ID: 948152785

View in Genome Browser
Species Human (GRCh38)
Location 2:235757502-235757524
Sequence GACATGGATCTGCCTAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948152785_948152787 2 Left 948152785 2:235757502-235757524 CCTGGTCTAGGCAGATCCATGTC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 948152787 2:235757527-235757549 TCCTTTGACCTCATTGCCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948152785 Original CRISPR GACATGGATCTGCCTAGACC AGG (reversed) Intronic
902930818 1:19730275-19730297 GATATGGAGCTCCCTCGACCTGG + Intronic
903275042 1:22216253-22216275 GCCATGGAGCTGAGTAGACCAGG + Intergenic
904599204 1:31664565-31664587 GACATGGCTCTGCCTTGGCTTGG - Intronic
913416557 1:118615218-118615240 GACAAGGATCTGCTGAAACCTGG - Intergenic
916773596 1:167936894-167936916 GACATGGCTCTGCCTGAGCCGGG - Exonic
919075690 1:192809766-192809788 GACATGGAACTGTCTGGAGCCGG - Intronic
919249481 1:195033731-195033753 GCTGTGAATCTGCCTAGACCTGG + Intergenic
1070257708 10:74825818-74825840 GACATCGTTCTGCCTGCACCCGG + Intronic
1071007584 10:80900598-80900620 TGCCTGGATCTGACTAGACCGGG - Intergenic
1072905593 10:99450430-99450452 GACTTGGATCTGCCTCAACCTGG - Intergenic
1073570742 10:104579081-104579103 AAGCTGGATCTGCCTTGACCAGG - Intergenic
1073623159 10:105069928-105069950 GCTATGGATCTGGCTAGACTGGG - Intronic
1085269461 11:75261759-75261781 GAGATGGAGCTGCCTGGGCCAGG + Intergenic
1086315853 11:85591360-85591382 GAAATGGATCTGCCTGGAACAGG - Intronic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1095688998 12:45066726-45066748 GACATGCTTATGCTTAGACCTGG + Intergenic
1097992790 12:65853730-65853752 TGCATTGAGCTGCCTAGACCAGG - Intronic
1105902601 13:24769010-24769032 GACATGGAGCTCCTTAGACGTGG + Intronic
1120932919 14:89866646-89866668 GACATGTTTCAGCCTAGACAAGG - Intronic
1122743731 14:103886181-103886203 GACATTGACCTGCCTAGAGGTGG + Intergenic
1123767602 15:23496944-23496966 GACAGTGGTCTGCCTAGTCCAGG - Intergenic
1124570664 15:30860362-30860384 GACAGTGGTCTGCCTAGTCCAGG + Intergenic
1135424802 16:22327088-22327110 CACAAGGCTCTGCCCAGACCTGG + Intronic
1136174225 16:28506488-28506510 TTCATTTATCTGCCTAGACCTGG + Intronic
1138439228 16:57024278-57024300 GACATGGAGCTGCTTAGGGCAGG + Intronic
1140607676 16:76560985-76561007 GATATTGATCTTCCAAGACCTGG + Intronic
1144448445 17:15353993-15354015 GAGATGGAGCTGCCTAGATGGGG - Intergenic
1157701924 18:49766741-49766763 CACACGGATCTGCCCAGCCCTGG - Intergenic
1158165165 18:54532017-54532039 TAAATGGATCAGCATAGACCAGG + Intergenic
1162015741 19:7845685-7845707 GGCATTGATCTGCCTCCACCAGG + Intronic
1163790019 19:19301187-19301209 GAGATGGATCTGCCTGGGACTGG - Intronic
1164037693 19:21468628-21468650 GACATCCATGTGCCTAGGCCTGG + Intronic
1166688973 19:44811509-44811531 GACTTGGCTGTGCCTAGACACGG - Intronic
925442505 2:3900590-3900612 AACATGGAGGTGCCTACACCAGG - Intergenic
925687582 2:6489099-6489121 CACATGGATGTGCATGGACCCGG + Intergenic
925697284 2:6594397-6594419 GGCATGGAGCTGCCCAGAGCTGG - Intergenic
928269889 2:29846463-29846485 GACAAGGATCATCCTAGACAAGG - Intronic
929996682 2:46830601-46830623 GTCATGGAGCTTCCTATACCTGG + Intronic
930312917 2:49764416-49764438 CACATGGTTTTTCCTAGACCTGG + Intergenic
932269695 2:70398675-70398697 GACATGGATCTGACTGGATCTGG - Intergenic
937797062 2:126036275-126036297 GGCAGGGATCTGCCTTGCCCAGG + Intergenic
945563504 2:211367696-211367718 GACATGCTTCTTCCTACACCTGG - Intergenic
948152785 2:235757502-235757524 GACATGGATCTGCCTAGACCAGG - Intronic
1171062576 20:21980765-21980787 GCCATGGATCTGCCTCCTCCAGG + Intergenic
1171176921 20:23058405-23058427 AACATGTATCTGGCTGGACCTGG + Intergenic
1171183675 20:23109935-23109957 GAGTTGGAGCTGTCTAGACCAGG + Intergenic
1172009555 20:31838454-31838476 GACATGGCTCAGCCTCCACCGGG - Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1182782468 22:32879227-32879249 TTCATGGATCTGCCAAGACACGG + Intronic
1184220073 22:43094431-43094453 GACCCGAACCTGCCTAGACCTGG + Intergenic
959234320 3:103699075-103699097 GACCTGGTTCTACCTTGACCTGG + Intergenic
959382163 3:105654138-105654160 GACAGGGCTCTGCCTATCCCAGG + Intergenic
963078457 3:141369201-141369223 GACACGTATTTGCCTAGAACAGG - Intronic
963594150 3:147304007-147304029 GACAATGATCAGCCTAGACTCGG + Intergenic
964965412 3:162486423-162486445 CACATTGATCTACCTAAACCTGG - Intergenic
970443392 4:16104354-16104376 GACTTGGATCTGACCAGTCCTGG + Intergenic
970492273 4:16586369-16586391 AGCATGGATCTGCCCAGTCCAGG - Intronic
976177683 4:82371970-82371992 GACAAGAATCTGCCTAGGCTGGG + Intronic
980846372 4:138330008-138330030 GACATGCATTTGCCTACAGCTGG + Intergenic
982589164 4:157282508-157282530 GACATGGATTTCCGAAGACCTGG + Intronic
996688361 5:126310078-126310100 GACATGGCTCTGCCCAGGACTGG - Intergenic
1000147446 5:158467215-158467237 CACATGGAGCCGCCGAGACCAGG + Intergenic
1003810581 6:9775326-9775348 AATCTGTATCTGCCTAGACCAGG - Intronic
1013016637 6:106165832-106165854 GAGCTGAATCTGCCTAGACATGG + Intergenic
1019875899 7:3810385-3810407 GAAATGTTTCTGCCTAAACCTGG + Intronic
1023584985 7:41719827-41719849 GGCTCTGATCTGCCTAGACCAGG - Intergenic
1024063483 7:45715545-45715567 GACAGGGATCAGCCTGGAGCAGG - Exonic
1029283446 7:99450976-99450998 CAGGTGGCTCTGCCTAGACCAGG + Intronic
1030801661 7:113859797-113859819 GCCATGAATCTGTCTAGTCCTGG - Intergenic
1030949971 7:115777966-115777988 GAAATGCATTTTCCTAGACCGGG - Intergenic
1032085572 7:128881698-128881720 GACATGGCTCTGCATCCACCAGG - Exonic
1032526535 7:132582018-132582040 GACATGGCTCTGGCCAGATCTGG - Intronic
1037896301 8:22658669-22658691 AACATGGATAAGCCTAGGCCTGG + Intronic
1039972352 8:42331053-42331075 GACATGGGGCTGCCTGGAGCAGG + Exonic
1043126612 8:76404287-76404309 GAGATGGATCTGCCTCATCCAGG + Intergenic
1046731853 8:117734734-117734756 ATCATTGATCTACCTAGACCTGG + Intergenic
1048870370 8:138792237-138792259 GGCAGGGATTTGCCTAGACAAGG - Intronic
1055319271 9:75066246-75066268 GACAGGGATCTGCCTAAATATGG - Intronic
1060862733 9:126968408-126968430 GACCTGGCTCTGCCAATACCTGG - Intronic
1061670657 9:132186431-132186453 GCCATGGCTCTGGCTAGACAAGG - Intronic
1062399149 9:136364901-136364923 GACGTGGATGTGCCTGGTCCTGG - Intronic
1203434508 Un_GL000195v1:124964-124986 GACAGGGATCTGACAAAACCAGG + Intergenic