ID: 948147305

View in Genome Browser
Species Human (GRCh38)
Location 2:235717123-235717145
Sequence CTAAAGATGCTACCATGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 2, 3: 67, 4: 460}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948147300_948147305 -9 Left 948147300 2:235717109-235717131 CCTAGACTCATCCCCTAAAGATG 0: 1
1: 0
2: 0
3: 12
4: 127
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460
948147294_948147305 8 Left 948147294 2:235717092-235717114 CCTGCCCCCAAGTCTACCCTAGA 0: 1
1: 0
2: 2
3: 12
4: 139
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460
948147293_948147305 16 Left 948147293 2:235717084-235717106 CCTGTTGTCCTGCCCCCAAGTCT 0: 1
1: 0
2: 2
3: 12
4: 234
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460
948147299_948147305 -8 Left 948147299 2:235717108-235717130 CCCTAGACTCATCCCCTAAAGAT 0: 1
1: 0
2: 1
3: 4
4: 119
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460
948147295_948147305 4 Left 948147295 2:235717096-235717118 CCCCCAAGTCTACCCTAGACTCA 0: 1
1: 0
2: 0
3: 10
4: 122
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460
948147292_948147305 27 Left 948147292 2:235717073-235717095 CCTTTTCTGCTCCTGTTGTCCTG 0: 1
1: 0
2: 3
3: 41
4: 437
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460
948147296_948147305 3 Left 948147296 2:235717097-235717119 CCCCAAGTCTACCCTAGACTCAT 0: 1
1: 0
2: 0
3: 8
4: 112
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460
948147298_948147305 1 Left 948147298 2:235717099-235717121 CCAAGTCTACCCTAGACTCATCC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460
948147297_948147305 2 Left 948147297 2:235717098-235717120 CCCAAGTCTACCCTAGACTCATC 0: 1
1: 0
2: 1
3: 8
4: 87
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460
948147291_948147305 28 Left 948147291 2:235717072-235717094 CCCTTTTCTGCTCCTGTTGTCCT 0: 1
1: 0
2: 1
3: 47
4: 534
Right 948147305 2:235717123-235717145 CTAAAGATGCTACCATGCATGGG 0: 1
1: 0
2: 2
3: 67
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948147305 Original CRISPR CTAAAGATGCTACCATGCAT GGG Intronic