ID: 948145042

View in Genome Browser
Species Human (GRCh38)
Location 2:235702397-235702419
Sequence TGGACAGGAGCTGCCTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 339}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948145032_948145042 29 Left 948145032 2:235702345-235702367 CCTTTAGCAGAAGGCTCTGAAAT 0: 1
1: 0
2: 1
3: 15
4: 189
Right 948145042 2:235702397-235702419 TGGACAGGAGCTGCCTTCCCTGG 0: 1
1: 0
2: 1
3: 22
4: 339
948145038_948145042 5 Left 948145038 2:235702369-235702391 CCGAGGAAGGACGCAGTGGAGGC 0: 1
1: 0
2: 2
3: 19
4: 199
Right 948145042 2:235702397-235702419 TGGACAGGAGCTGCCTTCCCTGG 0: 1
1: 0
2: 1
3: 22
4: 339
948145036_948145042 6 Left 948145036 2:235702368-235702390 CCCGAGGAAGGACGCAGTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 226
Right 948145042 2:235702397-235702419 TGGACAGGAGCTGCCTTCCCTGG 0: 1
1: 0
2: 1
3: 22
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948145042 Original CRISPR TGGACAGGAGCTGCCTTCCC TGG Intronic
900154614 1:1198948-1198970 GGGACAGCAGCTCCATTCCCTGG + Intergenic
900206706 1:1434757-1434779 TGGACAGGAGAACCCTACCCCGG - Intergenic
900221090 1:1509586-1509608 TGCACAGGAGGTGCCTGCCACGG + Intergenic
900286234 1:1901911-1901933 TGGCCATGAGTAGCCTTCCCTGG + Intergenic
900591925 1:3463982-3464004 TGGACAGGAGCCGGCCTGCCTGG + Intronic
900913519 1:5618768-5618790 TGCACAGAAGGTGCCTTCTCAGG - Intergenic
900944436 1:5821952-5821974 TGGACAGGAGATGCTCTGCCAGG + Intergenic
901400919 1:9014725-9014747 TGGAGAGGAGCTGCCAGCGCAGG + Exonic
901413951 1:9104374-9104396 TGCATAGGTGCTGCCTTCCTGGG - Exonic
901691091 1:10973858-10973880 CAGGCAGGATCTGCCTTCCCGGG + Intronic
901813827 1:11782570-11782592 TGGCCAGGAGCTGGACTCCCGGG - Intronic
903575383 1:24336639-24336661 GGGAGGGGAGCTGCCTTGCCAGG - Exonic
903861042 1:26364735-26364757 TGGCCAAGCTCTGCCTTCCCAGG - Exonic
904460944 1:30679528-30679550 AGGACAGGGGCTGCCTTCCTGGG - Intergenic
905726554 1:40257671-40257693 TGAACAGCAGCCGACTTCCCAGG - Intergenic
905791380 1:40791512-40791534 GGGGCAGGAGCTGCGTGCCCTGG + Intronic
906568009 1:46814159-46814181 TGGACAAAAGATGGCTTCCCAGG + Intronic
906783884 1:48597156-48597178 GGGATAGCAGCTCCCTTCCCTGG + Intronic
907020238 1:51059888-51059910 TGGAAAGGAGCTACCTACTCTGG + Intergenic
907523150 1:55038232-55038254 TGGACAGCAGCCCCCTTCCTGGG + Intergenic
910067286 1:83168522-83168544 TGGTGAGGAGCTGCATTCCTTGG - Intergenic
911025786 1:93434551-93434573 TGGATAGGAGCTACCTACTCTGG - Intergenic
911694742 1:100877430-100877452 TGGACAGCGGCAGCCTTTCCAGG + Intronic
915297394 1:154930806-154930828 TGGGCAGGAGCTACTTTACCTGG - Intronic
915670787 1:157486899-157486921 TGCACCTGAGGTGCCTTCCCTGG - Intergenic
916437370 1:164789608-164789630 TGGTCAGGACTTGCCTTGCCAGG - Intronic
917749093 1:178038084-178038106 TGGACCGGAGCTGCCCCGCCGGG - Intergenic
918614769 1:186531851-186531873 TGGGCAGGACCTGCCTGCCAGGG - Intergenic
919253948 1:195096996-195097018 TGGAAAGGAGCTGCCCTCTATGG + Intergenic
919314099 1:195948784-195948806 CAGGCAGGATCTGCCTTCCCGGG - Intergenic
920006265 1:202835873-202835895 GGGACAGGCTCTGGCTTCCCAGG + Intergenic
920269456 1:204752235-204752257 CAGGCAGGATCTGCCTTCCCTGG + Intergenic
921933699 1:220776960-220776982 AGTACAGTAGCTGCCTTCCTGGG + Intronic
922157565 1:223052071-223052093 CGCACAGCAGCCGCCTTCCCAGG + Intergenic
922849411 1:228720048-228720070 TGGACATGAGCCACCTTGCCTGG - Intergenic
922861210 1:228818359-228818381 CGGGCAGGATCTGCCTTCCCGGG + Intergenic
923286506 1:232501484-232501506 GAGACTGGAGGTGCCTTCCCTGG - Intronic
923630454 1:235646220-235646242 TGCACATGAGCTCCTTTCCCAGG - Intronic
924939423 1:248802484-248802506 GGGAAAGGAGTTGTCTTCCCAGG - Intergenic
1063085315 10:2812667-2812689 AGGACAGGGGATACCTTCCCTGG + Intergenic
1063534696 10:6871976-6871998 TGGACAGGATCTCCCTCTCCAGG + Intergenic
1065996481 10:31064098-31064120 TTGACAGGAGCTGCCTCACTTGG - Intergenic
1066373623 10:34837962-34837984 TGACCTGGAACTGCCTTCCCTGG + Intergenic
1070804907 10:79265247-79265269 TGGGCAGGTCCTGCCTTCTCAGG - Intronic
1070934437 10:80282334-80282356 TGGACAGGAACAGCCTTAGCAGG - Intronic
1072437545 10:95427846-95427868 GGCCCAGGAGATGCCTTCCCTGG - Intronic
1073517165 10:104086827-104086849 TGGATAGCATCTGGCTTCCCAGG + Intergenic
1076481318 10:130786840-130786862 GGGACAGGATGTGCCCTCCCAGG + Intergenic
1076605019 10:131683690-131683712 CAGACACGACCTGCCTTCCCGGG + Intergenic
1076608113 10:131702545-131702567 TGGAGATGAGCTGCCCTCCCCGG + Intergenic
1076617709 10:131767510-131767532 TGGACAGAAGCAGCGTTTCCAGG - Intergenic
1077027686 11:448519-448541 TGGACGGGAGCTGGCTGCTCTGG + Intronic
1078066534 11:8082442-8082464 TGGCGATGAGCTCCCTTCCCTGG - Intronic
1078107418 11:8366885-8366907 TGGCCTGTAGCTGCCATCCCTGG - Intergenic
1078175305 11:8965145-8965167 TGAACAGGCACTGCCTTACCCGG - Intergenic
1083165366 11:60881844-60881866 TGGCGAGGAGCTGCGTTCCTTGG - Intergenic
1083546128 11:63550421-63550443 TGGGCCTTAGCTGCCTTCCCAGG + Intergenic
1084428751 11:69099961-69099983 TGGTCAGGAGCGGAATTCCCAGG - Intergenic
1084618478 11:70252141-70252163 TGCACAGGTGCCGCCTTCTCTGG + Intergenic
1085273349 11:75283266-75283288 AGGTCAGGAACTGCCATCCCTGG - Exonic
1086392049 11:86375196-86375218 TGGGCAGCACCTGCCTGCCCAGG - Exonic
1089053264 11:115564468-115564490 TGGGGAGGTGCTGCCCTCCCAGG + Intergenic
1089844061 11:121444642-121444664 TGGACAGGATCTGACTTCAGTGG + Intergenic
1089849299 11:121482507-121482529 TGGTGAGGAGCAGCCTTCTCTGG - Intronic
1089957007 11:122580733-122580755 TGAACTGGCGCTGCTTTCCCAGG - Intergenic
1090278773 11:125438544-125438566 AGGAGAGCAGCTGCATTCCCAGG - Intergenic
1090432219 11:126655547-126655569 CACACAGTAGCTGCCTTCCCTGG - Intronic
1092126789 12:6080217-6080239 AAGACAGGAGCTGTATTCCCAGG + Intronic
1092447229 12:8568478-8568500 CAGACAGGATCTGCCCTCCCAGG - Intergenic
1095875234 12:47073188-47073210 TGTAAAAGAGCTTCCTTCCCTGG + Intergenic
1096080810 12:48831112-48831134 TGGATTGAAGCTGCTTTCCCTGG + Intronic
1096255234 12:50058332-50058354 AGGACAGGAGCTCCTTACCCCGG + Intronic
1101648927 12:106657032-106657054 AGGACAGGAGCTGCCTGCTAAGG + Intronic
1102257640 12:111425372-111425394 TGGGAGGGGGCTGCCTTCCCTGG + Intronic
1103701788 12:122851880-122851902 TGCACAGGAGCCACCTTGCCAGG + Intronic
1103703307 12:122858956-122858978 TGGACAGAACCTGCCATCCCAGG - Intronic
1103719096 12:122964008-122964030 AGGCCAGGAGCTTCCCTCCCTGG - Intronic
1103827170 12:123748881-123748903 GAGACAGAAGCAGCCTTCCCAGG - Intronic
1104505617 12:129329525-129329547 GGGAAAGGAGCTTCCTTTCCTGG - Intronic
1104859790 12:131918041-131918063 TGGCCAGGGGCTGCCATCGCTGG + Intronic
1104897506 12:132171538-132171560 AGGAGTGGGGCTGCCTTCCCAGG - Intergenic
1105997406 13:25685814-25685836 GTGACAGGACCTGCCTTCCATGG + Intronic
1106606411 13:31233487-31233509 TGGAGCAGAGCTGCCTCCCCAGG - Intronic
1107133030 13:36916805-36916827 TGTTCAGGCGCTGCCTTCACGGG - Intronic
1107603872 13:42040368-42040390 CGGAAAGGAGCGGCCTCCCCCGG - Intronic
1112484670 13:99809706-99809728 TGGTAATGAGCTGCCTTCCAAGG + Intronic
1112559619 13:100501464-100501486 TGGACATGAGCTAAATTCCCTGG + Intronic
1113665041 13:112135733-112135755 GGGACCTGAGCTGGCTTCCCTGG - Intergenic
1113984548 13:114303393-114303415 TGTGCAGGAGCTACTTTCCCGGG + Intronic
1114052714 14:18935093-18935115 TGGACAGACTCTCCCTTCCCAGG + Intergenic
1114109844 14:19466833-19466855 TGGACAGACTCTCCCTTCCCAGG - Intergenic
1114533372 14:23408821-23408843 TGGACAACAGATCCCTTCCCTGG - Intergenic
1116503766 14:45652615-45652637 TGGGGTGGATCTGCCTTCCCCGG - Intergenic
1117503580 14:56378308-56378330 TGGACAGAAGCTGATTTCCCTGG - Intergenic
1119738693 14:77000094-77000116 TGGGCAGAAGGTGCCTTACCAGG - Intergenic
1120670709 14:87359761-87359783 TGGTGAGGAGCTGCATTCCTTGG + Intergenic
1120732426 14:88018685-88018707 TTGACAGGAGGTGGCCTCCCTGG + Intergenic
1121619049 14:95333531-95333553 TGGACAGGTTCTGCTTGCCCTGG + Intergenic
1124604588 15:31161016-31161038 GGCACAGGGGCTGCCCTCCCTGG + Exonic
1125744874 15:41991237-41991259 TGGGAAGGAGCTGGGTTCCCAGG - Intronic
1127992913 15:64133877-64133899 AGGCCAGCAGCTTCCTTCCCTGG + Intronic
1128231116 15:66036095-66036117 GGGCCAGGAGCTGGCATCCCTGG + Intronic
1129253243 15:74320009-74320031 TCCACAGAAGCTGCCCTCCCAGG - Intronic
1130203404 15:81853927-81853949 TGGACATGAGCTGCTGTGCCTGG - Intergenic
1130738118 15:86571434-86571456 TGGAGAGGAGCTGCCTACTGTGG - Intronic
1132840719 16:1977403-1977425 TGGACAGCAGCTGCGTGCCACGG - Exonic
1132945808 16:2530949-2530971 GGGAGAGGAGCTGTCTTGCCAGG + Exonic
1134063571 16:11213006-11213028 AGGACAGGAGGTGCCTCCGCAGG + Intergenic
1135208156 16:20499823-20499845 GGGACAGGAGGCACCTTCCCGGG - Intergenic
1135210743 16:20523877-20523899 GGGACAGGAGGCACCTTCCCGGG + Intergenic
1136185349 16:28585261-28585283 TAGAAAGGAGCTTCCTTCCCAGG + Intronic
1139351976 16:66342694-66342716 TGAGCTGGAGCTGCCTTTCCTGG + Intergenic
1139477032 16:67207920-67207942 TGGCCAGGAGCTGGCTGCCTGGG + Exonic
1140310438 16:73842869-73842891 TGGACAGGCGGTGCCTTCCGTGG - Intergenic
1140863480 16:79039638-79039660 TGGACAGGAGTTACTTTCCGAGG - Intronic
1141470868 16:84237401-84237423 TGGACAGGAGCTGACTCCAAGGG + Exonic
1141485820 16:84339658-84339680 TGGACTGGAGCTGAGTTCCATGG + Intergenic
1141568959 16:84922727-84922749 GGGAGAGGACCTGCCTGCCCTGG + Intergenic
1141633411 16:85301296-85301318 CTGGCAGGAGCTGCCTTCACTGG + Intergenic
1141659026 16:85431698-85431720 TGGACAGGAGCTGGCCTGTCTGG + Intergenic
1141923829 16:87153917-87153939 GGGCCTGGAGCTGCCCTCCCTGG + Intronic
1142203916 16:88773748-88773770 TGGACAGCAGCTGCCTACTGGGG + Intronic
1142306544 16:89289148-89289170 CAGCCAGGAGCTGCCTGCCCGGG - Intronic
1142399958 16:89853435-89853457 TGGCCAGGAGCGGCCTGCTCAGG + Intronic
1143204628 17:5133296-5133318 GGGACAGGGTCTCCCTTCCCAGG - Intronic
1144386181 17:14751185-14751207 CAGGCAGGATCTGCCTTCCCAGG + Intergenic
1144485310 17:15659709-15659731 GGGACAGGAGATGGTTTCCCAGG + Intronic
1144875690 17:18395981-18396003 GGGACAGGGTCTCCCTTCCCAGG - Intergenic
1145156536 17:20548440-20548462 GGGACAGGGTCTCCCTTCCCAGG + Intergenic
1145231808 17:21178462-21178484 TGGAGACCTGCTGCCTTCCCTGG - Intronic
1146057382 17:29588304-29588326 TGGGCTAGAGCTTCCTTCCCAGG + Intronic
1146160367 17:30556288-30556310 GGGACAGGGTCTCCCTTCCCAGG - Intergenic
1146814814 17:35934101-35934123 TGGACAGGATCTGGTTTGCCTGG - Intergenic
1146841024 17:36154372-36154394 TGGTCAGCAGCTGCCATACCAGG - Intergenic
1146844034 17:36172526-36172548 GGGACAGGGTCTCCCTTCCCAGG + Intronic
1146856337 17:36260461-36260483 GGGACAGGGTCTCCCTTCCCAGG + Intronic
1146864279 17:36327914-36327936 GGGACAGGGTCTCCCTTCCCAGG - Intronic
1146872247 17:36384372-36384394 GGGACAGGGTCTCCCTTCCCAGG + Intronic
1146879608 17:36435457-36435479 GGGACAGGGTCTCCCTTCCCAGG + Intronic
1147067138 17:37928502-37928524 GGGACAGGGTCTCCCTTCCCAGG - Intronic
1147075133 17:37984996-37985018 GGGACAGGGTCTCCCTTCCCAGG + Intronic
1147078670 17:38008063-38008085 GGGACAGGGTCTCCCTTCCCAGG - Intronic
1147086658 17:38064542-38064564 GGGACAGGGTCTCCCTTCCCAGG + Intronic
1147094608 17:38131998-38132020 GGGACAGGGTCTCCCTTCCCAGG - Intergenic
1147102601 17:38188505-38188527 GGGACAGGGTCTCCCTTCCCAGG + Intergenic
1147456634 17:40542148-40542170 AGGAAAGGACCTGCCTCCCCAGG + Intergenic
1147998798 17:44375787-44375809 TGGTCTGGGGCCGCCTTCCCAGG + Intronic
1148227177 17:45907111-45907133 TGGCCTCGAGCTGCCTGCCCGGG + Intronic
1148480128 17:47954554-47954576 TGCCATGGAGCTGCCTTCCCTGG + Intronic
1149238019 17:54616166-54616188 TGGAAAGGAGCTGCCCACCGTGG + Intergenic
1149650068 17:58271161-58271183 TGGCCAGGAGCTGCATCCACAGG + Intronic
1149847176 17:60014972-60014994 GGGACAGGGTCTCCCTTCCCAGG + Intergenic
1150085535 17:62271589-62271611 GGGACAGGGTCTCCCTTCCCAGG + Intergenic
1151234188 17:72706751-72706773 GGAAGAGGATCTGCCTTCCCAGG + Intronic
1153823085 18:8848997-8849019 TGAACAGGAGCTGCCTTAGAAGG - Intergenic
1155308025 18:24498303-24498325 TGGGCATGAGGTGCCCTCCCTGG - Intergenic
1157340491 18:46773475-46773497 TAAACTGAAGCTGCCTTCCCTGG - Intergenic
1157707501 18:49819675-49819697 GGGACTGTAGCTGCTTTCCCAGG - Intronic
1159458586 18:68693991-68694013 TGGAAAGGAGCTACCTACTCGGG + Intronic
1161152617 19:2717581-2717603 TGGACAGGCGCTGCATGGCCGGG + Exonic
1161289095 19:3483299-3483321 TGGACAGCATCCGCCTGCCCAGG - Intergenic
1161420373 19:4173287-4173309 GGGAAGGCAGCTGCCTTCCCGGG + Intergenic
1161517081 19:4702589-4702611 TGGAAGGGACCTACCTTCCCAGG + Exonic
1161905413 19:7152818-7152840 TGGACAGGAGCAGCATTCGCCGG + Exonic
1162348837 19:10136944-10136966 TGGTCAGCAGCTACCTTCTCTGG + Intronic
1162792457 19:13070122-13070144 TCCCCAGGAGCTGCCTCCCCAGG + Intronic
1165323607 19:35100997-35101019 TGGACAGGATCTGGCATCCAAGG - Intergenic
1165347038 19:35254963-35254985 TGGACAGGAACCGCCTGCCATGG - Intronic
1165506320 19:36233084-36233106 TGGCCAGGAGCTGCTTTTCTTGG - Intronic
1165906012 19:39195401-39195423 GAAACAGAAGCTGCCTTCCCAGG - Intergenic
1166269810 19:41707053-41707075 GGGACAGGAGCTGCCTGCAGAGG - Intronic
1166290840 19:41862419-41862441 TGAAGAGAAGCTGACTTCCCTGG + Intronic
1166714076 19:44955445-44955467 CTGACCGGAGCTGCCTCCCCCGG - Exonic
1167279239 19:48556973-48556995 TGGACAGGAGCCACCATGCCTGG - Intronic
1167341863 19:48921201-48921223 TGAAGAGGAGCTGGCTGCCCGGG + Exonic
1168434086 19:56303787-56303809 TGGCCACGGGCAGCCTTCCCCGG + Intronic
925406987 2:3612440-3612462 TGGACAGGAGCCGGCTGACCAGG + Intronic
925568960 2:5288622-5288644 TGGCCAGGAGCTGTCTTACGTGG - Intergenic
925898866 2:8494451-8494473 CCGACAGGCCCTGCCTTCCCTGG + Intergenic
927533955 2:23837322-23837344 GGGACAGGGGAAGCCTTCCCAGG + Intronic
928074443 2:28250208-28250230 TGCACAGGGACTGCCTTCCCTGG - Intronic
928115431 2:28542591-28542613 GGGACAAGAGCTGGCATCCCTGG - Intronic
930845609 2:55900345-55900367 TGGACTAGACCAGCCTTCCCGGG + Intronic
932493950 2:72137535-72137557 TGGCCAGGAGGGGCCATCCCAGG + Intronic
932497428 2:72153362-72153384 TGGGCAGGACCTGCCGCCCCAGG - Intergenic
933420875 2:82043617-82043639 TGGATAGGAGCTGCCCACTCTGG + Intergenic
933777090 2:85777685-85777707 TGCACAGAAGCAGACTTCCCTGG - Intronic
933816041 2:86069548-86069570 GGGACAGAAGATGCCTTCACGGG + Intronic
936089511 2:109491867-109491889 AGGGCAGAGGCTGCCTTCCCGGG - Intronic
936280921 2:111139015-111139037 TGGAAAGGAGCTGTCGTTCCAGG + Intronic
936935733 2:117836684-117836706 AGGACACCAGCAGCCTTCCCTGG - Intergenic
937220473 2:120340374-120340396 TGGACAGGAACTGAGGTCCCTGG - Intergenic
938197172 2:129338526-129338548 AGGACAGGAGCTGACTCCCCAGG + Intergenic
938696114 2:133837073-133837095 TGGACAGGAGCACCCTACGCAGG - Intergenic
939127640 2:138196359-138196381 TTGACAGCAGATCCCTTCCCAGG - Intergenic
939405128 2:141746083-141746105 GAGTCAGGAGCTGCGTTCCCTGG + Intronic
942848565 2:180455352-180455374 TGGCCAGGACCTGCATTTCCAGG - Intergenic
946028654 2:216687998-216688020 GGGACAGCAGTTGCCTTCTCAGG + Intronic
946307264 2:218863245-218863267 TGCCCAGGACCTGCTTTCCCTGG + Intronic
947530958 2:230908364-230908386 CGGACAGGAGTCGCCTTCTCAGG - Exonic
947742607 2:232491466-232491488 TGGTCAGGTGCTGCCTCCACAGG + Intergenic
947822616 2:233082679-233082701 GGGAGAGGAGCTGCCTCACCTGG + Intronic
948029799 2:234808054-234808076 TGGAAAGGAGATGCCTTCATGGG + Intergenic
948055304 2:235006052-235006074 TGGGCAGGAGCCGCCTGTCCTGG + Intronic
948145042 2:235702397-235702419 TGGACAGGAGCTGCCTTCCCTGG + Intronic
948205685 2:236161725-236161747 TGCACTGGAGCCTCCTTCCCTGG + Intergenic
948434572 2:237944344-237944366 TGGACAGGAGCTACCCACCCTGG + Intergenic
948635104 2:239329757-239329779 AGGACAGCAGCTGACATCCCTGG + Intronic
948666103 2:239535780-239535802 TGGACAGGAGGGGCTTCCCCAGG - Intergenic
948928758 2:241116970-241116992 CGCTCAGAAGCTGCCTTCCCGGG - Intronic
1169061020 20:2660403-2660425 AGTACAGGGGCTACCTTCCCAGG + Intronic
1170351540 20:15447287-15447309 TAGCCAGGCTCTGCCTTCCCAGG - Intronic
1170533761 20:17320166-17320188 TGCACATGAACTGCCTTTCCAGG + Intronic
1171255723 20:23687932-23687954 TGCACAGGAGGTGCACTCCCTGG - Intronic
1171278565 20:23878627-23878649 TGCACAGGAGGGGCATTCCCTGG - Intronic
1176083955 20:63287457-63287479 TGGACAGTGACCGCCTTCCCAGG - Intronic
1176309079 21:5140295-5140317 TGGACAGACTCTGCCATCCCAGG - Intronic
1177641519 21:23849929-23849951 TGGCCAGAAGATGCTTTCCCAGG + Intergenic
1177749310 21:25260137-25260159 TGCACAGAAACTGGCTTCCCAGG - Intergenic
1178587376 21:33881486-33881508 TGGACAAATGCTGCCTTCCAAGG - Intronic
1179847982 21:44121738-44121760 TGGACAGACTCTGCCATCCCAGG + Intronic
1179890068 21:44330876-44330898 TGGCCTGAAGCCGCCTTCCCGGG - Exonic
1180145143 21:45914634-45914656 TGCAGAGGTGCTGCCATCCCTGG - Intronic
1180471188 22:15657467-15657489 TGGACAGACTCTCCCTTCCCAGG + Intergenic
1180948279 22:19708649-19708671 GGGTGAGGAGCTGCCATCCCCGG - Intergenic
1181392597 22:22594603-22594625 TGCACAGGTGCTGCCTCCCAGGG + Intergenic
1181458306 22:23071621-23071643 TGGACTGGGCCTGCCCTCCCAGG + Intronic
1181458791 22:23074164-23074186 GAGACTGGAGCTGCCCTCCCAGG + Intronic
1183175733 22:36223530-36223552 TGGCCATGACCTGCCTCCCCAGG - Intergenic
1183708599 22:39489562-39489584 AGGACAGGACCTGGCTGCCCTGG + Exonic
1183909553 22:41068185-41068207 TGGACAGGTGCTGCCCCCACAGG + Intergenic
1184293887 22:43511957-43511979 TGAGCAGAAGCTGCCTTGCCTGG - Intergenic
1184533272 22:45070428-45070450 AGGACAGGGGCTTCCTGCCCAGG - Intergenic
1184732541 22:46378668-46378690 TGGACAGGAGCTCGCAGCCCCGG + Exonic
1185023232 22:48392855-48392877 TGGACAGGAGCAGCCTGGGCTGG - Intergenic
1185069315 22:48647570-48647592 TTGACACCAGATGCCTTCCCGGG - Intronic
1185257722 22:49845357-49845379 AGCACAGGAGCTGCCAGCCCTGG + Intergenic
950522495 3:13505321-13505343 AGGTCTGGACCTGCCTTCCCAGG + Exonic
951444639 3:22764456-22764478 TGAACAAGAGCTGCCTGACCTGG + Intergenic
953205311 3:40822596-40822618 TGACCAGAAGCTGCCTTGCCTGG + Intergenic
953794100 3:45969853-45969875 TGGTAGGGGGCTGCCTTCCCAGG + Intronic
953841989 3:46396604-46396626 GGAACTGGAGCTGCCTGCCCAGG + Intergenic
954505232 3:51064504-51064526 CAGACAGTAGCTGCCTTCGCAGG - Exonic
954578085 3:51687766-51687788 TGGAGAGCAGCTGCTGTCCCGGG + Intronic
954867689 3:53743850-53743872 TGGAAAGGACCTGCCCTCCTAGG + Intronic
958641650 3:96814002-96814024 TGGACAGGCGCTCCCGTCCGGGG - Intergenic
961329938 3:126132436-126132458 TGGCCAGGAGCTGCTTGGCCAGG - Intronic
961411640 3:126726631-126726653 TGTCGAGGAGCAGCCTTCCCTGG + Intronic
961435385 3:126912938-126912960 TGCACAGGAAGTGCTTTCCCTGG + Intronic
962364156 3:134766447-134766469 TGGCCATGAGCTGCTGTCCCAGG - Intronic
962657065 3:137557866-137557888 TGGTGAGGAGCTGCATTCCTTGG - Intergenic
967826461 3:193881581-193881603 TGGACAGCAGCATCCTGCCCTGG + Intergenic
969116640 4:4874413-4874435 TGGGCAGGGGGTGGCTTCCCAGG - Intergenic
969618197 4:8265746-8265768 TGGACAGGACATCCCCTCCCAGG + Intergenic
971678045 4:29659884-29659906 TGGAAAAGAGCTAGCTTCCCTGG - Intergenic
972680859 4:41305709-41305731 TGAACAGGAGCTGTCTGCCAGGG + Intergenic
973270708 4:48259908-48259930 AGGACATAAGATGCCTTCCCGGG + Intronic
973340122 4:48995133-48995155 GGGAGAGGAGCAGCATTCCCTGG + Intronic
973932114 4:55803562-55803584 TGGAAAGGAGCTGGCAGCCCTGG + Intergenic
974877754 4:67718284-67718306 TGGGGAGGGGCCGCCTTCCCTGG + Intergenic
976224515 4:82784920-82784942 TGAATAGCTGCTGCCTTCCCTGG - Intronic
977410323 4:96653800-96653822 TGGAAAGGAGCTACCCACCCTGG + Intergenic
978619421 4:110623332-110623354 TGGGCAGGAGCTGAATTCCCGGG - Intronic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
980450267 4:132960105-132960127 TGGAGAGGAGCTGCCCACTCTGG + Intergenic
983099817 4:163611343-163611365 TGGACATGAGCAGCCTTCTCTGG + Intronic
985655659 5:1130301-1130323 GAGACAGGAGGTGCCTGCCCAGG - Intergenic
985709851 5:1422137-1422159 TGGACAAGAGATGCCTTCCAGGG + Intronic
986202546 5:5591179-5591201 TAGAGAGGAGCTGCTTTACCAGG - Intergenic
986739317 5:10692355-10692377 TGGACAGGAGGTTCCCTACCAGG + Intronic
992530885 5:77650815-77650837 TGAGAAGGAGCTGCCTGCCCTGG + Intergenic
995964004 5:117882148-117882170 TGGACTGGAGCTGCCTGTACTGG - Intergenic
996797022 5:127358565-127358587 TGCACAGGAAGTGCCATCCCAGG - Intronic
997670674 5:135669319-135669341 TGGATAGGGGCTGCCTTCTTGGG + Intergenic
998267888 5:140679805-140679827 GGGACAGGAGCTCCCCGCCCTGG + Exonic
998541858 5:142990500-142990522 TGGTGAGGAGCTGCATTCCTTGG + Intronic
998899428 5:146836908-146836930 TGGACAGGAGCTGTTTTCTGAGG - Intronic
999113601 5:149142338-149142360 AGGAGACGAGCAGCCTTCCCAGG - Intronic
999405047 5:151299537-151299559 TGGGCAGGAGCTGCCAGCACAGG - Intronic
1001793587 5:174483028-174483050 AGGACAGCACCTGCCTGCCCAGG + Intergenic
1002805478 6:570007-570029 TGGACAGTAGTTGCCTTCCCTGG - Intronic
1002806732 6:583791-583813 TGCACAGCAGAAGCCTTCCCTGG + Intronic
1003528138 6:6915402-6915424 TGGTCTGGGGCTGCTTTCCCAGG - Intergenic
1004520711 6:16358822-16358844 CAGGCAGGATCTGCCTTCCCAGG + Intronic
1006083077 6:31578656-31578678 TGGAGAGGAGCCGCATTCTCAGG + Intergenic
1006683148 6:35811677-35811699 TGGGAAGGAGCTGCCCTTCCAGG - Intronic
1006867743 6:37222618-37222640 TAGGCAGGATCTGCCCTCCCAGG - Intronic
1007612375 6:43158840-43158862 TGGACAGGTGCTCCATGCCCAGG - Exonic
1009018439 6:57927792-57927814 TAGACATGCGCTGCCTTGCCAGG - Intergenic
1010428103 6:75748916-75748938 CGGACAGGACCTGCTTTGCCGGG + Intergenic
1011301821 6:85883324-85883346 TGGAGAGGAGCTGAGGTCCCAGG - Intergenic
1012362103 6:98394902-98394924 TGGACAATAGCTGCCTTCTTTGG - Intergenic
1013551136 6:111208922-111208944 TGGGCATGAGCTGCCATGCCTGG - Intronic
1014391744 6:120872905-120872927 TGGATAGGAGCTGCCCACTCTGG + Intergenic
1014549455 6:122772880-122772902 TGGGCAGGAGCTGGCTTAGCTGG + Intergenic
1015663785 6:135604208-135604230 TGGAAAGGAGCTGCCCTCTGAGG + Intergenic
1016190675 6:141261103-141261125 TGGGCAGGAGCTCCCCTCCCAGG + Intergenic
1017376439 6:153775308-153775330 CAGACAGGAGCTGCCATGCCAGG - Intergenic
1017420571 6:154268228-154268250 AGGACAGCAGGGGCCTTCCCAGG + Intronic
1018646160 6:165950658-165950680 AGGACAGCAGCTGCCAGCCCAGG + Intronic
1019217573 6:170453709-170453731 GGGACAGGCGGTGCCTTCACCGG - Intergenic
1019360182 7:600790-600812 TGGAAGGGAGCTACGTTCCCAGG + Intronic
1019481667 7:1269862-1269884 TGGTCAGGCGCCCCCTTCCCCGG + Intergenic
1019669743 7:2270971-2270993 AGCACAGGACCCGCCTTCCCTGG + Intronic
1019706007 7:2497717-2497739 TGGACAGGGCGTTCCTTCCCAGG + Intergenic
1020153440 7:5701954-5701976 TGGTCCTGAGCTGCCTTCCTGGG - Intronic
1021343110 7:19488931-19488953 TGGATAGGAGCTACCTGCTCTGG - Intergenic
1024976705 7:55120158-55120180 TGATCAGGTGCTGCCCTCCCTGG + Intronic
1026359734 7:69591958-69591980 GGGGCAGGATCTGCCTTCCCGGG - Intergenic
1026933219 7:74236665-74236687 TGGAGAGAAGATGGCTTCCCTGG + Intronic
1027276820 7:76566230-76566252 TGGTGAGGAGCTGCCTTCCTTGG + Intergenic
1028233213 7:88330172-88330194 CAGGCAGGATCTGCCTTCCCTGG + Intergenic
1028715985 7:93969358-93969380 TGGGAAGGATCTGGCTTCCCTGG + Intronic
1029349683 7:100004251-100004273 TTGGCTGGGGCTGCCTTCCCAGG - Intergenic
1029420039 7:100467627-100467649 AGGAGAGGAGAAGCCTTCCCAGG + Intronic
1030243822 7:107359710-107359732 TGGACAGGAGCTACCCACTCTGG + Intronic
1030297608 7:107944598-107944620 TGGTCATGTGCTTCCTTCCCTGG + Intronic
1030484485 7:110148992-110149014 TGGAGAGGAGCTACCCACCCTGG - Intergenic
1032791488 7:135246239-135246261 TGGAGAGCAGCAGCCTTCCTGGG - Intronic
1034555855 7:151849964-151849986 TGGGCAGGAGCAGCTTCCCCAGG - Intronic
1034904570 7:154932882-154932904 TGAATAGGAGCTGCCAGCCCAGG + Intronic
1034976356 7:155451009-155451031 CGGAAGGGAGCTCCCTTCCCGGG - Intergenic
1034994615 7:155570255-155570277 GGAACAGGTGCTGCCTTCCCCGG + Intergenic
1035032517 7:155870652-155870674 TAGCCAGGACCTGCCTCCCCTGG + Intergenic
1035095089 7:156347859-156347881 TGGACAGGGACTCCATTCCCAGG - Intergenic
1035996061 8:4548747-4548769 TTGAAAGCAGCTGCATTCCCAGG + Intronic
1036651522 8:10646996-10647018 TGGTCAGGCACTGCCTTGCCAGG - Intronic
1037884294 8:22588384-22588406 TGGAGAGAAGTTGGCTTCCCAGG + Intronic
1037884874 8:22590651-22590673 TGGAGAGAAGCTGGTTTCCCAGG + Intronic
1039896967 8:41723674-41723696 TGCACAGCAGCTGCATTCCAGGG - Intronic
1041816702 8:61980813-61980835 TGGACAGCAGCTGACATCACTGG - Intergenic
1042196894 8:66238543-66238565 GGGGCAGGAGGTGCCTTCCTGGG + Intergenic
1043180549 8:77082688-77082710 TGGAAAGGAGCTACCTACCACGG - Intergenic
1044256949 8:90074684-90074706 TGGAGAAGAGCTTGCTTCCCTGG + Intronic
1045498539 8:102728273-102728295 AGGACAGAAGCTCCCTCCCCTGG - Intergenic
1046379685 8:113435434-113435456 TGCAAATGAGCTGCCTTCCGTGG + Intronic
1049021699 8:139961554-139961576 CAGGCAGGAACTGCCTTCCCAGG + Intronic
1049192317 8:141295180-141295202 CCCACAGGGGCTGCCTTCCCTGG - Intronic
1049381798 8:142319884-142319906 GGGACAGGAGCTTTCTTCCCCGG + Intronic
1049434262 8:142579240-142579262 TGCACAGGACCTGTCTCCCCAGG - Intergenic
1051891092 9:21943911-21943933 TGGAGTGGAGGTGCCTTCCCTGG - Intronic
1055969114 9:81894087-81894109 TGGAAAGCTGCTGCCCTCCCTGG - Intergenic
1057859074 9:98625275-98625297 TGACCAGGAGCTTCCTTCCCTGG - Intronic
1059335495 9:113566135-113566157 TAGACACGAGCTTCCATCCCTGG - Intronic
1060026332 9:120175271-120175293 TGGGCAGGTGGTGGCTTCCCTGG - Intergenic
1060206331 9:121684811-121684833 TGGAGAGGAGCAGCTTGCCCAGG + Intronic
1060809968 9:126606174-126606196 TGGACTGGTGCAGCCTCCCCAGG - Intergenic
1061088372 9:128412285-128412307 TGGACCAGAGCAGCCTACCCGGG + Intronic
1061162405 9:128902864-128902886 TGGCCTGGAGCTGCCAGCCCAGG + Intronic
1061440909 9:130602797-130602819 TGGACATGGGCAGGCTTCCCAGG + Intronic
1061865979 9:133492004-133492026 GGGACAGGAGCTCACTTCACCGG - Intergenic
1062253635 9:135610801-135610823 TGGACAGGAGCACCCATACCGGG + Intergenic
1062450781 9:136614871-136614893 TGGAGAGGGGAGGCCTTCCCAGG + Intergenic
1186891739 X:13965753-13965775 GGGACAGAAGCTGCATCCCCCGG - Intergenic
1186931135 X:14391918-14391940 TGGTGAGGAGCTGCATTCCTCGG - Intergenic
1189589036 X:42492499-42492521 TGGAAAGGAACTGAGTTCCCTGG + Intergenic
1190621161 X:52288185-52288207 TAGAAAGGAGCTGCCCACCCTGG + Intergenic
1190621200 X:52288399-52288421 TAGAAAGGAGCTGCCCACCCTGG + Intergenic
1191187110 X:57624661-57624683 TGGTGAGGAGCTGCGTTCCTTGG - Intergenic
1195320947 X:103721610-103721632 TGGAGAAGGGCTGCTTTCCCAGG - Intronic
1198806739 X:140501696-140501718 GGGGCTGGTGCTGCCTTCCCAGG + Intergenic
1199976864 X:152899310-152899332 TGCAGAGGTCCTGCCTTCCCAGG + Intergenic
1199987683 X:152964235-152964257 CGGACTGGAGCTGGCTTCCCAGG - Intronic