ID: 948151282

View in Genome Browser
Species Human (GRCh38)
Location 2:235747039-235747061
Sequence GGATGCACTGAGTGTCTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948151282_948151286 -7 Left 948151282 2:235747039-235747061 CCCAGAAGACACTCAGTGCATCC 0: 1
1: 0
2: 0
3: 8
4: 169
Right 948151286 2:235747055-235747077 TGCATCCGTGGGTATGTGATAGG 0: 1
1: 0
2: 0
3: 5
4: 102
948151282_948151288 7 Left 948151282 2:235747039-235747061 CCCAGAAGACACTCAGTGCATCC 0: 1
1: 0
2: 0
3: 8
4: 169
Right 948151288 2:235747069-235747091 TGTGATAGGCATCTTAACAATGG 0: 1
1: 0
2: 1
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948151282 Original CRISPR GGATGCACTGAGTGTCTTCT GGG (reversed) Intronic
900647591 1:3715947-3715969 GGGTGCACTCAGTGTCTCCCAGG + Intronic
901133053 1:6974673-6974695 GGATGCACAGACTGTCTTCCAGG - Intronic
903060567 1:20665938-20665960 CCATGCACTGAGTGCCTACTAGG + Intronic
903922785 1:26812893-26812915 GGGTGAACAGAGTGTCCTCTGGG - Intergenic
904252809 1:29236978-29237000 GTGTGCGCTGAGTGTCTTGTGGG + Intronic
905850142 1:41267884-41267906 TGATCCACTGAGCATCTTCTGGG + Intergenic
906756449 1:48321274-48321296 GGATGCAGTGTGTTTCTTGTAGG - Intronic
907790855 1:57662050-57662072 GGAATCTCTGATTGTCTTCTTGG - Intronic
908218335 1:61978040-61978062 GGAGGCACAAAGTGACTTCTGGG - Intronic
909718956 1:78743548-78743570 AGATGCACTGAGATTCTTATAGG - Intergenic
910758597 1:90714801-90714823 GGAAGGACTGAGTGTCCTCCTGG + Intronic
912566840 1:110593418-110593440 GGATGCATTGGGTATCATCTTGG - Intergenic
912681229 1:111730219-111730241 GGAGGCACTGAGTTTGGTCTGGG - Intronic
915596182 1:156897709-156897731 GGAGCCACTGAGGGGCTTCTTGG + Intronic
915634392 1:157176186-157176208 GGATCCACTGGGTTTTTTCTTGG - Intergenic
916642593 1:166746660-166746682 AGATGAAGTGAGTTTCTTCTAGG - Intergenic
917138552 1:171811505-171811527 GGATGCAGTGATTGTGCTCTTGG + Intronic
922314018 1:224425283-224425305 TGATGCACTCACTCTCTTCTAGG + Intronic
1063145131 10:3289411-3289433 GGAAAGAATGAGTGTCTTCTGGG + Intergenic
1067373605 10:45707304-45707326 GGATGAAGGGAGTGTCTTCCTGG + Intergenic
1067380084 10:45764923-45764945 GGATGAAGGGAGTGTCTTCCTGG - Intronic
1067728622 10:48792435-48792457 ACATGTACTGAGTGTCTTCATGG - Intronic
1067887783 10:50105578-50105600 GGATGAAGGGAGTGTCTTCCTGG - Intronic
1068073851 10:52229516-52229538 GGAGTCCCTGAGTGGCTTCTTGG + Intronic
1070784086 10:79153163-79153185 GGAGGCTCTGAATGCCTTCTGGG + Intronic
1072188945 10:93065350-93065372 GGAGTCACTAAATGTCTTCTTGG - Intronic
1074308309 10:112299308-112299330 GGATGAACAGTGTGTCTTCTGGG + Intronic
1075341100 10:121647455-121647477 AGCTGGACTGAGTGGCTTCTGGG - Intergenic
1077239827 11:1504728-1504750 GGAAGCCCTGGGGGTCTTCTGGG - Intergenic
1079122203 11:17694277-17694299 GGAGGGACTGAGGGTCTCCTGGG - Intergenic
1079166107 11:18044994-18045016 TGATCTTCTGAGTGTCTTCTTGG - Intergenic
1081686904 11:45049246-45049268 GGAGCCAGTGAGCGTCTTCTGGG + Intergenic
1081830477 11:46107598-46107620 AGATGCAAGGAGTGTATTCTAGG + Intronic
1086198457 11:84170588-84170610 GGATGAGCTGAGTGTGTTCATGG + Intronic
1090749396 11:129732644-129732666 ATATGTACTGAGTGTCTACTAGG - Intergenic
1092533194 12:9362070-9362092 GGAGGCACGAAGTCTCTTCTCGG + Intergenic
1098426746 12:70372892-70372914 GGATGAACAGAGTTTCATCTTGG + Intronic
1100602187 12:96121359-96121381 GGGTGCACTGACTGTGGTCTGGG - Intergenic
1101005850 12:100400092-100400114 AGATGCACTGAGTGCTTTCTGGG - Intronic
1102219588 12:111185661-111185683 GGCTGCACTGAGTGTGTGCCGGG - Intronic
1103979426 12:124726875-124726897 GCATGCACTGGGTTTCTTCCGGG - Intergenic
1105635197 13:22209678-22209700 GGCTGCATTGTGAGTCTTCTAGG + Intergenic
1106207597 13:27614391-27614413 CTATGCTCTGAGTGGCTTCTGGG - Intronic
1107296555 13:38915003-38915025 GGTAGCACTCACTGTCTTCTGGG + Intergenic
1107601015 13:42012448-42012470 GGAAGCAATGAGGGCCTTCTGGG - Intergenic
1107684061 13:42879175-42879197 TCATGCACTGAGTCACTTCTGGG + Intergenic
1112101009 13:96189561-96189583 AGAAGCATTTAGTGTCTTCTGGG + Intronic
1113246729 13:108404730-108404752 GAATTCACTGAGATTCTTCTAGG + Intergenic
1114822033 14:26032249-26032271 GGAGCCAGTGAGTGTCCTCTGGG + Intergenic
1116631395 14:47339515-47339537 GGATGTAATGAGTGAGTTCTTGG + Intronic
1116857611 14:49966736-49966758 GGAGACACTGAGACTCTTCTAGG + Intergenic
1118337608 14:64867454-64867476 GGAAGGAATGTGTGTCTTCTGGG + Intronic
1123178227 14:106442398-106442420 GGAGGCACTGAGGGTCTTGCTGG + Intergenic
1125930455 15:43595987-43596009 GGATGCACTGAGTGGCCTGAAGG + Exonic
1125943623 15:43695819-43695841 GGATGCACTGAGTGGCCTGAAGG + Exonic
1128673714 15:69593977-69593999 GCAGGGTCTGAGTGTCTTCTCGG - Intergenic
1131418719 15:92285073-92285095 GGATGCTGTGAGTGTCTTGCTGG - Intergenic
1132734296 16:1377937-1377959 GGATGCAATGAGGCTTTTCTTGG - Intronic
1136665525 16:31808543-31808565 GTGTGCACTGAGTGTCTTCCAGG - Intergenic
1136737181 16:32475585-32475607 GGATGCACAGACTCTCCTCTCGG - Intergenic
1137520398 16:49190271-49190293 GGATGAACTTAGTGTGTTCAAGG - Intergenic
1141424628 16:83936799-83936821 GCATGCGCTGAGTGCCGTCTGGG + Intronic
1203015889 16_KI270728v1_random:353992-354014 GGATGCACAGACTCTCCTCTCGG + Intergenic
1203034224 16_KI270728v1_random:627150-627172 GGATGCACAGACTCTCCTCTCGG + Intergenic
1143171325 17:4932323-4932345 GAAGGCACAGAGCGTCTTCTAGG - Exonic
1143273062 17:5689791-5689813 GGCTGCACTGGGTCACTTCTTGG + Intergenic
1144182198 17:12762782-12762804 GGATGGACTCAGTGTCCTCAAGG + Intronic
1145274936 17:21423599-21423621 GGATTTACTGAGTGCCTACTGGG - Intergenic
1145722307 17:27084325-27084347 AGATGAACTGAGTTTCTTGTAGG - Intergenic
1146550141 17:33773602-33773624 AGATGCACTGAATGTCTTTTAGG + Intronic
1146556404 17:33828310-33828332 TGATTCACTGAGGGTCCTCTAGG + Intronic
1148063895 17:44854758-44854780 GGATGAAGTGACTGTCTTCCAGG - Intronic
1150083699 17:62262962-62262984 GGAAGCCCAGAGTGTCTACTGGG - Intergenic
1153291896 18:3509887-3509909 AAATGCACTGAGTGACTTGTGGG - Intronic
1157466403 18:47950134-47950156 GAATCCAATGAGTCTCTTCTTGG + Intergenic
1163481997 19:17562280-17562302 GGAGGCACTTGGTGTCTACTTGG + Intronic
1164597251 19:29538367-29538389 ACATCCACTGAGTGTATTCTAGG - Intronic
1168275625 19:55276758-55276780 GGCTGCACTGCAGGTCTTCTCGG + Intronic
925083626 2:1090736-1090758 GCATGCACTGTGTGTTTCCTGGG + Intronic
926036586 2:9640638-9640660 ACATTCACTGAGTGTCTGCTAGG + Intergenic
926072420 2:9908607-9908629 GCATTTACTGAGTGTCTACTAGG - Intronic
926728814 2:16019162-16019184 TCATGCACTGATTGTTTTCTGGG + Intergenic
929195832 2:39183373-39183395 TGATGCACTGAGAGGATTCTTGG + Intronic
929825948 2:45309932-45309954 GGATGCACTGAGGGCGCTCTGGG - Intergenic
929969021 2:46557223-46557245 GGGTACACTGAATGTTTTCTAGG - Intronic
930186966 2:48420326-48420348 CCATGCACTGAGTGCCTGCTGGG - Intergenic
935056360 2:99570852-99570874 TCATTCACTGAGTGCCTTCTAGG + Intronic
935486144 2:103656794-103656816 AGATGCAGTTTGTGTCTTCTGGG + Intergenic
936489852 2:112960720-112960742 GGAAGTTCTGAGTGCCTTCTGGG - Intergenic
937730708 2:125225110-125225132 GAATGCAGTGAGTGAATTCTGGG + Intergenic
937846563 2:126585110-126585132 ACATGCAATGAGTGTCTTCTGGG - Intergenic
940187335 2:151001774-151001796 GGATGCAATGTGTGTGTTCTTGG - Intronic
941294399 2:163718008-163718030 AGATGCACAGATTGTCTGCTTGG - Intronic
945827443 2:214741064-214741086 TGATGTAATGATTGTCTTCTAGG + Intronic
948151282 2:235747039-235747061 GGATGCACTGAGTGTCTTCTGGG - Intronic
1171076344 20:22129008-22129030 AGATGAAGTGAGTGTCTTGTAGG - Intergenic
1172047826 20:32093326-32093348 AAATCCACTGAGTGTCTTGTGGG - Intronic
1172222745 20:33284921-33284943 GGAGGGACTGAATGGCTTCTTGG - Intronic
1174273665 20:49387773-49387795 GGATCCACTGAGAGTCTAATGGG + Intronic
1181614800 22:24046450-24046472 GGAGGCTTTGAGTCTCTTCTTGG + Intronic
1182600653 22:31461048-31461070 GAATTTACTGAGTGCCTTCTTGG + Intronic
1183706583 22:39478313-39478335 GGATGCCCTGAGTGCCCACTGGG + Intronic
1184274884 22:43404549-43404571 GTGTTGACTGAGTGTCTTCTGGG + Intergenic
949357626 3:3198643-3198665 GGATGCAATGAGTAACTTGTAGG - Intergenic
951673703 3:25213505-25213527 GGATGCTCAGAGTGCCTTATTGG - Intronic
953173186 3:40525665-40525687 GGATGCACGGAGATTCTACTAGG - Intronic
954287149 3:49626991-49627013 AGATGGACTGAGTGTCTCCAAGG - Intronic
957261902 3:77912693-77912715 AGAAGCCCTGAGTCTCTTCTTGG + Intergenic
961160371 3:124719053-124719075 GGATGCCTTGAATGACTTCTGGG - Intronic
961405485 3:126676830-126676852 GGATGGACTCACTTTCTTCTTGG - Intergenic
964496249 3:157293446-157293468 GGAAGAACTGAATTTCTTCTTGG + Intronic
964893268 3:161562037-161562059 GGAAGCAATGTGTGGCTTCTAGG + Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968516283 4:1016974-1016996 GGGGGCACTGTGTCTCTTCTCGG + Intronic
969555769 4:7908418-7908440 TCATTTACTGAGTGTCTTCTAGG - Intronic
970073420 4:12189937-12189959 GTATGCACTGAGTTACTCCTTGG + Intergenic
970637555 4:18025294-18025316 GGATTCACTGACTGTCAGCTAGG + Intergenic
975069970 4:70122160-70122182 GGGTGAAGTGAGTCTCTTCTTGG - Intergenic
975095500 4:70452149-70452171 GGATGCAGTGTGTTTCTTGTAGG + Intronic
984502567 4:180574626-180574648 TGACACACTGATTGTCTTCTGGG + Intergenic
984702495 4:182827241-182827263 GGAGGCAGTGTGTGTGTTCTTGG + Intergenic
985126271 4:186697869-186697891 TCATGCACTGACCGTCTTCTTGG - Intronic
986587515 5:9334491-9334513 GGAAGCTCTGAGGGTCTTCATGG - Intronic
988715670 5:33824849-33824871 GTATGAGCTGAGAGTCTTCTAGG - Intronic
988853158 5:35198752-35198774 GAAAGCACTTAGTGTCTGCTTGG + Intronic
992211111 5:74480304-74480326 GCATGCAGTGAGTGACTTCGAGG + Intergenic
993226399 5:85170359-85170381 GCATGCACTGAGTCTCATCCAGG - Intergenic
993643165 5:90430920-90430942 CGATGATCTGAGTGACTTCTTGG - Intergenic
993921691 5:93813039-93813061 GGATTCATTGAGGGCCTTCTTGG - Intronic
995972178 5:117985793-117985815 TGATGCACTGAATGCTTTCTTGG - Intergenic
997987126 5:138510763-138510785 GCATACACTGAGTGTCTACTAGG + Intronic
998737189 5:145155565-145155587 GAATGCACTGAGTGTGATTTTGG + Intergenic
1000529090 5:162396123-162396145 GGGTGAAGTGAGTTTCTTCTAGG - Intergenic
1000823276 5:166012020-166012042 AGATGAAATGAGTCTCTTCTAGG + Intergenic
1001413862 5:171529373-171529395 GGATGAACCCAGTGTCTGCTGGG - Intergenic
1001501218 5:172236354-172236376 ATATGTACTGAGTGTCTACTGGG + Intronic
1003000643 6:2329224-2329246 TGCTGCACTGTGGGTCTTCTGGG + Intergenic
1005164795 6:22907358-22907380 GGATGGAATTAGTGTCTTCCTGG - Intergenic
1005595788 6:27377836-27377858 GGAACCACTGAATTTCTTCTTGG - Intronic
1006310280 6:33252872-33252894 GGAAGCACATAATGTCTTCTTGG - Intronic
1007512994 6:42388939-42388961 GGATGCACTGTGTGCCTACAGGG + Intronic
1008342685 6:50387052-50387074 GGAGGCAATGAGTGCCTTCAAGG + Intergenic
1008435450 6:51470519-51470541 GTATGCATTGAGAGTCTACTAGG + Intergenic
1009802055 6:68551145-68551167 GGATGAAGTGTGTTTCTTCTAGG - Intergenic
1011965224 6:93148316-93148338 GAAAGCATTGACTGTCTTCTGGG - Intergenic
1013340645 6:109211953-109211975 AGATGAAGTGAGTTTCTTCTAGG + Intergenic
1016024257 6:139269756-139269778 GGATGCACACAGTATCATCTTGG + Intronic
1017787679 6:157769773-157769795 GGAAGCACTGGGTGTGTTGTGGG + Intronic
1018133750 6:160757765-160757787 TGATTGACTGAGTGCCTTCTCGG + Intergenic
1019575525 7:1735777-1735799 GGAGGAAATGAGTGTCTACTGGG + Intronic
1022529984 7:31061049-31061071 GGAAGCAGTGAGTATCTGCTAGG + Intronic
1032405790 7:131654585-131654607 GGATGCATTGTGTGTTTTGTGGG + Intergenic
1033014086 7:137653855-137653877 GGAGGCAGTGAGTGACTGCTGGG + Intronic
1035382186 7:158447213-158447235 GGAGGCACCGAGTGTTGTCTGGG - Intronic
1036688346 8:10926164-10926186 GGCAGCCCTGAGTGTGTTCTTGG - Intronic
1038857328 8:31348034-31348056 GATTAAACTGAGTGTCTTCTGGG - Intergenic
1044605155 8:94041860-94041882 GGATGCTCTGAGGTTTTTCTTGG - Intergenic
1044933441 8:97271616-97271638 GGATTCACTCAGAGTCTGCTTGG - Intergenic
1045475279 8:102547350-102547372 GGCTGATCTGACTGTCTTCTGGG - Intergenic
1048059614 8:130904576-130904598 GGCTGCACTGAGGGTCCTTTGGG + Intronic
1052276729 9:26685109-26685131 GGAATCCCTGAGTGTCTACTAGG + Intergenic
1052788160 9:32849225-32849247 AAATGAACTGAGTGACTTCTAGG - Intergenic
1056151275 9:83791627-83791649 GGATTCATTTAGAGTCTTCTAGG + Intronic
1056382197 9:86065476-86065498 GAATGTAATGATTGTCTTCTGGG - Intronic
1056731799 9:89172320-89172342 GGATCCACTGAGGGTCCACTGGG - Intronic
1057181774 9:93034536-93034558 GTCTGCAGTGGGTGTCTTCTGGG - Exonic
1059554213 9:115262626-115262648 GTATGCAATCAGTGTCTGCTGGG - Intronic
1059883502 9:118718709-118718731 GAGTGCACTGAGTGCCTACTTGG - Intergenic
1060035989 9:120256191-120256213 CAAACCACTGAGTGTCTTCTAGG - Intergenic
1061868052 9:133505570-133505592 GGATCCACGGAGTGTCTGCATGG - Intergenic
1062608589 9:137361164-137361186 GGAAGCACCCAGTGTCTCCTGGG - Intronic
1185927779 X:4166343-4166365 ATATTCACTGAGTGTCTTCCAGG + Intergenic
1188686372 X:33075220-33075242 CTGTGCACTGAGTCTCTTCTGGG - Intronic
1190218625 X:48496409-48496431 GGATGGACTCAGTGGCCTCTGGG + Intergenic
1191959389 X:66683540-66683562 GGATGCATGAAGAGTCTTCTTGG + Intergenic
1197401667 X:125999726-125999748 GCATGGACTAAGTGTTTTCTGGG - Intergenic
1199708775 X:150453154-150453176 GCATGAACTGAGCATCTTCTTGG - Intronic
1202114304 Y:21455465-21455487 GGATCCAGTGTGTGTCTGCTTGG - Intergenic