ID: 948152881

View in Genome Browser
Species Human (GRCh38)
Location 2:235758406-235758428
Sequence TGCACCATGTACCTCTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948152881_948152886 -6 Left 948152881 2:235758406-235758428 CCTTCCCAGAGGTACATGGTGCA 0: 1
1: 0
2: 0
3: 15
4: 135
Right 948152886 2:235758423-235758445 GGTGCAGCTGGTGTCAGGCGAGG 0: 1
1: 0
2: 3
3: 22
4: 261
948152881_948152890 26 Left 948152881 2:235758406-235758428 CCTTCCCAGAGGTACATGGTGCA 0: 1
1: 0
2: 0
3: 15
4: 135
Right 948152890 2:235758455-235758477 CCCGTTTCTACCTGTGGTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 102
948152881_948152888 20 Left 948152881 2:235758406-235758428 CCTTCCCAGAGGTACATGGTGCA 0: 1
1: 0
2: 0
3: 15
4: 135
Right 948152888 2:235758449-235758471 TCATTTCCCGTTTCTACCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948152881 Original CRISPR TGCACCATGTACCTCTGGGA AGG (reversed) Intronic
902797766 1:18810404-18810426 TGCTCCATGTCACTCTGGGGTGG - Intergenic
904053765 1:27656842-27656864 TGCACCAACTACCTCAGGCAAGG + Intergenic
904287198 1:29460390-29460412 TGCCCCATGTCCCTGTGGGAGGG + Intergenic
904598360 1:31660686-31660708 TGCACCATGTGGCTGTCGGATGG + Intronic
906705592 1:47892822-47892844 TTGACCATGTGGCTCTGGGAAGG + Intronic
908809263 1:67962731-67962753 TGCATCTTGTTCCACTGGGAAGG + Intergenic
910480445 1:87653043-87653065 TGATACATGTACCTCTCGGAAGG - Intergenic
911096602 1:94060301-94060323 TGGACCATGGACCCCTGGGCAGG + Intronic
913544992 1:119859425-119859447 TATACCAGGTCCCTCTGGGAAGG + Intergenic
914463693 1:147908217-147908239 TGCCCCACGTACATCAGGGACGG - Exonic
917465677 1:175273776-175273798 TAGACCATGTAGCTTTGGGATGG + Intergenic
920175755 1:204100830-204100852 TCCACCAAGAACCCCTGGGATGG + Intronic
922425699 1:225490609-225490631 AGCCCAAAGTACCTCTGGGAAGG + Exonic
1064123447 10:12638833-12638855 TTCCCCATCTTCCTCTGGGAGGG + Intronic
1064714495 10:18162901-18162923 TGCACAATGTGTTTCTGGGATGG + Intronic
1065387638 10:25149015-25149037 TGCATCATCTTCCTCTTGGAGGG + Intergenic
1066255136 10:33671231-33671253 TTCACCATTTTTCTCTGGGATGG + Intergenic
1066307880 10:34164310-34164332 TGCACCATGTACTTCTGCAAAGG + Intronic
1068704580 10:60059835-60059857 TGCTCTATGTTCCCCTGGGAAGG + Intronic
1069249565 10:66251103-66251125 TGCACCAGGAACCTCTTAGAAGG + Intronic
1070804701 10:79264269-79264291 TGCTCCAAGGACCTCTGGGCAGG - Intronic
1072546415 10:96442811-96442833 TGCATCATCTACCTCTGGACTGG - Intronic
1075724402 10:124604135-124604157 AGACCCATGTACCTCTGGGAAGG - Intronic
1077155897 11:1090659-1090681 TGCAGGATGCCCCTCTGGGAAGG - Intergenic
1078477719 11:11646258-11646280 TGCTCCATGTAACCCTGGAAAGG + Intergenic
1078564827 11:12405281-12405303 TGCACCATATACCTTTGAGTGGG + Intronic
1078643184 11:13114804-13114826 TGCACCCTGACCCTCTGGCAAGG - Intergenic
1080612350 11:33915488-33915510 TGCACCAGGTTCCTCTGGAAGGG + Intergenic
1080933321 11:36836907-36836929 TGCACCAGGTAGGCCTGGGAAGG - Intergenic
1083263308 11:61534791-61534813 TGTGCCATGGCCCTCTGGGAGGG - Intronic
1086641345 11:89160486-89160508 TGAACAATGTACCTCTGGAATGG - Intergenic
1087095683 11:94315155-94315177 TGCAGCATCTACTTCTGGGGAGG - Intergenic
1088409657 11:109520321-109520343 CTCCCCATGTACCTCTGGGGAGG + Intergenic
1091126788 11:133107115-133107137 TGCACAATCTTCCTCTTGGATGG - Intronic
1091201454 11:133783981-133784003 TGCAGCATGTAGTTCAGGGATGG + Intergenic
1094185216 12:27634745-27634767 TGCACCATGTAACTCTGACTTGG + Intronic
1102891571 12:116562511-116562533 TGATCCATGTAGCCCTGGGAAGG + Intergenic
1103898693 12:124291929-124291951 TGCACCATACACCCCTGGGAAGG - Intronic
1106244276 13:27933897-27933919 TGCTCAATGGACCTCAGGGAAGG + Intergenic
1107062971 13:36180813-36180835 TGTACCATGTGCCACTGAGAAGG + Intronic
1109212280 13:59548188-59548210 TGCACCCTGTACCCCTGTGCTGG + Intergenic
1110690558 13:78426547-78426569 TGCAACATATTCCTTTGGGATGG + Intergenic
1111858597 13:93671828-93671850 AGAACCATGGACCTATGGGAGGG + Intronic
1113364439 13:109662976-109662998 TGCAGCATGTAGCTCTGAGATGG + Intergenic
1116093057 14:40333394-40333416 AGCACCATCCACCTCTGGAAAGG + Intergenic
1117770091 14:59125428-59125450 TGCACCCTTTACTTCAGGGAGGG + Intergenic
1119683381 14:76610125-76610147 TGAACAATGTATCTCTTGGAAGG - Intergenic
1122728116 14:103773707-103773729 AACACCATGTACCTCTGGAAAGG + Intronic
1122960720 14:105092691-105092713 GGCACCACGGGCCTCTGGGAGGG - Intergenic
1124683841 15:31761273-31761295 TGCACAATGTACATCTGATAAGG + Intronic
1129235544 15:74221797-74221819 AGCACCCTGAGCCTCTGGGAAGG - Intergenic
1139423893 16:66866970-66866992 TGCTCCATGTGCCTGTGGAATGG + Intronic
1141578051 16:84977563-84977585 TTCACCATGTTCCCCTGGGGTGG + Intronic
1141732234 16:85830281-85830303 AGCACCATGTCCATTTGGGATGG + Intergenic
1141938925 16:87261420-87261442 AGCACCATGAACCCCTGGCAGGG - Intronic
1143626727 17:8114541-8114563 GGCTCCATGTACATCAGGGATGG + Exonic
1144221034 17:13100086-13100108 TGCACAATGTAACTCACGGAGGG - Intergenic
1144851589 17:18246679-18246701 TGCATCGTGTACTTCTGGCAGGG - Exonic
1144931747 17:18864702-18864724 TTCACCTGGGACCTCTGGGAAGG - Intronic
1147607607 17:41783114-41783136 TGCCCCATGCAGCTCTGGAAAGG - Intronic
1148352257 17:46949652-46949674 AGCACCTTGTACCTGTGTGACGG - Intronic
1148643763 17:49207208-49207230 AGCAGGAGGTACCTCTGGGATGG - Intronic
1149057952 17:52387823-52387845 TGCCTCATGGAGCTCTGGGAAGG + Intergenic
1151777306 17:76214162-76214184 TGCACCCTCAACCTGTGGGATGG + Intronic
1152666571 17:81573720-81573742 TGGACCATTTTTCTCTGGGAGGG - Intronic
1153524129 18:5978951-5978973 AGCACGACCTACCTCTGGGAGGG + Intronic
1157470309 18:47983273-47983295 TTCATCATGGTCCTCTGGGATGG + Intergenic
1161593271 19:5138251-5138273 TGTACCTTGCACCTCGGGGAAGG - Intronic
1163170800 19:15529761-15529783 TGCACCATGTACTCTTGGTATGG + Exonic
1163300089 19:16439728-16439750 TGCACCATGAACCTCAAAGAAGG + Intronic
1166822757 19:45590806-45590828 TGCACCTGGTCCCCCTGGGAGGG + Exonic
1166888303 19:45974117-45974139 TGGACCACGTCCCTCTGGGTTGG + Intergenic
925666837 2:6266039-6266061 TGCACCTTGCAGCTCTGAGATGG - Intergenic
929056643 2:37883456-37883478 TGAACCATATACAACTGGGAAGG + Intergenic
929799945 2:45091280-45091302 TGCATCACATACCTCTGGAAGGG - Intergenic
930051454 2:47219234-47219256 CTCACCATCTACTTCTGGGAGGG + Intergenic
932218062 2:69979501-69979523 TGTACTATGTCCCTCTGGGAGGG + Intergenic
934758167 2:96839069-96839091 TGCACCTTGTACATCCTGGATGG + Exonic
936596664 2:113854688-113854710 TTCAACATGTACATTTGGGAGGG + Intergenic
937497017 2:122431184-122431206 TGCCCCATGTACCTGAAGGAAGG + Intergenic
938289668 2:130142567-130142589 TTCTCCATGTCTCTCTGGGAAGG + Intronic
938391943 2:130913851-130913873 TTCCCCATGTACCCCTAGGAAGG - Intronic
944674684 2:202025474-202025496 TGCACCATGCTAGTCTGGGATGG - Intergenic
948152881 2:235758406-235758428 TGCACCATGTACCTCTGGGAAGG - Intronic
1170415326 20:16133414-16133436 AAAACCATGTACCTCTGGGGAGG - Intergenic
1171206919 20:23288561-23288583 TGCACCTGGCACCTCTGGGAGGG + Intergenic
1175370246 20:58483421-58483443 TCCACCATGGACCCCTGGAATGG - Intronic
1176518953 21:7810629-7810651 TTGACCCTGTGCCTCTGGGATGG + Intergenic
1178652981 21:34440642-34440664 TTGACCCTGTGCCTCTGGGATGG + Intergenic
1179487079 21:41717262-41717284 GGCACCTTGTTCCTCTGGGCTGG - Intergenic
1182839740 22:33379136-33379158 AGTTCCATGGACCTCTGGGAAGG - Intronic
952042852 3:29281065-29281087 AACACCATGTCACTCTGGGAGGG + Intronic
953302959 3:41797373-41797395 TGTACCAGATACCTCTGGGGTGG - Intronic
953472002 3:43175665-43175687 TACTCCATGTACCTCTGGGCAGG - Intergenic
954977924 3:54714335-54714357 AGCACGTTGTACCTCTGGGATGG + Intronic
956369473 3:68542804-68542826 TACACCATTTACATGTGGGAAGG + Intronic
960436184 3:117629421-117629443 TGCACCAAGTTCCTCAGGGAAGG - Intergenic
961045417 3:123704562-123704584 TGAATCATCTACCTCTTGGATGG + Intronic
961429952 3:126874448-126874470 TGTACCATGTAGCCTTGGGATGG + Intronic
962082643 3:132156678-132156700 TGCACAATGTGCCTGTGGGGTGG - Intronic
962146235 3:132842907-132842929 AGCACCATGTACCTCTGCCTTGG - Intergenic
969345799 4:6569118-6569140 TTCACCAGGTAGCTCAGGGATGG + Intergenic
972774304 4:42227378-42227400 TGCACCATCTAAACCTGGGAAGG - Intergenic
976129788 4:81871719-81871741 TGCACCAGCTAGATCTGGGATGG - Intronic
980228743 4:130020596-130020618 TGCACCTCTGACCTCTGGGAAGG - Intergenic
986178481 5:5372097-5372119 TGAACAATGAACCCCTGGGAGGG + Intergenic
986297849 5:6454501-6454523 TTCACCATGTACCTTGGTGAAGG + Intronic
986424914 5:7621738-7621760 TGAATCCTGTACTTCTGGGAAGG - Intronic
987181491 5:15372762-15372784 TGCACCAAGGAGCTCAGGGATGG + Intergenic
988466577 5:31497540-31497562 TGCACTTTGTACCTCTGTTATGG - Intronic
989467383 5:41772994-41773016 AGCACAATGTCACTCTGGGAGGG + Intronic
990771722 5:59254102-59254124 TCCATCATGTAGCTCTGGAAGGG - Intronic
992201100 5:74384597-74384619 TGCACCATTTATTTCTGGGATGG - Intergenic
994990542 5:106991064-106991086 TGCACCATGTTCCTTTTGCAAGG + Intergenic
996568786 5:124909997-124910019 TGTATTATGTATCTCTGGGAAGG + Intergenic
997653137 5:135536606-135536628 TGCGCCCTGTGCCTCTGGCATGG - Intergenic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
999789683 5:154927689-154927711 TGCACAAAATATCTCTGGGAAGG + Intronic
1001481588 5:172092636-172092658 TTCACCAAGTACATTTGGGAAGG + Intronic
1003166145 6:3680116-3680138 TCCACAATGAGCCTCTGGGATGG - Intergenic
1004342326 6:14818631-14818653 TGGGCAATGTGCCTCTGGGAGGG - Intergenic
1005876388 6:30013313-30013335 TACAGCATTTACCTCTGGGGCGG - Intergenic
1006949419 6:37809204-37809226 TGCACCATGTGTGGCTGGGATGG - Intergenic
1012770306 6:103424954-103424976 TGCACCTGGGTCCTCTGGGATGG - Intergenic
1014015777 6:116528375-116528397 TCCGCTTTGTACCTCTGGGAGGG - Intronic
1017942571 6:159066091-159066113 ATCACCATGTGCTTCTGGGAGGG - Intergenic
1017970070 6:159304379-159304401 TGCTCCCTGTGCCTCTGGGTTGG + Intergenic
1021077245 7:16319925-16319947 AGCACCAGGTACCTCTGGAACGG - Intronic
1028086170 7:86640187-86640209 TCCACCAAGTACTTCTGGGTAGG + Intergenic
1028107690 7:86899520-86899542 TGAACCATGTATCACTGGAAAGG - Intronic
1035555998 8:567715-567737 TCACCCATGTTCCTCTGGGAGGG - Intergenic
1040283795 8:46089299-46089321 TGCACCGTGGGCTTCTGGGAAGG - Intergenic
1044723493 8:95172849-95172871 TGGACCATGGGCCTCTGGAAGGG - Intergenic
1045024901 8:98077245-98077267 GCCACCATGCTCCTCTGGGAAGG - Intronic
1045313840 8:101026596-101026618 AGAACCATGTATCTGTGGGAGGG + Intergenic
1045986966 8:108260244-108260266 TACCCCATGTACCTTTTGGAAGG + Intronic
1046750071 8:117917772-117917794 CCCACCAGCTACCTCTGGGATGG - Intronic
1049093024 8:140530958-140530980 TGCAGCGTGTACCCATGGGAGGG - Intergenic
1049207356 8:141369746-141369768 TGCACCCTGTCCCTTGGGGAAGG - Intergenic
1050020610 9:1280398-1280420 AGCACCAAGTACCTCTGTAAGGG - Intergenic
1051215078 9:14788975-14788997 TTCACCTTCTACCTTTGGGATGG - Exonic
1051755831 9:20399116-20399138 TGTACTGTGTACCTCTGAGAGGG + Intronic
1052353203 9:27477980-27478002 TGCTCCAAGTAGCTCAGGGAAGG + Intronic
1053144054 9:35699968-35699990 TGGACCATGTACTGCTGGTAAGG - Exonic
1055402030 9:75934178-75934200 TGCAGCATGTACCCTTGGGCTGG - Intronic
1059306739 9:113359588-113359610 TGCAACAGGTGCCTTTGGGAAGG + Intronic
1059810894 9:117854265-117854287 TGCACCATGAAGTTCTGGGTAGG - Intergenic
1062058238 9:134480312-134480334 AGCACCATTTACCACTGAGAGGG + Intergenic
1188534986 X:31186699-31186721 TCCACAAAGTACCTCTGTGATGG - Intronic
1189433861 X:40973610-40973632 TGCAACAGGTACCTAGGGGATGG + Intergenic
1193412596 X:81182643-81182665 AGCAGCATCTACTTCTGGGAAGG - Intronic