ID: 948147292

View in Genome Browser
Species Human (GRCh38)
Location 2:235717073-235717095
Sequence CAGGACAACAGGAGCAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 437}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948147292_948147305 27 Left 948147292 2:235717073-235717095 CCTTTTCTGCTCCTGTTGTCCTG 0: 1
1: 0
2: 3
3: 41
4: 437
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460
948147292_948147304 26 Left 948147292 2:235717073-235717095 CCTTTTCTGCTCCTGTTGTCCTG 0: 1
1: 0
2: 3
3: 41
4: 437
Right 948147304 2:235717122-235717144 CCTAAAGATGCTACCATGCATGG 0: 1
1: 0
2: 0
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948147292 Original CRISPR CAGGACAACAGGAGCAGAAA AGG (reversed) Intronic