ID: 948147298

View in Genome Browser
Species Human (GRCh38)
Location 2:235717099-235717121
Sequence GGATGAGTCTAGGGTAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948147298_948147305 1 Left 948147298 2:235717099-235717121 CCAAGTCTACCCTAGACTCATCC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460
948147298_948147304 0 Left 948147298 2:235717099-235717121 CCAAGTCTACCCTAGACTCATCC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 948147304 2:235717122-235717144 CCTAAAGATGCTACCATGCATGG 0: 1
1: 0
2: 0
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948147298 Original CRISPR GGATGAGTCTAGGGTAGACT TGG (reversed) Intronic