ID: 948147297 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:235717098-235717120 |
Sequence | GATGAGTCTAGGGTAGACTT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 97 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 8, 4: 87} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
948147297_948147304 | 1 | Left | 948147297 | 2:235717098-235717120 | CCCAAGTCTACCCTAGACTCATC | 0: 1 1: 0 2: 1 3: 8 4: 87 |
||
Right | 948147304 | 2:235717122-235717144 | CCTAAAGATGCTACCATGCATGG | 0: 1 1: 0 2: 0 3: 11 4: 134 |
||||
948147297_948147305 | 2 | Left | 948147297 | 2:235717098-235717120 | CCCAAGTCTACCCTAGACTCATC | 0: 1 1: 0 2: 1 3: 8 4: 87 |
||
Right | 948147305 | 2:235717123-235717145 | CTAAAGATGCTACCATGCATGGG | 0: 1 1: 0 2: 2 3: 67 4: 460 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
948147297 | Original CRISPR | GATGAGTCTAGGGTAGACTT GGG (reversed) | Intronic | ||