCCCCAGTGTGGCCCCGG - Intergenic
1136554028 16:30997401-30997423 GCCAAGCACCGGCGGGGGCGTGG - Intronic
1140985738 16:80156648-80156670 GGCAAGACTCAGAGTGGGCAGGG + Intergenic
1141830662 16:86508517-86508539 GCCAAGCCCCAGCGCGAGCTGGG - Intergenic
1142010692 16:87712336-87712358 GCCCATGCCCAGTGTGGGCGTGG + Intronic
1142265360 16:89061922-89061944 GTGAAGCCCCAGGGTGGGTGGGG + Intergenic
1142431077 16:90027742-90027764 GCCCAGTCCCCGGGTGGGCGTGG + Intronic
1142468405 17:148556-148578 GCCAGGCCCCAGAGAGGCCCAGG - Intronic
1143247650 17:5500081-5500103 GCTGTGCCCCAGAGTTGGCGCGG - Intronic
1143366882 17:6414326-6414348 GCCATTCCCCAGTGTGGGAGGGG + Intronic
1143378493 17:6480938-6480960 GCCAGGGCCCACAGTGGGCAAGG + Intronic
1145248526 17:21285003-21285025 GCCCGGCCCCAGATTAGGCGCGG - Intronic
1147700149 17:42388526-42388548 GCCCAGCCCCAGCCTGGCCGAGG + Exonic
1147919244 17:43906291-43906313 TCCAAGCCTCTGAGAGGGCGGGG + Intronic
1148562039 17:48611839-48611861 GCCAAGTCCCTGAGAGGGAGAGG + Intronic
1150488921 17:65561356-65561378 GCCGAGCCGCGGCGTGGGCGCGG - Intronic
1151576012 17:74953000-74953022 GCCCAACGCCAGAGTGGGTGAGG - Exonic
1151914727 17:77109110-77109132 GCCAAACCCCAGGCTGGGTGCGG - Intronic
1152214175 17:79022963-79022985 GCCTTGCCCCAGGCTGGGCGAGG - Intronic
1152374681 17:79913080-79913102 GCCAAGGGGCAGGGTGGGCGTGG - Intergenic
1154021567 18:10668167-10668189 GAGAGGGCCCAGAGTGGGCGGGG + Intronic
1159582322 18:70247446-70247468 ACCAAGCCCCAGAGGAGACGGGG + Intergenic
1160444202 18:78914441-78914463 GCCAAACCCCAGCGTGGTCCAGG + Intergenic
1161450824 19:4344348-4344370 GACAAGCCCCAGTGTGGGGAGGG + Intronic
1162401539 19:10449726-10449748 GTCAAGACCCAGGGTGGGCCTGG - Intronic
1162487847 19:10972655-10972677 GCAAAGGCCAAGAGTGGGCAGGG - Intronic
1163304450 19:16469094-16469116 GCCATGCCCCAAAGTGGTCTGGG - Intronic
1163444223 19:17337526-17337548 GTCAAGCCGCGGAGTGGGCGGGG + Intronic
1163651889 19:18522525-18522547 GGAAAGCCGCAGAGAGGGCGTGG + Intergenic
1164155769 19:22596082-22596104 CCCTCTCCCCAGAGTGGGCGGGG + Intergenic
1165831488 19:38732780-38732802 GACAGGCCCCAGAGTGGGGTTGG + Intronic
1165945539 19:39439659-39439681 GCCAAGCACCAGAGAAGGCCTGG + Intronic
1166072175 19:40394075-40394097 CCCAAGGCCCGGAGTGGGAGTGG - Exonic
1166300036 19:41908070-41908092 CCCCAGCCCCAGAGTGGGGGGGG - Intronic
1166919112 19:46216644-46216666 TACATGCCCCAGAGTGGGAGTGG + Intergenic
1166996507 19:46722101-46722123 GGCGAGGCCCAGAGTGGGAGGGG - Intronic
1168327223 19:55544616-55544638 GCCCCACCCCAGAGAGGGCGAGG - Intronic
1168714452 19:58518846-58518868 ACAAAGCCCCAGGGTGGGCTCGG + Intronic
925348628 2:3187022-3187044 GCCAAGGCCCAGGGTTGGGGTGG - Intergenic
925873339 2:8289852-8289874 GCCAAGGAGCAGAGTGGGAGTGG - Intergenic
927412620 2:22844447-22844469 GGCAACCACCAGAGTGGGAGTGG + Intergenic
927509781 2:23637152-23637174 GCCAAGTCCCACACTGGGCCTGG - Intronic
929543794 2:42842557-42842579 GACAAACGCCATAGTGGGCGAGG - Intergenic
935072153 2:99704503-99704525 CCCAAGACCAAGAGTGGGCAAGG - Intronic
937644608 2:124252223-124252245 ACCAAGCCACAGCTTGGGCGGGG + Intronic
938578238 2:132623222-132623244 CCCAAGCCCCAGAGAGGCAGTGG + Intronic
938599418 2:132821838-132821860 CCCATGCCCCACAGTGGCCGTGG + Intronic
940193538 2:151067533-151067555 GCCAAGGCACAGATTGGGCATGG + Intergenic
942656704 2:178221100-178221122 GCCAAGCCCCAGAATGGAGGGGG - Intronic
946818544 2:223606680-223606702 GCCAAGGCCCTGAGGGGCCGGGG - Intergenic
947767458 2:232646852-232646874 GCCAAGCCCTGGGCTGGGCGTGG - Intronic
948140444 2:235669379-235669401 GCCAAGCCCCAGAGTGGGCGTGG + Intronic
948237477 2:236401444-236401466 GCCAGGCCCCAGGGCTGGCGGGG - Intronic
948499012 2:238377408-238377430 ACCAAGCCCCACAGTGGGGGGGG - Intronic
1170548423 20:17454873-17454895 GCCATGCCCCTGCGTGAGCGAGG + Intronic
1170821587 20:19759035-19759057 GCCAAGCCCAGAAGGGGGCGGGG - Intergenic
1171284900 20:23928956-23928978 GCCCAGCCTCAGAGTGGGCGGGG + Intergenic
1171439366 20:25148283-25148305 GCCAAGCCCCTCAGTTGGGGAGG + Intergenic
1173299560 20:41789614-41789636 GCCAAGCCCAGGAGAGGGCAAGG + Intergenic
1173556467 20:43969653-43969675 GCAGAGGCCCTGAGTGGGCGGGG - Intronic
1173646847 20:44638686-44638708 TACAGGCCCCAGAGTGGGAGAGG + Intronic
1174404051 20:50292475-50292497 ACCAAGGCCCAGAGAGGGCAAGG - Intergenic
1175595258 20:60225756-60225778 GCCAGGACTCAGAGTGGGCCTGG - Intergenic
1176060145 20:63168961-63168983 GCCAAGCTCCAGGCTGGGTGGGG - Intergenic
1176150410 20:63587986-63588008 TCCAAGCCCCAGCGTGGGGAAGG - Exonic
1176181637 20:63752281-63752303 GCTGAGCTCCAGGGTGGGCGCGG + Intronic
1179234298 21:39531248-39531270 GCAGAGCCTCAGAGGGGGCGTGG + Intergenic
1180728205 22:17961729-17961751 GCCCAGCCCCAGAGTCGGTTAGG - Intronic
1180842893 22:18967552-18967574 GCCGAGCCCCAGGTTGGGGGTGG + Intergenic
1180967762 22:19799440-19799462 GCCAAGCCCCAGCCTGGACCTGG + Intronic
1181514997 22:23405228-23405250 GCCGAGCCCCAGGTTGGGGGTGG - Intergenic
1181573226 22:23779071-23779093 GCCCAGCCACACAGTGGGCTGGG + Intronic
1181762687 22:25068849-25068871 GCCAAGCTCCAGCCTGGGGGCGG + Intronic
1181949571 22:26544325-26544347 GCTGAGTCCCAAAGTGGGCGGGG - Intronic
1183248369 22:36711055-36711077 GTCAAGGCCCTGAGTGGGCAAGG - Intergenic
1184107951 22:42379370-42379392 TCCAGGCCTCACAGTGGGCGTGG + Intergenic
1185156303 22:49195436-49195458 GCAAAGACACAGGGTGGGCGGGG + Intergenic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
950010969 3:9723504-9723526 CCCAGGGCCCAGAGTGGGAGTGG - Intronic
950425660 3:12923616-12923638 ACCAAGGCTCAGAGTGGGAGGGG - Intronic
950566372 3:13772131-13772153 TCCAAGCCTCAGGGTGGGGGCGG + Intergenic
954079544 3:48205440-48205462 GCAAAGCCCCAGGTGGGGCGTGG - Intergenic
954194753 3:48990051-48990073 GAGAAGCCCCAGCGTGGGCTGGG + Exonic
954982961 3:54762503-54762525 GCCAGGCCCCAGGGGGGGCAGGG + Intronic
960944572 3:122957356-122957378 GCCAAGCCCCACAGTTGGACTGG - Intronic
961674352 3:128555665-128555687 TCCAAGCCCCCGGGTGGGGGTGG + Intergenic
964876267 3:161372009-161372031 TCCCAGCCCCAGAGCGGGGGAGG - Exonic
965733046 3:171792578-171792600 GCCCAGCCCCAGACTGGCTGAGG + Intronic
967159230 3:186720506-186720528 GCCAAGCCAAAGAGCTGGCGAGG + Intronic
969021491 4:4142869-4142891 GCGTAGCCCCAGTGGGGGCGGGG - Intergenic
969081434 4:4621563-4621585 TCCAACCCCCAGGCTGGGCGCGG - Intergenic
976741407 4:88361008-88361030 GGCAAGCCCCACACTTGGCGTGG + Intergenic
978807775 4:112818559-112818581 TCCCAGCCCCAGAGTGGACTTGG + Intronic
981705198 4:147651808-147651830 GCCAGGACCCAGGGTGGGAGGGG + Intronic
981910494 4:149975524-149975546 GACAAGCCACAGATTGGGAGAGG - Intergenic
983233913 4:165157469-165157491 GACAACCCACAGAGTGGGAGAGG + Intronic
983620705 4:169758055-169758077 GCCCAGCACGGGAGTGGGCGGGG - Intergenic
985650697 5:1105907-1105929 CCCATGCCCCACAGTGGGAGGGG + Intronic
987672097 5:21022969-21022991 GCAGAGTCCCTGAGTGGGCGAGG - Intergenic
988491561 5:31709602-31709624 GCAAAGCCCTAGAGTTGTCGGGG - Intronic
992261314 5:74973356-74973378 GCCATTGCCCAGAGTGGGGGTGG - Intergenic
996690077 5:126331024-126331046 CCCAAGCCCCAGAGGTGGCATGG + Intergenic
997212167 5:132083245-132083267 CCCAAGGCCCAGAGAGGGCAGGG + Intergenic
999268504 5:150282642-150282664 GCTAAGGCCCAGAGAGGGTGAGG - Intronic
999440520 5:151597247-151597269 GCCAAGCCCCTGAGTGGGCAAGG - Intergenic
1002073252 5:176693144-176693166 GCCACTCCCCAGAGTGGGGAAGG - Intergenic
1002304349 5:178274525-178274547 GCAGAGCCCCAGACTGGGCGGGG + Intronic
1004861074 6:19805043-19805065 GCACAGCCGCAGACTGGGCGTGG - Intergenic
1006118822 6:31791832-31791854 GCCCAGGCCCAGAGTGGGTGGGG - Intronic
1007048100 6:38797913-38797935 GCCAAGCCGAAGAATTGGCGTGG - Intronic
1007764541 6:44152836-44152858 GCCAGGCCCCAGACTGAGCCAGG - Intronic
1007791154 6:44309281-44309303 GCCAAGCCCCAGAGGAGCTGCGG + Intronic
1011696519 6:89918095-89918117 GCCTAGCCCCAGTGTGGAGGGGG + Intergenic
1013209547 6:107974375-107974397 CCCAAGCCCCAGAGTGGGGCAGG - Intergenic
1013456066 6:110330638-110330660 CCCAAGCCCCAGACTGGCCTGGG + Intronic
1015036970 6:128667717-128667739 CCCAAGCCCCACTGTGGGTGTGG - Intergenic
1016416390 6:143839001-143839023 GCCAGGTCACAGAGTGGTCGAGG - Intronic
1017524716 6:155232449-155232471 GTCAAGCCCCAGAAAGGGTGTGG - Intronic
1018922969 6:168188575-168188597 GCCATGCCCCATGGAGGGCGGGG - Intergenic
1019344626 7:523105-523127 GCCAAGCCCCGGAGGGGCCCCGG - Intergenic
1019613095 7:1946817-1946839 GACAAGGCCCAGAGAGGGTGCGG + Intronic
1023750259 7:43365326-43365348 CCCAGGCCTCAGAGTGGGTGGGG - Intronic
1024054897 7:45653682-45653704 GCAAAGCCCCAGTGGGGGAGAGG - Intronic
1026292977 7:69025387-69025409 GCCACGCTGCAGAGTGGGCATGG - Intergenic
1032087720 7:128892537-128892559 GCCAGGCCCCAGAGTGGACCAGG - Exonic
1032778863 7:135145485-135145507 GTCAAGCCCCAGACTGGGGCAGG + Intronic
1036398309 8:8386706-8386728 CCCCAGCCCCAGACTTGGCGCGG + Intergenic
1038121113 8:24616491-24616513 GCCAAGCCACAGAGAGGGATGGG - Intergenic
1038596575 8:28891132-28891154 GCCCAGGCCCAGAGCGAGCGAGG - Intronic
1039486086 8:37911019-37911041 GGCATGCCACAGAGTGGGAGAGG - Intergenic
1039966447 8:42287507-42287529 GCCAAGCGCCAGGGTGGGTGGGG + Intronic
1042169973 8:65981647-65981669 GCCAAGCACAAGCGTGGGTGTGG - Intergenic
1047392650 8:124465943-124465965 GCCACTCCCCAGGCTGGGCGCGG + Intergenic
1049341850 8:142117286-142117308 TCCAAGCCTCAGAATGGGAGTGG + Intergenic
1049617122 8:143580492-143580514 GTCAAGCCTGTGAGTGGGCGGGG - Exonic
1053283200 9:36834893-36834915 GCCAGGCCTCAGAGTCGGGGAGG + Exonic
1053297778 9:36927229-36927251 GCCAGGCCCCAGGGTGGGCTGGG - Intronic
1056854998 9:90119441-90119463 GGCAAGCTACAGAGTGGGAGAGG - Intergenic
1057568896 9:96188789-96188811 GCCAAGCCTCTGTGTGGGCAGGG - Intergenic
1060757409 9:126223488-126223510 GCCAGGGCCCAGAGTAGGGGCGG + Intergenic
1060828456 9:126699597-126699619 GCCCAGCCCCGGACTGGGTGTGG + Exonic
1061131905 9:128713165-128713187 GCCAAGCACCAGCGTGGCCGAGG + Exonic
1061589952 9:131591767-131591789 GACATGCCCCAGACTGGGAGGGG - Intronic
1061937465 9:133866120-133866142 CCCAAGCCCTAGGGTGGGCCTGG + Intronic
1062026173 9:134341787-134341809 GCCAAGACCCAGAGGAGGGGTGG - Intronic
1062172347 9:135142056-135142078 GACAAGCCTCAGATTGGGGGAGG - Intergenic
1187547398 X:20267077-20267099 GCCCAGCCCCTGGGTGCGCGCGG - Intronic
1192795742 X:74422765-74422787 GCCGAGCCCCAGAGCGGGCGGGG + Intronic
1198224017 X:134628936-134628958 GCCCAGCCCCAGTATGGGGGTGG - Intronic
1200062457 X:153489660-153489682 GCCCAGCCCCAGGGAGGGCACGG - Intronic
1200077784 X:153560251-153560273 ACCCAGCCCCAGAGTGGCCACGG + Intronic