ID: 948147296

View in Genome Browser
Species Human (GRCh38)
Location 2:235717097-235717119
Sequence ATGAGTCTAGGGTAGACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948147296_948147305 3 Left 948147296 2:235717097-235717119 CCCCAAGTCTACCCTAGACTCAT 0: 1
1: 0
2: 0
3: 8
4: 112
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460
948147296_948147304 2 Left 948147296 2:235717097-235717119 CCCCAAGTCTACCCTAGACTCAT 0: 1
1: 0
2: 0
3: 8
4: 112
Right 948147304 2:235717122-235717144 CCTAAAGATGCTACCATGCATGG 0: 1
1: 0
2: 0
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948147296 Original CRISPR ATGAGTCTAGGGTAGACTTG GGG (reversed) Intronic