ID: 948147300 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:235717109-235717131 |
| Sequence | CATCTTTAGGGGATGAGTCT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 140 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 127} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 948147300_948147304 | -10 | Left | 948147300 | 2:235717109-235717131 | CCTAGACTCATCCCCTAAAGATG | 0: 1 1: 0 2: 0 3: 12 4: 127 |
||
| Right | 948147304 | 2:235717122-235717144 | CCTAAAGATGCTACCATGCATGG | 0: 1 1: 0 2: 0 3: 11 4: 134 |
||||
| 948147300_948147305 | -9 | Left | 948147300 | 2:235717109-235717131 | CCTAGACTCATCCCCTAAAGATG | 0: 1 1: 0 2: 0 3: 12 4: 127 |
||
| Right | 948147305 | 2:235717123-235717145 | CTAAAGATGCTACCATGCATGGG | 0: 1 1: 0 2: 2 3: 67 4: 460 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 948147300 | Original CRISPR | CATCTTTAGGGGATGAGTCT AGG (reversed) | Intronic | ||