ID: 948140491

View in Genome Browser
Species Human (GRCh38)
Location 2:235669541-235669563
Sequence CCGCGGGCCGCGCGCCCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948140491_948140493 -8 Left 948140491 2:235669541-235669563 CCGGCTGGGCGCGCGGCCCGCGG 0: 1
1: 0
2: 2
3: 31
4: 270
Right 948140493 2:235669556-235669578 GCCCGCGGTCCCTTGCACGTCGG 0: 1
1: 0
2: 0
3: 2
4: 41
948140491_948140500 16 Left 948140491 2:235669541-235669563 CCGGCTGGGCGCGCGGCCCGCGG 0: 1
1: 0
2: 2
3: 31
4: 270
Right 948140500 2:235669580-235669602 CCCCGTCGCCCGCCCCGCCCCGG 0: 1
1: 1
2: 7
3: 113
4: 922

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948140491 Original CRISPR CCGCGGGCCGCGCGCCCAGC CGG (reversed) Intronic