ID: 948152569

View in Genome Browser
Species Human (GRCh38)
Location 2:235755859-235755881
Sequence GGTCTCCGGAAGGTCAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948152569 Original CRISPR GGTCTCCGGAAGGTCAGGAA GGG Intronic
900468202 1:2835949-2835971 GGTCTCCTGAAGGGCAGTCATGG + Intergenic
901024544 1:6272171-6272193 GGCCTCCAGCAGGACAGGAAGGG - Intronic
904031429 1:27535897-27535919 GGTCCCCTGAAGGACAGGGATGG + Intronic
906257218 1:44359477-44359499 GCTCTCCGGGAGGTCAGTCATGG + Intergenic
909108750 1:71447625-71447647 GTACTTAGGAAGGTCAGGAAAGG - Intronic
911089842 1:94009666-94009688 GGCTTCCAGAAGGTCAGGGAGGG - Intronic
912686802 1:111774381-111774403 GGTGTTGGGAAGGGCAGGAAAGG + Intronic
914911611 1:151791445-151791467 GGTCCCTGGACGGTTAGGAACGG + Intergenic
921572776 1:216798483-216798505 GGCCTCCAGAAAGCCAGGAAGGG + Intronic
921979491 1:221240330-221240352 GGTCTCAGGAAGGAGAAGAAGGG - Intergenic
922816390 1:228452632-228452654 GGTCAGTGGAAGGTCAGGAGGGG - Intergenic
1064079759 10:12298949-12298971 AGTCTCCGAAAGGTTAGGGAGGG + Intergenic
1064147974 10:12840524-12840546 GGGCTCCGGAAGGCTGGGAAGGG - Intergenic
1072973683 10:100039115-100039137 AGTCTTGGGAAGGTCAGGAAAGG - Intergenic
1076831497 10:132996583-132996605 GGTCTCCGTGGGGTCAGGAAGGG - Intergenic
1077402511 11:2366207-2366229 GCTCTCCAGAAGGTCAGCTATGG - Intergenic
1077408147 11:2391716-2391738 GGTGTCAGGAAGGACGGGAAAGG + Intronic
1082001807 11:47397238-47397260 GGACTCCTCCAGGTCAGGAAGGG - Intergenic
1083764109 11:64833929-64833951 GAGCTCCGGAAGGACAGGAAGGG + Exonic
1084704294 11:70806868-70806890 GGCCCCTGGAAGGGCAGGAATGG - Intronic
1091650393 12:2304844-2304866 GGTCTCAGGCAGGGCAGGCAGGG + Intronic
1091848937 12:3679607-3679629 AAGCTCCTGAAGGTCAGGAAAGG + Intronic
1092106047 12:5922409-5922431 GGTCAGAGGAGGGTCAGGAAAGG - Intronic
1094305712 12:29016957-29016979 GGTCTCAGGATGGTCAATAAAGG - Intergenic
1096719905 12:53513461-53513483 GGTGTCTGGAAGAACAGGAAAGG - Exonic
1097161199 12:57047858-57047880 GGCCTCCAGAAGGCCAGGGAAGG + Intronic
1101532617 12:105587720-105587742 GAGCTCTGGGAGGTCAGGAATGG - Intergenic
1103836108 12:123822376-123822398 GGACTCAAGAAGGGCAGGAACGG - Intronic
1113938105 13:114005779-114005801 GGTGTCCGGCAGGGCAGGAGGGG - Intronic
1113938129 13:114005851-114005873 GGTGTCCGGCAGGGCAGGAGGGG - Intronic
1113938514 13:114007035-114007057 GGTGTCCGGCAGGGCAGGAGTGG - Intronic
1113938549 13:114007147-114007169 GGTGTCCGGCAGGGCAGGAGTGG - Intronic
1113938594 13:114007276-114007298 GGTGTCCGGCAGGGCAGGAGGGG - Intronic
1113938643 13:114007422-114007444 GGTGTCCGGCAGGGCAGGAGGGG - Intronic
1120982036 14:90298728-90298750 GGTCTCCAGATGGGTAGGAAGGG + Intronic
1121795200 14:96728686-96728708 GGTCTCCTGATGGTCACGGATGG - Intergenic
1122817153 14:104319418-104319440 GGTCTCAGCCAGGGCAGGAAGGG + Intergenic
1126362328 15:47859257-47859279 TGATTCCGGTAGGTCAGGAATGG + Intergenic
1128349802 15:66881283-66881305 GGTCTTCTGGAGCTCAGGAAGGG + Intergenic
1128675175 15:69603182-69603204 GGTCTCTGGAAAGGCAGGAGTGG + Intergenic
1129703997 15:77784161-77784183 GGTCTCCGGGAGGTCCCAAAAGG + Intronic
1132405852 15:101541532-101541554 GGTCTCGGGGAAGTCAGGATGGG + Intergenic
1133262449 16:4559880-4559902 GGTTTCCAGAGGCTCAGGAAGGG + Intronic
1137252813 16:46752161-46752183 GGTCACCAGAAGGCCAGGGAAGG - Intronic
1137930942 16:52587044-52587066 GGTGTCCTGGAGGACAGGAAAGG - Intergenic
1138580363 16:57937148-57937170 GTTCTCCGGGAGGTGAGGACAGG + Intronic
1139472080 16:67183790-67183812 CTTCTCCGGGAGATCAGGAAAGG + Exonic
1139852736 16:69960775-69960797 GCTCCCCGGCAGGGCAGGAAAGG + Intronic
1139881707 16:70183683-70183705 GCTCCCCGGCAGGGCAGGAAAGG + Intronic
1140370801 16:74411823-74411845 GCTCCCCGGCAGGGCAGGAAAGG - Intronic
1141944596 16:87300686-87300708 GGTTTCTGGGAGCTCAGGAAGGG - Intronic
1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG + Exonic
1147167268 17:38600326-38600348 GGTCCCCAAAAGGTCAGGCAGGG + Intronic
1152029723 17:77834545-77834567 GGCCTCTGGAATGCCAGGAAAGG + Intergenic
1153031684 18:719249-719271 GGTCTCCAGAAGCACTGGAATGG + Intergenic
1153463840 18:5366935-5366957 GGCCTCAAGTAGGTCAGGAAAGG - Intergenic
1159035704 18:63275410-63275432 GGTCCCGGGGAGGACAGGAAGGG - Intronic
1160211341 18:76882792-76882814 GGTATCTGGCAGGGCAGGAAAGG + Intronic
1161821554 19:6533584-6533606 GGTCTCTGGAAGGGGAGGGAAGG - Intronic
1161829995 19:6595881-6595903 GTTCTTGGGAAGGTCAGAAAAGG - Intronic
1162359235 19:10207680-10207702 GGGCTAGGGGAGGTCAGGAAAGG - Intronic
1162459937 19:10808837-10808859 GGTTTCCTGTAGGTCAGGGATGG + Intronic
1163572425 19:18090399-18090421 GGTCTCAGGATGGTCAGGAGGGG - Intronic
1164503825 19:28841654-28841676 GGCCTCAGGAAGGCCAGGAAAGG - Intergenic
1168321473 19:55512863-55512885 GGTCTCCACGAGGTCAGGTAGGG + Intronic
931426667 2:62177996-62178018 GGTCTCAGGAAAGGCAGGAATGG + Intergenic
932166120 2:69508785-69508807 GGGCTCGGGAAGGTGAAGAATGG + Intronic
933386350 2:81615732-81615754 GGCCTCCAGAAGATCAGGACAGG - Intergenic
934516881 2:94993881-94993903 GGCCTCGGGTAGGTCAGCAAGGG + Intergenic
936373076 2:111919242-111919264 GGGCTGCGGAAGGCCAGGGATGG - Intronic
936949999 2:117968190-117968212 GGTCCCTGGGAGGGCAGGAAGGG - Intronic
938397268 2:130960924-130960946 GGTCTCCGGAAGATTAAAAAGGG + Intronic
938594687 2:132776157-132776179 GTTCTTTGGAAGGTCTGGAAAGG - Intronic
945878835 2:215305891-215305913 TGTCTAAGGAATGTCAGGAAGGG - Intergenic
947064541 2:226207813-226207835 TGTCACTGGAAGGTCAGGAGAGG - Intergenic
948152569 2:235755859-235755881 GGTCTCCGGAAGGTCAGGAAGGG + Intronic
1170376967 20:15710825-15710847 GGCCTCTGGAAGGTCAAGACTGG - Intronic
1172102406 20:32493162-32493184 GCTCTCCGGCAGGTGAGGAGAGG + Intronic
1173736772 20:45367327-45367349 GGTATCTGAGAGGTCAGGAAGGG + Exonic
1174136606 20:48384563-48384585 GGCCTCCGGGGCGTCAGGAAAGG - Intergenic
1174683500 20:52431056-52431078 GGTCCCTGGAATGTCAGGAATGG - Intergenic
1175416687 20:58805793-58805815 TGTTTCTGGAAGGTCAGGAGTGG - Intergenic
1176264114 20:64199711-64199733 ACTCTCTGGGAGGTCAGGAAAGG + Intronic
1176289314 21:5035734-5035756 TGTCTCCAGAAGGGCTGGAAAGG + Intronic
1179115840 21:38490986-38491008 GCTCTCTGGAAGGTCAGGGAAGG + Intronic
1179867915 21:44227853-44227875 TGTCTCCAGAAGGGCTGGAAAGG - Intronic
1181627593 22:24132236-24132258 GGTCTCAGGAAGCCCAAGAAAGG - Intronic
1181879288 22:25964949-25964971 GGTCTCAGGAAGGTTGGGATTGG - Intronic
1182220434 22:28754377-28754399 GTTCTGTGGAAGGTCAGGCACGG + Intronic
1182651739 22:31857298-31857320 GGTATCATGAAGGTCTGGAAAGG + Intronic
1184815263 22:46864065-46864087 GGCATCAGGAATGTCAGGAAAGG - Intronic
951407121 3:22314832-22314854 GGTTTCCTGGAGGTCAGGACAGG + Intronic
953687874 3:45092425-45092447 TCTCTCCTGAAGGTAAGGAAGGG - Intronic
954875805 3:53802553-53802575 AACCTCCTGAAGGTCAGGAATGG + Intronic
955660399 3:61292764-61292786 GGCCTCAGGAAGGGCAAGAAGGG - Intergenic
967514829 3:190354845-190354867 GGTTTCAGAAAGGGCAGGAATGG - Intronic
968700964 4:2058334-2058356 GGTCACCTGAAGGCCAGGAGGGG - Intergenic
976036114 4:80823158-80823180 GGTCTCCTCAGGGACAGGAATGG + Intronic
981678648 4:147368525-147368547 GGTCTCCAGAAGGGCATGCAAGG - Intergenic
983130485 4:164012814-164012836 GGGCTCCATAAGCTCAGGAATGG - Intronic
991339069 5:65585569-65585591 GGTTTCTGGCAGGTCAGAAACGG + Intronic
994023385 5:95053678-95053700 GGTACCTGGTAGGTCAGGAAAGG - Intronic
996321578 5:122222768-122222790 GGGCCCTGGAAGGTGAGGAATGG - Intergenic
997110394 5:131067990-131068012 GGCCTCTGGAAGAACAGGAATGG - Intergenic
1001009719 5:168086648-168086670 GGTCTGCAGAAGCTCTGGAAGGG - Intronic
1008299140 6:49813001-49813023 GGTCTCCAGGAGCTTAGGAAAGG + Intergenic
1011734822 6:90299772-90299794 GGTCACGGGAAGTACAGGAATGG + Intergenic
1014421112 6:121246179-121246201 TGTCTCCGGCAGGACTGGAATGG - Intronic
1016915929 6:149244464-149244486 GGACTCTGGGAGTTCAGGAAAGG + Intronic
1017755160 6:157523238-157523260 TGGCTCCTGAAGGGCAGGAAAGG - Intronic
1021184130 7:17543050-17543072 GATCTCCTGCAAGTCAGGAATGG - Intergenic
1021685677 7:23183037-23183059 GCTATCCGGGAGGTGAGGAAAGG + Intronic
1023168658 7:37368740-37368762 GGTGTCAGGAAGGTGAGGGATGG - Intronic
1023413646 7:39911483-39911505 TGTCTCCTGAAGGGCTGGAATGG - Intergenic
1023997418 7:45169609-45169631 GGCCACCAGAAGTTCAGGAAAGG - Intronic
1024010925 7:45266153-45266175 GGTCCCCGTAGGGTCTGGAAAGG - Intergenic
1029312040 7:99676371-99676393 GGTCTCAGAATAGTCAGGAAAGG - Intronic
1029870025 7:103680810-103680832 GGTGTCAGGAATGTCAGAAAAGG + Intronic
1030080161 7:105770689-105770711 GGTCTCCTTAAGGTCTGGCAGGG - Intronic
1032838740 7:135697414-135697436 GGTCTCAGGAAGGTTAGAAAGGG - Intronic
1034427309 7:151020839-151020861 GGGCTTCGGAAGGGCAGGACAGG - Intronic
1035107252 7:156452200-156452222 GGGGTCTGGATGGTCAGGAAGGG - Intergenic
1044123524 8:88428032-88428054 GGTTACCTGAAGTTCAGGAATGG - Intergenic
1045286456 8:100795967-100795989 GGTCCCCAGGAGGGCAGGAAAGG + Intergenic
1047216422 8:122879810-122879832 GTTCTCCAGAAGCTCAGAAAGGG - Intronic
1047759227 8:127941904-127941926 GGTCTCAGGAAGGAGAGGCATGG - Intergenic
1048016038 8:130498711-130498733 GGTCTCAGCGAGGTCAGGGAGGG + Intergenic
1049188518 8:141272551-141272573 GGACTCCGTGAGGTGAGGAATGG - Intronic
1049837566 8:144748019-144748041 GCACTCTGGAAGGCCAGGAAGGG - Intronic
1049948435 9:621117-621139 GTTCTCCAAAGGGTCAGGAAAGG - Intronic
1055266345 9:74498964-74498986 GGTCTCCGGCAAGGCAGGAGAGG - Intronic
1057970972 9:99557157-99557179 GGTCTAGGGAGGCTCAGGAATGG - Intergenic
1060220643 9:121762429-121762451 GGTCGCCTGCTGGTCAGGAAGGG + Intronic
1060749920 9:126162406-126162428 GGAGTCCGCAAGGTCTGGAAGGG + Intergenic
1062174958 9:135156469-135156491 GGTCTCCAGAAACTTAGGAAAGG + Intergenic
1189433415 X:40969702-40969724 GGTCTCAAGAAAGTCGGGAAGGG - Intergenic
1192334529 X:70206231-70206253 GGTCTCCAGAAAATGAGGAATGG - Intergenic
1192433469 X:71127821-71127843 GGTCGAGGGATGGTCAGGAAAGG - Intronic
1196637302 X:118017592-118017614 GGTCTTGGGAGGGTCAGGACAGG - Intronic