ID: 948155306

View in Genome Browser
Species Human (GRCh38)
Location 2:235776719-235776741
Sequence GTGTGCAAGGGGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1474
Summary {0: 1, 1: 0, 2: 6, 3: 125, 4: 1342}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948155306_948155315 -10 Left 948155306 2:235776719-235776741 CCCTCCCCCTTCCCCTTGCACAC 0: 1
1: 0
2: 6
3: 125
4: 1342
Right 948155315 2:235776732-235776754 CCTTGCACACCTTGTACTCCAGG 0: 1
1: 0
2: 1
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948155306 Original CRISPR GTGTGCAAGGGGAAGGGGGA GGG (reversed) Intronic
900145593 1:1157561-1157583 GTGTGGAGCAGGAAGGGGGAAGG + Intergenic
900161724 1:1227222-1227244 GTGAGCAAGGGGATTGGGCAGGG - Intronic
900177593 1:1297693-1297715 GTGTGCACGGGCACGGGGCAGGG + Intronic
900197506 1:1384220-1384242 GTGAGCAAGAGGCAGGGAGATGG - Intergenic
900755999 1:4435171-4435193 GGGTGCAAGGGGCTCGGGGAAGG - Intergenic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
901715837 1:11153181-11153203 GAGTGGAAGGGGAAGGGGCCAGG + Intronic
902214443 1:14925230-14925252 GGGGGGAAGGGGCAGGGGGAAGG - Intronic
902429361 1:16351634-16351656 GTGTGCAAAGGGAACGGTGGAGG - Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
902769358 1:18636746-18636768 TTGGGCAAGGGGGCGGGGGACGG + Intronic
902822217 1:18950339-18950361 CTTTGCCAGGGGAAGGGGGCTGG + Intronic
902906007 1:19557861-19557883 AAGTGAAAGGGGAAGGGGAAGGG - Intergenic
903049090 1:20587665-20587687 GTTTGGATGGGGAATGGGGAAGG - Intergenic
903313287 1:22477885-22477907 GTGGGAAAGGGGAAGAAGGAAGG - Intronic
903320038 1:22537585-22537607 GTGTGTGATGGGAAGTGGGAGGG - Intergenic
903387615 1:22938221-22938243 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
903429303 1:23280340-23280362 GGGTGGAAGGGAGAGGGGGATGG + Intergenic
903836174 1:26204580-26204602 GTAGGGAAGGGGAAGGGGAAGGG - Intergenic
904390744 1:30184252-30184274 GTGGGAAAGAGGGAGGGGGAGGG - Intergenic
904432827 1:30476175-30476197 GTGGGCAAGAGCAAGGGTGATGG - Intergenic
904893065 1:33793751-33793773 GTGTGGACGGAGAAGAGGGAGGG + Intronic
905305332 1:37013925-37013947 GGGTGCAAGGGGCTGGGGCAAGG - Intronic
905688562 1:39926392-39926414 GTGAGCCAGGGGTAGAGGGAAGG - Intergenic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
905891006 1:41518359-41518381 GCGGACAAGGGGAAAGGGGACGG + Intronic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
905946606 1:41906513-41906535 TTTTGCAAGGGGATGGGGGTAGG + Intronic
906058073 1:42931261-42931283 GGGTGCAAGGGGAAAGGAAAAGG - Intronic
906118924 1:43374533-43374555 GGGGGCAAGGGGCAGGGGGATGG + Intergenic
906427777 1:45727433-45727455 AAGGGCAAGGGGAAGGGGAAGGG - Intronic
906500882 1:46341258-46341280 ATGGGCAAGGGAAAGGGGGAGGG - Intronic
906724905 1:48037108-48037130 GTGTGTATGTGGAAAGGGGAGGG - Intergenic
906904502 1:49875298-49875320 GTGTGGAGGGGGGAGGGGGGAGG - Intronic
907760475 1:57353746-57353768 GTGTGGAAGGGGGAGGAGCAGGG - Intronic
907883859 1:58576043-58576065 GTGCGCAAAAGGGAGGGGGAAGG + Exonic
908389928 1:63675240-63675262 GTGTGGGAGGGGGAGAGGGAAGG - Intergenic
908475487 1:64483861-64483883 ATATGCAAGGGGGGGGGGGAAGG - Intronic
908920809 1:69189240-69189262 GTGGTGAAGGGGAGGGGGGAAGG - Intergenic
909663608 1:78110036-78110058 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910130061 1:83893839-83893861 GTGTCCTAGGGGAAGGGGCAGGG + Intronic
910576994 1:88776210-88776232 GAGGGCAAGGGGGAGGGGGTAGG - Intronic
910607662 1:89104767-89104789 TTGTGAACGGGGCAGGGGGAGGG + Intergenic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
910856155 1:91697948-91697970 AGGGGAAAGGGGAAGGGGGAAGG + Intronic
910896120 1:92071249-92071271 GTGTGTATGGGGTAGGGGGCAGG - Intergenic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
911282702 1:95951437-95951459 GCATGCAAGGGGAAGGAAGAAGG - Intergenic
911569610 1:99507582-99507604 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
911813539 1:102313308-102313330 GTGGGGTAGGGGGAGGGGGAGGG + Intergenic
911848222 1:102781382-102781404 GTGGGGTAGGGGGAGGGGGAGGG + Intergenic
911951008 1:104173169-104173191 GTGTGAAAGGGGACGGGAGCAGG - Intergenic
912065193 1:105730017-105730039 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
912465033 1:109866535-109866557 GTGTGTATGGGGATGGGGGTGGG + Intergenic
912799559 1:112712515-112712537 GGGTGGAGGGGGTAGGGGGAGGG - Intronic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
913323714 1:117607781-117607803 GTGGAAAAGGGGGAGGGGGATGG + Intronic
914326135 1:146618674-146618696 TTGTGGAAGGGGAAAGGGCATGG + Intergenic
914747872 1:150512694-150512716 GTGTGAAAGGGGCAGGGGTTAGG - Intronic
914968827 1:152288218-152288240 GTGGGGTAGGGGGAGGGGGAGGG - Intergenic
915323812 1:155070414-155070436 GTGTGCAAAGGGGTGGGGGAGGG - Intergenic
915839121 1:159201303-159201325 GTGAGGAAGGGTAAGGGGCAGGG + Exonic
915878797 1:159643419-159643441 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
915932851 1:160070523-160070545 GGGTGACAGGGGAAGGGAGAAGG + Intergenic
916243825 1:162666571-162666593 GTGTGTGGGGGAAAGGGGGAGGG + Intronic
916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG + Intergenic
916611360 1:166395148-166395170 GGGGGAAAGGGGAAGGAGGAGGG + Intergenic
916670247 1:167011033-167011055 AAGTGAAAGAGGAAGGGGGAAGG - Intronic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
916863971 1:168836742-168836764 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
916863975 1:168836748-168836770 GAGAGGGAGGGGAAGGGGGAGGG - Intergenic
917270365 1:173266102-173266124 GTGTGCAAGAGTAAGAAGGATGG + Intergenic
917485480 1:175451362-175451384 GTGGGGTGGGGGAAGGGGGAAGG - Intronic
919163663 1:193864333-193864355 GTGTGCAGTGGGGAGGGGCAAGG - Intergenic
919301939 1:195781404-195781426 GAATGGAAAGGGAAGGGGGAGGG + Intergenic
919343874 1:196349849-196349871 GTGGGCTGGGGGAAGGGGGGAGG - Intronic
919709297 1:200710369-200710391 GCCTGTGAGGGGAAGGGGGAGGG + Intergenic
919979845 1:202636006-202636028 GGCTGCAAGTGGTAGGGGGAAGG + Intronic
919983832 1:202659181-202659203 CTGTGCATTGGGAAAGGGGAGGG - Intronic
920016178 1:202911285-202911307 GTGGGCAATGGGAAGCAGGAAGG - Intronic
920273648 1:204787289-204787311 TGGTGGAAGGGGAAGGGGAAGGG - Intergenic
920441111 1:205980865-205980887 GAGGTGAAGGGGAAGGGGGAGGG - Intronic
920841932 1:209562386-209562408 GGGAGCAAGGGGAAAAGGGAGGG + Intergenic
921241599 1:213189774-213189796 GTTCGGAAGGGGAAGTGGGAAGG - Intronic
921377454 1:214489347-214489369 GTGGGCAAGGGGAGAGGGCATGG - Intronic
921501457 1:215909271-215909293 GTTTGCCAGGGGTTGGGGGAGGG + Intronic
922069070 1:222173549-222173571 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
922156093 1:223040649-223040671 ATGGGCAAGGGGCAGGGGGAGGG + Intergenic
922383298 1:225055677-225055699 GTGTGGTGGGGGAGGGGGGAGGG - Intronic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
922698144 1:227742172-227742194 GTGGGCTAGGGGCAGGGGGGAGG - Intronic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
923438496 1:233992887-233992909 GTCTGAAAGGGAAAGTGGGAGGG + Intronic
923482467 1:234397493-234397515 GGGGGGAAGGGGGAGGGGGAAGG + Intronic
924561700 1:245161963-245161985 GAATGCAAGGGGCGGGGGGAAGG + Intronic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063219590 10:3954371-3954393 GTGGGTAGGGGGCAGGGGGAGGG + Intergenic
1063300255 10:4844430-4844452 GTGTGGAAGGGGACGGGAGTGGG + Intronic
1063306985 10:4911359-4911381 ATGTGCAAGGGGGAGGGGCCTGG + Intergenic
1063307462 10:4918358-4918380 ATGTGCAAGGGGGAGGGGCCTGG - Intergenic
1063511211 10:6646919-6646941 GAGGGAAAGGGAAAGGGGGAGGG - Intergenic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1064175872 10:13074566-13074588 GTGGGAGAGGGGGAGGGGGAGGG - Intronic
1064267342 10:13835833-13835855 TGGTGAAAGGGGGAGGGGGATGG - Intronic
1064595737 10:16942890-16942912 GAAGGCAAGGGGAAGGGGAAGGG + Intronic
1065856959 10:29838848-29838870 GGGTGAAGGGGGAAGGGGGGAGG + Intergenic
1065920750 10:30390672-30390694 GCGAGGAAGGGTAAGGGGGAGGG - Intergenic
1066334580 10:34463041-34463063 GGGAGGAAAGGGAAGGGGGAGGG + Intronic
1066440215 10:35431364-35431386 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1066522304 10:36235329-36235351 GCTTGCCAGGGGCAGGGGGAGGG + Intergenic
1066594173 10:37030601-37030623 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1066594833 10:37038893-37038915 GTGGGGTAGGGGAAAGGGGAAGG - Intergenic
1067039263 10:42940303-42940325 GAGTCCAAGGAGAAGGGAGATGG - Intergenic
1067300967 10:45009315-45009337 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1067473825 10:46553705-46553727 TTGTGGAGGGGGAATGGGGAAGG - Intronic
1067830674 10:49609738-49609760 GTGTGCAAGGGGCCAGGGGGCGG + Intronic
1067832305 10:49617177-49617199 GGGGGAAAGGGGAAGGGGGAAGG - Intronic
1067869215 10:49941909-49941931 GGGTGCCAGTGGAAGAGGGAAGG - Exonic
1068226053 10:54108267-54108289 TTCTGCCAGGGGATGGGGGAGGG - Intronic
1068268990 10:54695058-54695080 GTGGGGTAGGGGGAGGGGGAGGG + Intronic
1068269169 10:54697652-54697674 GGAAGGAAGGGGAAGGGGGAAGG + Intronic
1068430992 10:56931960-56931982 TTGTACAAGGGGAAGGATGAGGG + Intergenic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1069136554 10:64773436-64773458 GTGGGCAAGAGGATGGGGAATGG + Intergenic
1069184075 10:65400471-65400493 GAGTGGTGGGGGAAGGGGGAAGG - Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1069320273 10:67161010-67161032 GGGTGCTAGGGGATTGGGGAGGG + Intronic
1069636835 10:69930190-69930212 GTGGGCAAGGGAAGGGGAGATGG + Intronic
1069796200 10:71053429-71053451 GTGGGCTGGGGGCAGGGGGAAGG - Intergenic
1069817585 10:71208413-71208435 GGGTGCCAGGGGCTGGGGGAGGG + Intergenic
1069833658 10:71295786-71295808 GTGGGCCAGGGGCATGGGGAAGG - Intronic
1069834273 10:71299021-71299043 GGGCACAAGGGGAAGTGGGAAGG - Intronic
1069991993 10:72321748-72321770 CTGTGATAGGGAAAGGGGGAGGG - Intergenic
1070030671 10:72674173-72674195 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1070689870 10:78516559-78516581 GTGTGCCAGGGGAGGGGCTATGG - Intergenic
1071204195 10:83255014-83255036 GTGGGGGAGGGGAGGGGGGAGGG - Intergenic
1071807683 10:89142542-89142564 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1071864168 10:89707642-89707664 GTGTGAAGGGGGAAAGGGGATGG - Intronic
1071899892 10:90108751-90108773 GGGTGGGACGGGAAGGGGGAAGG + Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072397370 10:95058785-95058807 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
1072497162 10:95973131-95973153 GTGAGCAAGGAGGAGGGGGCGGG + Intronic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073147789 10:101291996-101292018 GTGAGGACGGGGAGGGGGGAAGG - Intergenic
1073269182 10:102247288-102247310 GTGTGTTGGGAGAAGGGGGATGG + Intronic
1073431773 10:103491827-103491849 GTGGGCAGGGGAATGGGGGAGGG - Intergenic
1073477251 10:103762497-103762519 GGGGGCAAGGGGTAGAGGGAAGG - Intronic
1073513879 10:104060315-104060337 ATGTGCCAGGAGAAGGGAGAGGG + Intronic
1073577981 10:104641202-104641224 GTGTGTAGGGGGAGTGGGGAGGG - Exonic
1073588857 10:104736922-104736944 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1073592105 10:104767552-104767574 GAGAGGAAGGGAAAGGGGGAAGG - Intronic
1073592128 10:104767624-104767646 AAGTGGGAGGGGAAGGGGGAAGG - Intronic
1073592141 10:104767654-104767676 GTGGAGAAGGGGAAGGGGAACGG - Intronic
1073677003 10:105659301-105659323 GTGTGCATGGGTTTGGGGGATGG + Intergenic
1074163755 10:110857020-110857042 GGGGGGAGGGGGAAGGGGGAAGG + Intergenic
1074307725 10:112294416-112294438 GTGTGCAAGAGGAAGTGTGCAGG + Intronic
1074326389 10:112455339-112455361 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1074546068 10:114403550-114403572 GTCTGCAGGAGGATGGGGGAGGG + Intronic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074676799 10:115860346-115860368 GTGAGCAAAGGGAAGGCAGATGG - Intronic
1074696287 10:116052541-116052563 GTGGGGTAGGGGGAGGGGGAGGG - Intergenic
1074769799 10:116725825-116725847 GTGTGGCAGGGGTTGGGGGAGGG - Intronic
1074881708 10:117664832-117664854 GTGTGCCAGGGGAGGAGGGATGG - Intergenic
1075122677 10:119675820-119675842 GAGGGAAGGGGGAAGGGGGAAGG - Intronic
1075263364 10:120981097-120981119 GAGTGGAAAGGGATGGGGGAGGG - Intergenic
1075379990 10:122011234-122011256 GTGTGGCTGGGGAAGTGGGAAGG + Intronic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1076064618 10:127439592-127439614 GTCAGCAAGGGGCAAGGGGAAGG - Intronic
1076088893 10:127661653-127661675 GTGGGGTTGGGGAAGGGGGAGGG - Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076366616 10:129925261-129925283 GGGTGCAAGGAGAATGGGGTGGG + Intronic
1076666840 10:132097984-132098006 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1076704285 10:132292902-132292924 GTCTGCATGGGGAAGGGAGGGGG - Intronic
1076791358 10:132778651-132778673 GTGTGCAATCGGAAGGAGGCTGG + Intronic
1077249472 11:1554622-1554644 AGGGACAAGGGGAAGGGGGAAGG + Exonic
1077287285 11:1773157-1773179 GTGGGGGAGGGGGAGGGGGAGGG + Intergenic
1077386960 11:2274264-2274286 GGGTGCCAGGGGCTGGGGGAAGG - Intergenic
1077648113 11:3944464-3944486 GAGTGGAGGGGGAAGTGGGATGG + Intronic
1077721391 11:4632954-4632976 GTGGGCGAGGGGCAAGGGGAGGG + Intergenic
1077761544 11:5104910-5104932 GTGAGGAAGGAGAAGAGGGAGGG - Intergenic
1077779262 11:5307648-5307670 GGGGGAAGGGGGAAGGGGGAGGG - Intronic
1077779267 11:5307655-5307677 GAGGGAAGGGGGAAGGGGGAAGG - Intronic
1077806579 11:5596526-5596548 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1077806583 11:5596533-5596555 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1078016167 11:7617001-7617023 GTGTGCATGGGGCAGGGAGCAGG - Intronic
1078473569 11:11611379-11611401 GTGGGCAAGGAAAATGGGGAAGG + Intronic
1078573075 11:12475985-12476007 GTGGGCAAGGGTAGGGGGAAAGG + Intronic
1078992505 11:16664326-16664348 CTGTGCCAGGGGATGGGGTAGGG - Intronic
1079078522 11:17398000-17398022 GTGTGCAGGGGCTAGGGGGTAGG - Intronic
1079125168 11:17713952-17713974 GTGTGCAGGGGGTGGGGGCAGGG - Intergenic
1079174491 11:18126633-18126655 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1079360311 11:19765445-19765467 GAGGGGAAGGGGAAGGGGAAGGG - Intronic
1080424126 11:32140467-32140489 GTGGGCAAGGGGAAGGGCAGAGG - Intergenic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1081126248 11:39326646-39326668 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
1081268956 11:41060981-41061003 GTGTGGAGGGGGGAGGGGAAGGG - Intronic
1081392194 11:42542282-42542304 GGGCACAAAGGGAAGGGGGAGGG - Intergenic
1081441690 11:43087780-43087802 GAGTTAAAGGGGAAGGGGGTGGG + Intergenic
1081585403 11:44380526-44380548 CTGTGCAAGGTAAAGGGAGAGGG + Intergenic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1081737011 11:45411324-45411346 GGGAGAATGGGGAAGGGGGAAGG - Intergenic
1081846862 11:46247029-46247051 GTGGGCAAGGGGGTGGGGGTGGG - Intergenic
1082132379 11:48506250-48506272 GTGTGGAAGGGAAGGGGGAAGGG - Intergenic
1082207985 11:49462252-49462274 GGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1082244424 11:49905176-49905198 GTGTGGAAGGGAAGGGGGAAGGG + Intergenic
1082244431 11:49905189-49905211 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1082244476 11:49905292-49905314 GAATGGAGGGGGAAGGGGGAAGG + Intergenic
1082244481 11:49905299-49905321 GGGGGAAGGGGGAAGGGGGAGGG + Intergenic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1082565842 11:54676870-54676892 GTGTGGAAGGGAAGGGGGAAGGG - Intergenic
1082667507 11:55991852-55991874 GTGGGCTAGGGGGAGGGGGGAGG + Intergenic
1082738813 11:56887614-56887636 GGGAGCCAGGGGAAGGGGGTGGG + Intergenic
1082849582 11:57753312-57753334 GGCTGCAAGAGGCAGGGGGATGG + Intronic
1082915682 11:58433904-58433926 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1083024389 11:59537646-59537668 GAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1083196844 11:61093317-61093339 GAGGGCAAGGGGCAGGGGGCAGG + Intergenic
1083276134 11:61598093-61598115 GTCTGCAGGGGGAAGTGGGGTGG - Intergenic
1083369710 11:62168561-62168583 GATTGCCAGGGGACGGGGGAGGG - Intergenic
1083674743 11:64319057-64319079 GTTTGGGAGGAGAAGGGGGAAGG - Intronic
1083692484 11:64418806-64418828 GGGTGCCAGGGGCTGGGGGAGGG + Intergenic
1083742839 11:64720289-64720311 GTGTGGAAGGGGCAGGGGCGAGG + Intronic
1083802985 11:65057537-65057559 GTGTGGGTGGGGAAGGGGGGTGG + Intronic
1083929603 11:65833565-65833587 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1083964482 11:66035029-66035051 TGGCACAAGGGGAAGGGGGAAGG + Intergenic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084456150 11:69269207-69269229 GCGTGCAAAGGGATGTGGGAAGG + Intergenic
1084589782 11:70084032-70084054 GTCTGCAAAGGCAAGGAGGAGGG + Intronic
1084676079 11:70635542-70635564 GGGTGCCAGGGGCCGGGGGAGGG + Intronic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1084942957 11:72623648-72623670 ATGGGCAAAGGCAAGGGGGAGGG - Intronic
1085112240 11:73898200-73898222 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1085167148 11:74413041-74413063 CTAGGCAAGAGGAAGGGGGAAGG + Intergenic
1085204000 11:74719365-74719387 GTGTGTACAGGGGAGGGGGATGG - Intronic
1085331302 11:75653822-75653844 GTGTGCAATGAGAAGGGCAAAGG + Intronic
1085449226 11:76622054-76622076 CTGGGCAGGGGGCAGGGGGAGGG + Intergenic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1085483401 11:76841579-76841601 GTGAGAAAGGGGATGGGGAAAGG - Intergenic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1086074858 11:82839738-82839760 GTGAGAAAGGGCAAAGGGGAAGG - Intronic
1086198892 11:84176152-84176174 GTCTGCTAGGGGGAGGGGGATGG - Intronic
1086964491 11:93013738-93013760 GGGTGGAAGGGCAAGGGGGACGG - Intergenic
1087429785 11:98038365-98038387 GTGCACAAGGGGAAGGGGGAAGG + Intergenic
1087487174 11:98770785-98770807 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1087734543 11:101817164-101817186 GTGTGCCCAGGAAAGGGGGAAGG + Intronic
1087774318 11:102243557-102243579 GGGAGAAGGGGGAAGGGGGAAGG + Intergenic
1088051238 11:105517851-105517873 GTTTGCCAGGTGAAGGGGGAAGG + Intergenic
1088339288 11:108745038-108745060 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1088339292 11:108745045-108745067 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1088339296 11:108745052-108745074 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1088339330 11:108745128-108745150 GAGTGGAAGGAGAAGGGAGAAGG - Intronic
1088545575 11:110955509-110955531 ATGTGCAATGAGGAGGGGGATGG + Intergenic
1088710634 11:112505442-112505464 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1088718915 11:112574791-112574813 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1088998089 11:115021166-115021188 GGGGGCAAGAGGAAGGGGAAGGG - Intergenic
1089139242 11:116273089-116273111 GGGAGCAAAGGGAAGGAGGAAGG + Intergenic
1089300055 11:117493079-117493101 GTGTGCAAGGGGTAGGGGTGAGG + Intronic
1089346900 11:117796715-117796737 GAGGGCAAGGGGCTGGGGGAGGG + Intronic
1089581875 11:119486532-119486554 GTGTGTTAGGGGAGGGGGGTAGG + Intergenic
1089604848 11:119635850-119635872 GTGTGCAGAGGGACGGGTGAAGG + Intronic
1089625687 11:119749288-119749310 GTGGGCAAACTGAAGGGGGAGGG + Intergenic
1090089339 11:123680866-123680888 GTTTGCCAGGGGCTGGGGGATGG - Intergenic
1090235253 11:125142218-125142240 GAGAGCAAGGGAAAGGGAGAAGG - Intergenic
1090400951 11:126447826-126447848 GGCTTCAAGGGCAAGGGGGAGGG + Intronic
1090464748 11:126924180-126924202 CTGAGCCAGGGAAAGGGGGAAGG - Intronic
1090601872 11:128380645-128380667 GAGGGGAAGGGGAAGAGGGAAGG - Intergenic
1090645681 11:128765037-128765059 GTGTGCACAGGGCCGGGGGAGGG + Intronic
1090663954 11:128902503-128902525 GTCTGCATGGGGGAGGGGGCTGG + Exonic
1090703229 11:129314795-129314817 GAGGGAGAGGGGAAGGGGGAAGG - Intergenic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1091208855 11:133839530-133839552 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1091630074 12:2153479-2153501 GGGTGCCAGGGGCTGGGGGAAGG - Intronic
1091718191 12:2794741-2794763 GGGTCCCAGGAGAAGGGGGAGGG + Intergenic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1091873152 12:3911984-3912006 GTGTCAAAGGGGAAGAGAGACGG - Intergenic
1091931503 12:4399326-4399348 GAGAGCATGGGGCAGGGGGAGGG + Intergenic
1092045799 12:5431344-5431366 GTGTGGAAGGGAGAGGGAGATGG - Intergenic
1092217782 12:6694909-6694931 GTGTGCAAGGGGCAGGAGCCAGG + Exonic
1092310671 12:7348220-7348242 CTGTGCAAGGGGAAAGAGCATGG + Intronic
1092423334 12:8352603-8352625 GGGTTCAGGGGGAAGGGGGAGGG - Intergenic
1092468785 12:8760086-8760108 GTGGGGTAGGGGAAGGGGGAGGG - Intronic
1092612787 12:10189291-10189313 GTCTGAAAGGGGAAAGGGCAGGG + Intronic
1092817240 12:12322940-12322962 GAGGGGAAGGGGAAGGGAGAAGG + Intergenic
1093112669 12:15170338-15170360 GTGTGTAGGGGGAAGGGAGTGGG + Intronic
1093184271 12:16002126-16002148 GTGGGGAAGGGGGAGGGGGGAGG - Intronic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1093480272 12:19597422-19597444 GGGTGCTAAGGGAAAGGGGAGGG - Intronic
1093662613 12:21774735-21774757 GAGGGCTAGAGGAAGGGGGATGG + Exonic
1093925109 12:24902314-24902336 GCCTGCAAAGGGAACGGGGACGG + Intronic
1093925221 12:24902826-24902848 GAGGGCAAGGCGAAGGAGGATGG + Intronic
1094382131 12:29854456-29854478 GTGGGGTAGGGGAAGGGGGGAGG + Intergenic
1094477377 12:30851713-30851735 GTGTACAAGGCAAAGGGGCAGGG - Intergenic
1094817867 12:34204834-34204856 GAGAGCAAGGGAAAGAGGGATGG - Intergenic
1095099020 12:38162437-38162459 GAGAGCAAGGGAAAGAGGGATGG + Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095447510 12:42296823-42296845 GGGTGCCAGGGAAAGGGGGAAGG - Intronic
1095457275 12:42401501-42401523 GTGGCCATGGGGAGGGGGGAGGG + Intronic
1096257785 12:50073534-50073556 ATTTGCAGGAGGAAGGGGGAAGG - Intronic
1096884007 12:54698894-54698916 GTGGGGAAGGGGGAGGGGGAGGG - Intergenic
1097046854 12:56193380-56193402 GAGTGGAAGAGGAAGGGTGAAGG - Intergenic
1097092521 12:56518524-56518546 GTGTCCAAGGTGAAGGAGTAGGG - Intergenic
1097114563 12:56687999-56688021 TTGTGAACGGGGCAGGGGGACGG + Exonic
1097140034 12:56893896-56893918 GTGGGGTAGGGGGAGGGGGAGGG + Intergenic
1097293453 12:57939894-57939916 GAGTGGGAGGGGAAGGGTGAGGG + Intergenic
1097416524 12:59322954-59322976 GTCTGCAGGGGGATGGGGGAGGG - Intergenic
1097540699 12:60938522-60938544 TGGTGAAAGGGAAAGGGGGAAGG - Intergenic
1097778820 12:63680117-63680139 GTGTGCTGGGGGTGGGGGGAAGG - Intergenic
1097829973 12:64214045-64214067 GTGTGCAATGGGATGGTGAAGGG - Intronic
1097924238 12:65110250-65110272 GGGGGCCAGGGGAAGGGGGCAGG - Intronic
1098219622 12:68255017-68255039 GTGGGCAAGGGGCAGCGAGATGG + Intergenic
1099144212 12:79018343-79018365 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
1099196854 12:79626731-79626753 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1099239563 12:80123175-80123197 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1099380521 12:81946796-81946818 GTGGGGTAGGGGTAGGGGGAAGG - Intergenic
1099608874 12:84839575-84839597 GTGGGGTAGGGGAAGGGTGAGGG + Intergenic
1099662464 12:85581875-85581897 ATGTGTAAGTGAAAGGGGGAAGG - Intergenic
1099668623 12:85661635-85661657 GTGGGCAGGGGGAATGGCGAGGG - Intergenic
1099842495 12:87983532-87983554 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1099954947 12:89344683-89344705 GTGGGTCAGGGGAAAGGGGAAGG - Intergenic
1100256334 12:92886626-92886648 GAGGGGAGGGGGAAGGGGGAAGG + Intronic
1100556158 12:95695987-95696009 GAGGGAAAGGGGAAGGGGAAGGG - Intronic
1100710342 12:97249421-97249443 TTGTGCAAGAGAAAGGGGGTGGG - Intergenic
1101111741 12:101493002-101493024 GATTGCTAGGGGCAGGGGGAAGG - Intergenic
1101647515 12:106645034-106645056 TTGTTCTAGGGGGAGGGGGAGGG - Intronic
1101735871 12:107462453-107462475 GTTTGCAATGGGAATGGTGATGG + Intronic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1102175195 12:110868743-110868765 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1102175199 12:110868749-110868771 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1102204987 12:111084050-111084072 GTGTACATGGGGAAGTGTGAGGG + Intronic
1102229098 12:111250132-111250154 GAGTGGAAGGGAAAGGGGGTGGG - Intronic
1102454654 12:113064023-113064045 GGGAGAAGGGGGAAGGGGGAAGG - Intronic
1102813194 12:115841712-115841734 GTGTGCAGTGGGAAGAGAGAAGG - Intergenic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103404392 12:120665060-120665082 GGGTGCAAGGGGTTGGGGGGAGG + Intronic
1103567782 12:121825489-121825511 GGGTGCAAGTGGAAGGGGAGAGG + Intronic
1103897479 12:124282924-124282946 GAGTGACTGGGGAAGGGGGAGGG + Intronic
1104451663 12:128874007-128874029 GGGAGGAAGGGGAAGGGGAAGGG - Intronic
1104521517 12:129480193-129480215 GTGTGCAAGGGAGAGGAAGAAGG + Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104886143 12:132109757-132109779 GGGTGCCAGGGGCTGGGGGAGGG - Intronic
1105508065 13:21028071-21028093 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1105595870 13:21837401-21837423 GAGAGAAAGGGGCAGGGGGAAGG - Intergenic
1105596298 13:21842546-21842568 GTGGTTAGGGGGAAGGGGGATGG + Intergenic
1105980756 13:25513976-25513998 GTGGGAGAGGGGGAGGGGGAGGG + Intronic
1106625143 13:31412941-31412963 GGATGAAAGGGGAAGGGGCATGG + Intergenic
1106675803 13:31956738-31956760 GTTGGGAAGGGCAAGGGGGAGGG - Intergenic
1107574658 13:41705286-41705308 GTGTGCAGGGGGTCGGGGGAGGG + Intronic
1107908394 13:45082903-45082925 GGGAGCAAGTGTAAGGGGGAGGG - Intergenic
1108203491 13:48064706-48064728 GTTTCCAAAGGGATGGGGGAGGG - Intronic
1108315713 13:49235140-49235162 GGATGGAGGGGGAAGGGGGAGGG + Intergenic
1108425110 13:50291572-50291594 GAGAGCAAGAGGTAGGGGGAAGG + Intronic
1108631050 13:52282506-52282528 GTGGGGTAGGGGAAGGGGGGAGG + Intergenic
1108744677 13:53379998-53380020 GATTGCCAGGGGATGGGGGAAGG - Intergenic
1109058908 13:57587167-57587189 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1109181585 13:59220086-59220108 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1109272394 13:60268838-60268860 GTGAGAAAGGGGAAGGGGCCGGG + Intergenic
1109309111 13:60671767-60671789 CTTTGCATGGGGATGGGGGATGG + Intergenic
1109365802 13:61354992-61355014 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1110236990 13:73227433-73227455 GTGTGCATTGGGAAGGGTGAAGG - Intergenic
1110479886 13:75961647-75961669 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1110874225 13:80490132-80490154 GTGTGGAAGGGGACGGGAGCTGG + Intergenic
1111359245 13:87153001-87153023 GTGGGGAATGGGAAGGGGGGAGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111635654 13:90900382-90900404 GAGAGCAAGAGGAAGGGGAAAGG - Intergenic
1111640069 13:90957385-90957407 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112441854 13:99430138-99430160 GGGTGCCAGGGGCTGGGGGAGGG - Intergenic
1112488002 13:99836889-99836911 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
1112963029 13:105151441-105151463 GTGGGCTGGGGGGAGGGGGAGGG + Intergenic
1113179797 13:107612104-107612126 GGGAGGAAGGGGAGGGGGGAGGG + Intronic
1113456966 13:110456194-110456216 GTTTACAAGGGGAAGGTGGTGGG + Intronic
1113861217 13:113488845-113488867 GTGTACATGGGGTGGGGGGAAGG + Intronic
1113975566 13:114225419-114225441 GGGAGGAAGGGGAGGGGGGAGGG + Intergenic
1114288494 14:21268890-21268912 GTGGGGGAGGGGAAGGGGGAAGG - Intronic
1114299723 14:21364358-21364380 GTGGGGGAAGGGAAGGGGGATGG + Intronic
1114320522 14:21543612-21543634 GTGTTTTAGGGGAAGAGGGAGGG + Intergenic
1114466485 14:22926653-22926675 GGGTGCAAGGGATAGGGTGAGGG - Intronic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1114952910 14:27779426-27779448 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1115011686 14:28555765-28555787 GTGGGCATGGGGGAGGTGGAAGG + Intergenic
1115157053 14:30352955-30352977 GTGGGGTAGGGGGAGGGGGAGGG + Intergenic
1115269154 14:31532436-31532458 GGGGGAAAGGGGAAGTGGGAAGG - Intronic
1115318865 14:32056701-32056723 GAGTGCAAGGAAAAGGGGTAAGG - Intergenic
1115412748 14:33093968-33093990 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
1115414140 14:33111803-33111825 GCGGGCAAGGGGGAGGGGGGAGG - Intronic
1115591862 14:34873698-34873720 CTGGGCAAGGGGAAGAGGAAGGG - Intronic
1115879499 14:37899265-37899287 GTTTGCAAGAGGAAGGGGGCTGG + Intronic
1115965585 14:38884107-38884129 GTGTGCATGGAGGAGGGGAATGG + Intergenic
1116062530 14:39941937-39941959 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1116078531 14:40143837-40143859 TGGGGCAGGGGGAAGGGGGAGGG + Intergenic
1116160279 14:41259001-41259023 GTGAGCAAGGGAGATGGGGAAGG + Intergenic
1116242263 14:42359825-42359847 GTGGGGTAGGGGAAGGGGGGAGG + Intergenic
1116474124 14:45320384-45320406 GTGGGCTGGGGGGAGGGGGAAGG - Intergenic
1116501940 14:45634477-45634499 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1116707973 14:48327719-48327741 GGGGGTAAGGGGAGGGGGGAGGG - Intergenic
1117079072 14:52132817-52132839 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1117099676 14:52333575-52333597 GAGGGCAAAGGGAATGGGGAGGG - Intergenic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1117445586 14:55800899-55800921 GTGTGCAAGGGGCTAGGGTAGGG - Intergenic
1117477732 14:56114235-56114257 GGGTGCCAGGGGCAAGGGGAAGG + Intergenic
1117599068 14:57354920-57354942 GGTTGCAAGGGGCTGGGGGAAGG + Intergenic
1117648931 14:57882176-57882198 TTCTCCAGGGGGAAGGGGGATGG - Intronic
1117667851 14:58076094-58076116 GAGGGGAAGGGGGAGGGGGAAGG + Intronic
1117974516 14:61283899-61283921 GTGTGGAAAGGGAAGGAGAAAGG + Intronic
1118012023 14:61619182-61619204 GGTTGCCAGGGGATGGGGGAAGG + Intronic
1118033371 14:61839878-61839900 TTGTGGAGGGGAAAGGGGGAGGG + Intergenic
1118181045 14:63493500-63493522 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1118244835 14:64099891-64099913 GTGGGTTAGGGGGAGGGGGAAGG - Intronic
1118295673 14:64566702-64566724 GTGTGCAGAGGGAATGGGGAGGG - Intronic
1118430062 14:65708848-65708870 GTGTGGGAGGGGATGGGGAAAGG + Intronic
1118693835 14:68364527-68364549 GAGTGGAAGGGGCTGGGGGAGGG - Intronic
1119143939 14:72293479-72293501 GTGGGAAAGCGGAAAGGGGAGGG - Intronic
1119655202 14:76412537-76412559 GTTTGCAAGGAGGAGGAGGATGG - Intronic
1119682963 14:76606668-76606690 GGTTGCTAGGGGAAGGGAGATGG - Intergenic
1119862833 14:77948884-77948906 GAGGGGTAGGGGAAGGGGGAGGG - Intergenic
1119932008 14:78556901-78556923 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1120256245 14:82123033-82123055 GTGATCAAGGGGAAGAGGGTGGG + Intergenic
1120651309 14:87136534-87136556 GTGTGAAAGGGGAGAGGGTAAGG - Intergenic
1120794905 14:88622027-88622049 GCGGACAAGGGGGAGGGGGAGGG - Exonic
1120949323 14:90026601-90026623 GTGGGGCAGGGGGAGGGGGAGGG - Intronic
1121217168 14:92257388-92257410 GGGTGCAAGGGGACTGGAGAGGG - Intergenic
1121288464 14:92755162-92755184 CTGTGCAACTGGAAGGGGAAAGG - Intergenic
1121468173 14:94129301-94129323 GAGTGCCAGGGGAAGGCAGAGGG + Intronic
1121662712 14:95647361-95647383 GTGTTCAAAGGGAAGTGGAAGGG + Intergenic
1121798383 14:96754120-96754142 GTGTGGAAGGGGGAGAGGGAAGG + Intergenic
1121813610 14:96912689-96912711 GAGTGAACAGGGAAGGGGGATGG + Intronic
1121928710 14:97952522-97952544 GAGGGAAAGGGGAAAGGGGAGGG - Intronic
1121936660 14:98025887-98025909 ATGAGCAAGGGGTAGAGGGATGG - Intergenic
1122267112 14:100551862-100551884 GTGGGGAAGGGGAAGTGGGTCGG + Intronic
1122329759 14:100904355-100904377 GTGTGGACGGGGAGAGGGGAGGG + Intergenic
1122384195 14:101332896-101332918 GGGGACAAGGGGAAGAGGGAGGG + Intergenic
1122396678 14:101437721-101437743 GTGTGTAAGGGGACAGGGCAGGG - Intergenic
1122778344 14:104133052-104133074 GCAGGCGAGGGGAAGGGGGATGG - Intergenic
1123112482 14:105879867-105879889 GTGTGTAAGTGGTTGGGGGAGGG + Intergenic
1123116996 14:105899342-105899364 GTGTGTAAGTGGACGGGGGAGGG + Intergenic
1123119060 14:105908650-105908672 GTGTGTAAGTGGACGGGGGAGGG + Intergenic
1123449098 15:20349326-20349348 GAGTCCCAGGGGGAGGGGGAGGG - Intergenic
1123632139 15:22268840-22268862 GGGAGAAAGGGGAAGTGGGAGGG - Intergenic
1124495463 15:30184043-30184065 GGCTGCAAGTGGTAGGGGGAAGG + Intergenic
1124748110 15:32354603-32354625 GGCTGCAAGTGGTAGGGGGAAGG - Intergenic
1124811535 15:32944100-32944122 GAGTGCCTGGGGAAGGGGAAGGG + Intronic
1125376508 15:39035987-39036009 GGGTGGAAGGGGGAGGGGGGAGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1126227649 15:46289852-46289874 GGTTGCAATGGGAAGAGGGAGGG + Intergenic
1126293974 15:47116632-47116654 GTGTGAGAGGGGAGGTGGGATGG - Intergenic
1126484860 15:49169090-49169112 GTATACAGGAGGAAGGGGGAAGG - Intronic
1126951554 15:53887175-53887197 GTGTGGAAGGAGAAGGGTTATGG + Intergenic
1127136900 15:55933535-55933557 GGGGGGAGGGGGAAGGGGGAGGG + Intronic
1127191750 15:56538501-56538523 GTTTCCAGGGTGAAGGGGGAGGG - Intergenic
1127271971 15:57409622-57409644 GTGTGAAAGGGGGAGGGAGAAGG + Intronic
1127280002 15:57480878-57480900 GGTTTCAAGAGGAAGGGGGATGG - Intronic
1127547164 15:60002401-60002423 GGGTGCGAGGGGCTGGGGGAGGG - Intergenic
1127708530 15:61571496-61571518 GTGTGCTAGGGGGTTGGGGAGGG - Intergenic
1127980768 15:64033271-64033293 GGGGGAAGGGGGAAGGGGGAAGG + Intronic
1128233324 15:66050488-66050510 ATGTGCAAGGGGCAGGAGGGAGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128358341 15:66943679-66943701 GTGTGTCAGGGGCAGGGGCAGGG + Intergenic
1128509356 15:68303884-68303906 ATCTGCAAGGGGAGGGGGGCCGG + Exonic
1128559641 15:68656146-68656168 CGGTGCGAGGGGGAGGGGGAGGG - Intronic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129218887 15:74119543-74119565 GTGAGGAAGGGTAAGGGGGAGGG - Intronic
1129252389 15:74316092-74316114 GTGGGCAAGGGGCAGGGGTGGGG + Intronic
1129364285 15:75044748-75044770 GGGTGCAAGGGCAGGGGAGAGGG - Intronic
1129386819 15:75201036-75201058 GTGTGCAGTGGGGAAGGGGAGGG - Intronic
1129462386 15:75706082-75706104 CTGTGCACAGGGAAGGGGCAGGG + Intronic
1129722469 15:77885349-77885371 CTGTGCACAGGGAAGGGGCAGGG - Intergenic
1129836574 15:78711551-78711573 GTGAGGAAGGGTAAGGGAGAGGG + Intronic
1129872954 15:78952858-78952880 GGGTGCCAGGGGAATGGGGTGGG - Intergenic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130510652 15:84586471-84586493 GTGAGGAAGAGTAAGGGGGAGGG - Intergenic
1130991264 15:88877410-88877432 GAGGGGAAGGGGAACGGGGAGGG + Exonic
1131256474 15:90865935-90865957 GAGTGCCTGGGGAAGCGGGAGGG - Intergenic
1131302835 15:91214734-91214756 GTGAGCCAGTGGAATGGGGAAGG - Intronic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1131708197 15:95021443-95021465 GTGTGTAGGAGGGAGGGGGAAGG - Intergenic
1131733000 15:95301763-95301785 GCTTGGAAGGGTAAGGGGGATGG + Intergenic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1131965776 15:97840758-97840780 GTGGGCAAAGGGAAGAGGGCAGG + Intergenic
1132066111 15:98732558-98732580 GTGAGCATGGGGAAGGGGGTCGG + Intronic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1132277295 15:100579024-100579046 GTGGGGTAGGGGGAGGGGGAAGG + Intronic
1132357755 15:101185431-101185453 GTGTTCACAGGGAAGGAGGATGG - Intronic
1132357775 15:101185511-101185533 GCGTTCACAGGGAAGGGGGATGG - Intronic
1132414995 15:101613375-101613397 GTGTACCAGGGGAGAGGGGAGGG - Intergenic
1133146611 16:3791734-3791756 GTATGCAGGGGGCAGGGAGAGGG + Intronic
1133365391 16:5205049-5205071 GTATGCATGGGGGAGGGGCAGGG - Intergenic
1133464746 16:6018983-6019005 GCTGGCGAGGGGAAGGGGGAGGG + Intergenic
1133558113 16:6924829-6924851 GTGGGGTAGGGGGAGGGGGAGGG - Intronic
1133572364 16:7054123-7054145 GTGTGAAAGGAAAAGAGGGAGGG - Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133786963 16:8981462-8981484 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1133964245 16:10519419-10519441 GAGGGGAAGGGGAAGGGGAACGG - Intergenic
1134066623 16:11232512-11232534 GAGGGCGAGGGGGAGGGGGAGGG + Intergenic
1134291709 16:12907034-12907056 GAGGGAAGGGGGAAGGGGGATGG - Intronic
1134293166 16:12920171-12920193 GTGGGTACGGGGAGGGGGGAGGG + Intronic
1134360669 16:13528231-13528253 CTGAGCAAGGGGAAAGGTGAGGG - Intergenic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1134692096 16:16197706-16197728 GGGTGCAAGAGGAGGGGGGCAGG + Intronic
1134770630 16:16806105-16806127 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1134777383 16:16864981-16865003 GGGTGGCAGGGGAAGGGGTAGGG - Intergenic
1135250693 16:20899593-20899615 GTGTGCATGGGGGAGGATGAGGG + Intronic
1135624309 16:23981841-23981863 GAGGGGAAGGGGAAGGGGAAGGG - Intronic
1135667955 16:24351622-24351644 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1136165003 16:28447957-28447979 GAGAGGAAGGGGGAGGGGGAGGG - Intergenic
1136197964 16:28667023-28667045 GAGAGGAAGGGGGAGGGGGAGGG + Intergenic
1136214309 16:28781200-28781222 GAGAGGAAGGGGGAGGGGGAGGG + Intergenic
1136259031 16:29061045-29061067 GAGAGGAAGGGGGAGGGGGAGGG + Intergenic
1136682576 16:31976674-31976696 GGGTGCAGGGAGGAGGGGGAAGG - Intergenic
1136782836 16:32917842-32917864 GGGTGCAGGGAGGAGGGGGAAGG - Intergenic
1136886960 16:33936008-33936030 GGGTGCAGGGAGGAGGGGGAAGG + Intergenic
1137232376 16:46578230-46578252 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1137232398 16:46578284-46578306 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1137481675 16:48856965-48856987 GTGTGCATGGGGAAGATGGAAGG + Intergenic
1137526245 16:49239009-49239031 TTGTGCAAAGGCCAGGGGGAGGG - Intergenic
1137557002 16:49477146-49477168 GAGCGGAAGGGGGAGGGGGAGGG + Intergenic
1137689709 16:50414414-50414436 GAGAGAAAGGGGAAGGGGAAGGG - Intergenic
1137919699 16:52474882-52474904 GTGAGAAAGGGGAAGGACGATGG - Intronic
1138028691 16:53542103-53542125 GTGTGAAGGTGGAAGGGGCAGGG - Intergenic
1138076692 16:54049729-54049751 GTAGGCAAAGGGAAGAGGGAGGG + Intronic
1138261135 16:55623526-55623548 GTGTGGAATGGGAATGGGGAAGG - Intergenic
1138352595 16:56353880-56353902 GTGTACAAGGGGCAAGGGGCAGG - Intronic
1138752511 16:59440788-59440810 GGGAGGGAGGGGAAGGGGGAGGG - Intergenic
1138984082 16:62305624-62305646 GTGGGCAGAGGGAATGGGGAAGG + Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1140007432 16:71092272-71092294 TTGTGGAAGGGGAAAGGGCATGG - Intronic
1140136135 16:72207171-72207193 GAGTGCAGGGTGAAGGGAGATGG + Intergenic
1140407641 16:74721676-74721698 GTGTTCAAGGGCAGTGGGGAGGG - Intronic
1140655131 16:77132350-77132372 GAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1140655157 16:77132406-77132428 GAGAGGGAGGGGAAGGGGGAGGG - Intergenic
1140980112 16:80100419-80100441 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1142110734 16:88329703-88329725 CTGTTCCAGGGGAAAGGGGACGG + Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142251725 16:88994969-88994991 TTCTCCAAGGGGAAGGGGAAGGG - Intergenic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1142411135 16:89917848-89917870 GGGTGGAAGCGGGAGGGGGATGG - Intronic
1203085484 16_KI270728v1_random:1181826-1181848 GGGTGCAGGGAGGAGGGGGAAGG - Intergenic
1203141917 16_KI270728v1_random:1772303-1772325 GGCTGCAAGGGGGAGGAGGAGGG - Intergenic
1142746338 17:1960713-1960735 GTTTGCCAGGGGCTGGGGGAGGG - Intronic
1142759274 17:2033956-2033978 TTGTGGGAGGGAAAGGGGGAAGG - Intronic
1142868824 17:2807729-2807751 GAGTGCAGGGGGCTGGGGGAAGG + Intronic
1143005164 17:3827077-3827099 GGGGGAAAGGGGAAGGGGGAAGG + Intronic
1143473428 17:7190370-7190392 GTGTGGGAGAGGATGGGGGAGGG + Exonic
1143598271 17:7928715-7928737 GGGTGCAAGGGGAGTGGGGCCGG - Intronic
1143680791 17:8474743-8474765 CTGTCCAAAGGGAAGGGAGAAGG + Exonic
1143783431 17:9240925-9240947 GTTTTCCAGGGGGAGGGGGAGGG + Exonic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1143934057 17:10463712-10463734 CTGTGCAGGGGCAATGGGGAAGG - Intronic
1144576277 17:16431864-16431886 GTGGGGAAGGGGGAGGGGGCCGG - Intronic
1144675331 17:17158211-17158233 GTGGGGGAGGGGGAGGGGGACGG - Intronic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1145911573 17:28546382-28546404 GGGTGCAAGGGGAAGGTGTGGGG - Intronic
1146165187 17:30582944-30582966 GTGAGCAAGGGGAAAGGAGTGGG + Intergenic
1146180543 17:30695445-30695467 GATTGCCAGGGGATGGGGGATGG - Intergenic
1146214831 17:30970983-30971005 GAGGGCAAGGGGAAGAGGAAGGG + Exonic
1146958011 17:36948363-36948385 CTGAGCAAGGGAAAGGGGGTGGG - Intergenic
1147164407 17:38585831-38585853 GTGTGATGGGGGAAGGGCGATGG + Intronic
1147168471 17:38605339-38605361 GTGTGGAAGGGGGAGGGGTGAGG - Intronic
1147214368 17:38890789-38890811 GTGTGAATGGGGAAGAGGGAGGG - Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147390321 17:40105257-40105279 GTGTGGTGGGGGGAGGGGGATGG + Intergenic
1147574902 17:41593431-41593453 ATGGGCAAGGTGAAGGGGGTGGG - Intergenic
1147632746 17:41942658-41942680 GTGGGCAAGGGGGAGGGAGAAGG + Intronic
1147792003 17:43019869-43019891 GGGTCCATGGGGAAGGGGGATGG + Intronic
1147899189 17:43772816-43772838 GTTTGCCAGAGGAAGGGGTAGGG + Intronic
1147954300 17:44123713-44123735 GCGGGCAAGGGGAAGGCGGGGGG - Intergenic
1147966337 17:44196230-44196252 GTGTGGGTGGGGAAGGGGGGTGG - Intronic
1148123710 17:45226259-45226281 GTGTGCACATGGGAGGGGGAGGG + Intronic
1148398543 17:47331737-47331759 GTTTGCCAGGGGATGGGGGAAGG - Intronic
1148404091 17:47397030-47397052 GAGGGAAAGGGGGAGGGGGAGGG - Intronic
1148441694 17:47714855-47714877 GTGGGCATGGGGGAGGGGGAGGG + Intergenic
1148462307 17:47845809-47845831 GGGAGCGAGGGGAAGGGGGAGGG + Exonic
1148564497 17:48625259-48625281 CCGGCCAAGGGGAAGGGGGAGGG - Intronic
1148831736 17:50437181-50437203 GTGTGCAAGGGAGACGGGAAGGG + Intronic
1149061084 17:52422555-52422577 GTGGGGTAGGGGGAGGGGGAAGG + Intergenic
1149633921 17:58150840-58150862 GTGTGCAAGGGGAAGGGTTCGGG - Intergenic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150370730 17:64635508-64635530 GGTTGCTAGGGGATGGGGGAGGG - Intronic
1150421607 17:65041649-65041671 GTGTGCACGTGGAAGGGGTGTGG + Intronic
1151081684 17:71336516-71336538 GGGTGTGAGGGGAAAGGGGATGG + Intergenic
1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG + Intergenic
1151327683 17:73388974-73388996 GAGGGGAAGGGGAAGGGGAAGGG - Intronic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151577673 17:74960937-74960959 GTGAGCACGGGGTGGGGGGAGGG - Intronic
1151889315 17:76942858-76942880 GTTTGCAAGGGGAGGGGAGAGGG - Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152757956 17:82094912-82094934 GTGGGCAAGGGTAGTGGGGAGGG + Intronic
1153291593 18:3507018-3507040 GTGTGTATGGGGCAGGGGGTGGG + Intronic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153563290 18:6393933-6393955 GTGAGCAAGGGGAGAGCGGAAGG - Intronic
1153626758 18:7028765-7028787 GTGTGCAGGAGCAAAGGGGAGGG + Intronic
1153852122 18:9104702-9104724 GGGTGGAAGGGGGAGGGAGAAGG - Intronic
1154128629 18:11716470-11716492 GTGTGGAAGGGGACGGGAGCAGG + Intronic
1154389038 18:13920773-13920795 GAGTGAACGGGGAAGGGTGAGGG + Intergenic
1154409242 18:14127595-14127617 TTGGGCAAGGGGAGGTGGGAGGG + Intronic
1155075578 18:22351195-22351217 GTGTGTTGGGGGAAGGGAGATGG + Intergenic
1155756841 18:29509145-29509167 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1156043904 18:32856795-32856817 GTGGGGAGGGGGAAGGGGGGAGG - Intergenic
1156111418 18:33731843-33731865 GTGAGGAGGAGGAAGGGGGAAGG - Intronic
1156122586 18:33863270-33863292 GTGGGGTAGGGGAAGGGGGGAGG + Intronic
1156134927 18:34026269-34026291 GTGTGCATGGGGAGGGAGGAGGG - Intronic
1156268376 18:35508677-35508699 GTTAGCAAGAGGAAGGGGCACGG - Intergenic
1156461108 18:37321758-37321780 GAGTGAGAGGGGGAGGGGGAGGG + Intronic
1156897737 18:42265808-42265830 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1156932923 18:42666396-42666418 GTGGGGTAGGGGGAGGGGGAGGG + Intergenic
1157099817 18:44719344-44719366 GTGTGCAAGGGGTGGAGGGCAGG + Intronic
1157142460 18:45123399-45123421 GTGTGGCGGGGGCAGGGGGATGG + Intergenic
1157244968 18:46045510-46045532 GTGGGGTAGGGGGAGGGGGAAGG + Intronic
1157630282 18:49088410-49088432 GTGGGGTAGGGGGAGGGGGAAGG + Intronic
1157899242 18:51498098-51498120 TTCTCCAAGGGGAAGGGAGAAGG + Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1160141931 18:76332124-76332146 GAAAGGAAGGGGAAGGGGGAGGG + Intergenic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160497928 18:79386091-79386113 GTGTGCACGGGGGCGGGGAAAGG - Intergenic
1160545057 18:79647413-79647435 GGGAGGAAGGGGAGGGGGGAGGG + Intergenic
1160877238 19:1302420-1302442 GTTTGCAAGGGGAAGAGGTTAGG - Intergenic
1160923569 19:1532098-1532120 GTGGGTAGGGGGAAGGGGAAGGG + Intronic
1160960436 19:1718481-1718503 GGGTGCAGTGGGGAGGGGGAGGG + Intergenic
1161088090 19:2344243-2344265 GGGTGCAAGGGGCAGGGTGATGG - Intronic
1161137511 19:2628683-2628705 GGGTGCTAGGGGCTGGGGGAGGG - Intronic
1161202897 19:3025668-3025690 GTGTGGGTGGGGAAGGGGGCGGG + Intronic
1161366080 19:3880624-3880646 GTGTGCAGGGAGGAGGGGGTGGG - Exonic
1161366955 19:3885602-3885624 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161515009 19:4691579-4691601 GTGTGGCACGGGAAGGGGGGCGG + Intronic
1161716726 19:5880512-5880534 GTGGGGAAGGGGCAGGGGGAGGG - Intronic
1161756580 19:6138472-6138494 GAGAGAGAGGGGAAGGGGGAAGG + Intronic
1161939436 19:7393713-7393735 GTGTGGAAGTGGATAGGGGAGGG + Intronic
1162083546 19:8234511-8234533 GGGTGCCAGGGGAAGGGAAATGG - Intronic
1162237375 19:9319803-9319825 GTGTGGTGGGGGGAGGGGGAGGG + Intergenic
1162352145 19:10157343-10157365 GTGTGAAAAGGGATGTGGGAAGG + Intronic
1162393576 19:10403875-10403897 GTCTGCAAGGGGTAGGGACACGG + Intronic
1162470001 19:10867145-10867167 GGGTGCCAGGGGCTGGGGGAGGG - Intronic
1162521339 19:11181587-11181609 GGGTGCCAGGGGCTGGGGGAAGG + Intronic
1162704243 19:12543333-12543355 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
1162978049 19:14220095-14220117 GGTTGCCAGGGGATGGGGGATGG + Intergenic
1163004561 19:14389259-14389281 GAGGGGGAGGGGAAGGGGGAAGG + Intronic
1163211679 19:15845477-15845499 GAGAGGAAGGGGAAGGGGAAGGG + Intergenic
1163370959 19:16901049-16901071 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1163454912 19:17400846-17400868 GTGAGCAAGGGGAAGTGAGGGGG + Intergenic
1163549412 19:17957235-17957257 GTGGGGAAGGGGAAAGGGAAAGG + Intronic
1163779630 19:19239632-19239654 GAGTGGAAGGAGGAGGGGGAGGG - Intronic
1164805105 19:31110347-31110369 GTGTGCATGGGAAAGGGTAAAGG + Intergenic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165475218 19:36026492-36026514 GGCTGCGAGGGGAAGGAGGACGG - Intronic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1165674067 19:37706282-37706304 GGGGGAAGGGGGAAGGGGGAAGG + Intronic
1166060180 19:40321122-40321144 GTGGGCAAGGGGCACTGGGAAGG - Exonic
1166151760 19:40880251-40880273 GTGTGGAGGGAGAAGGGGGTTGG + Intronic
1166385621 19:42378916-42378938 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1166676654 19:44745376-44745398 GGGTGCAAGGAGCCGGGGGAGGG + Intergenic
1166764593 19:45245314-45245336 GTGTGCTGGGGACAGGGGGAAGG - Intronic
1166929049 19:46290191-46290213 GTGGGGAAGGGGTAGGGAGAGGG - Intergenic
1166982508 19:46639490-46639512 GCCCGCAAGGGGAGGGGGGAGGG - Intergenic
1166999345 19:46736796-46736818 GTGTGCTCGGGGAGGGGGGCTGG - Intronic
1167114893 19:47483456-47483478 GTGTGTAAGGAGGAGGGCGAAGG + Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167331023 19:48856254-48856276 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
1167421103 19:49403855-49403877 GTGTGGAGGGGGAAGGTAGAGGG - Intronic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1167455766 19:49596175-49596197 GGCTACAAGGGCAAGGGGGATGG + Exonic
1167614265 19:50523242-50523264 GTGTGCCAGGGAGAAGGGGACGG + Intronic
1167638564 19:50668313-50668335 GTGGGCACGGGCGAGGGGGACGG + Exonic
1167679036 19:50908336-50908358 GTGAGAGAGGGGAAAGGGGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167742752 19:51334168-51334190 GTGAGCAAGGGGACTGGGGAAGG - Intronic
1168122632 19:54260748-54260770 GTGTGCTTGGGGAAGGGAGAAGG - Intronic
1168296654 19:55380322-55380344 GGGGGAAGGGGGAAGGGGGAGGG - Intronic
1168296659 19:55380329-55380351 GAGGGGAGGGGGAAGGGGGAAGG - Intronic
925200030 2:1959671-1959693 GTGTGTGAGGGGCAGAGGGATGG - Intronic
925246403 2:2387452-2387474 GGGGGCAGGGGGAAAGGGGAGGG - Intergenic
925295574 2:2774255-2774277 GTGTGCAGGGGGAAATGGCATGG + Intergenic
925340709 2:3133579-3133601 GGGTGCCAGGGGCTGGGGGAGGG + Intergenic
925418466 2:3690415-3690437 GGGGGGGAGGGGAAGGGGGAGGG - Intronic
925684057 2:6453212-6453234 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
925755363 2:7128037-7128059 GGGAGGAAGGGGAGGGGGGAGGG - Intergenic
925755413 2:7128128-7128150 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925755436 2:7128169-7128191 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925755459 2:7128210-7128232 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925755489 2:7128264-7128286 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925911009 2:8573649-8573671 CTGTGCAAGGTGGTGGGGGAAGG + Intergenic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
925947224 2:8876712-8876734 GGGGGAAGGGGGAAGGGGGAAGG + Intronic
926023104 2:9514363-9514385 GGGGGGAGGGGGAAGGGGGAAGG + Intronic
926037414 2:9646400-9646422 GAGAGCAAGGGGCAGGGCGAGGG - Intergenic
926124508 2:10263916-10263938 GGGGGGAGGGGGAAGGGGGAAGG + Intergenic
926135515 2:10332970-10332992 GGGTGCAGGGGGGAGGGGCAGGG + Intronic
926212776 2:10883451-10883473 GTGTGCAAGAGTAAGTGGGAAGG + Intergenic
927039126 2:19210416-19210438 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
927305211 2:21563380-21563402 GTCTGGGAGGGGTAGGGGGAAGG + Intergenic
927343558 2:22010226-22010248 GAGGGGAAAGGGAAGGGGGAGGG - Intergenic
927692588 2:25218852-25218874 GTGTCCAAGGGCAAGGAGAAGGG - Intergenic
927861476 2:26562711-26562733 GGGCGCTAGTGGAAGGGGGAGGG - Intronic
928280074 2:29938154-29938176 GAGGGCAGGGGGAAGGGGGAGGG + Intergenic
928842442 2:35626468-35626490 GGATGCAAGGGGTAGGAGGATGG - Intergenic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
928998369 2:37321473-37321495 GTGTGCATGGGGGAAGGGGAAGG - Intronic
929078697 2:38100431-38100453 GTGTGCAATAGGAAGGGGGCTGG - Intronic
929096116 2:38264645-38264667 GTGAGCAAGGGGAAGAGTGTTGG + Intergenic
929452303 2:42046321-42046343 GTCTGCAGGGTGTAGGGGGAAGG - Intergenic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
929868799 2:45740540-45740562 GCTTGCAATGGGCAGGGGGAAGG - Intronic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930441375 2:51411629-51411651 GTGGGCATGGGGAATGGAGAAGG - Intergenic
930545369 2:52760672-52760694 GTGGGGTAGGGGTAGGGGGAGGG + Intergenic
930835401 2:55788259-55788281 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
930838488 2:55819985-55820007 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
930936634 2:56960616-56960638 GAGTGCATGAGGAAGGAGGAAGG + Intergenic
931881409 2:66574970-66574992 GTGGGGAAGGGGAAGGGGTGGGG - Intergenic
931957783 2:67447393-67447415 GTGTCTAAGTGGAAGGGAGATGG - Intergenic
932291758 2:70586786-70586808 GTCTGGAAGGGTAAGGGGGAAGG - Intergenic
932355194 2:71062676-71062698 GTGGGCAAGGGATAGAGGGAGGG - Intergenic
932585087 2:73022618-73022640 GTAGGGAGGGGGAAGGGGGAAGG + Intronic
932585092 2:73022625-73022647 GGGGGAAGGGGGAAGGGGGAGGG + Intronic
932744893 2:74325869-74325891 GGGGGAAAGGGGAAGGGGAAGGG + Intronic
933061989 2:77749240-77749262 GGGGGCAGGGGGATGGGGGAGGG + Intergenic
933274934 2:80273626-80273648 GTGTGGCAGGAGAAGGGTGATGG - Intronic
933365713 2:81351137-81351159 GTGGGGAAGGGGGAGGGGGGAGG - Intergenic
934731614 2:96662054-96662076 GTGTGGAAGAAGAAGGGGCATGG + Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
934951476 2:98578629-98578651 GTGTGCTAGGGGCAGGCGGATGG - Intronic
935696973 2:105778468-105778490 GTGTGCATGGGGACCAGGGAAGG + Intronic
935848331 2:107190413-107190435 GTGGGCTGGGGGGAGGGGGAGGG + Intergenic
936024189 2:109018692-109018714 GAGTGCCAGTGGAAAGGGGATGG - Intergenic
936159743 2:110075784-110075806 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
936184922 2:110295569-110295591 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
936449842 2:112625838-112625860 GTGTTCAAAGGGAAGGCAGAAGG + Intergenic
936644727 2:114355892-114355914 GTGGGGTAGGGGGAGGGGGAAGG - Intergenic
936689010 2:114863826-114863848 GTGTGCAAGGGGCAGAGACAGGG - Intronic
936889891 2:117356965-117356987 GGTTGCCAGGGGATGGGGGAGGG - Intergenic
936927475 2:117751971-117751993 GTGGGGAGGGGGGAGGGGGAAGG + Intergenic
937017637 2:118620260-118620282 GTGTTCAAGGGGCAGGAGCATGG - Intergenic
937228916 2:120385464-120385486 GTTTGCCTGGGAAAGGGGGAGGG + Intergenic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
938311864 2:130295897-130295919 CTTTGCAACGGGAAGGGGAAGGG - Intergenic
938845717 2:135206728-135206750 GAGAGAAAGGGGAAGAGGGAGGG + Intronic
939330492 2:140753041-140753063 GTTTGCCAGGGGATGGGGGAAGG - Intronic
939405009 2:141745415-141745437 CTCTGCCAGTGGAAGGGGGAGGG - Intronic
939787697 2:146537454-146537476 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
939931538 2:148240266-148240288 GTGAGGCAGGGGGAGGGGGAAGG + Intronic
940008129 2:149028372-149028394 CTGGGCATGGGGAAGGGTGAAGG - Intergenic
940372941 2:152922907-152922929 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940450968 2:153836649-153836671 GTGGGGAGGGGGGAGGGGGAGGG - Intergenic
940503934 2:154528274-154528296 AGCTGCAAGGGGATGGGGGAGGG + Intergenic
940716492 2:157230848-157230870 GTGTGCAAGGAGAAGGAAGCAGG - Intergenic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941218825 2:162748865-162748887 GGGAGGGAGGGGAAGGGGGAGGG - Intronic
941521046 2:166543510-166543532 GAAAGAAAGGGGAAGGGGGAAGG + Intergenic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
942013891 2:171791735-171791757 ATGTGCAAGGGAAATGGGGGAGG + Intronic
942223642 2:173795619-173795641 GTGTGCAAGAGGCCGGGGTATGG + Intergenic
942531758 2:176917617-176917639 GTGAGCAAGGGGCAGGGGACTGG + Intergenic
943549861 2:189325166-189325188 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
943761253 2:191611892-191611914 GTGTGCACAGGGATGGCGGATGG + Intergenic
944035997 2:195295253-195295275 GGGGGCATGGGGTAGGGGGAGGG + Intergenic
944047915 2:195434628-195434650 GGGCGGAAGGGGAAGGGGAAGGG - Intergenic
944077631 2:195749831-195749853 GTGGGGAAGGGGGAGGGGGGAGG + Intronic
944526435 2:200624473-200624495 GTTTGGAAAGGGAAAGGGGAGGG + Intronic
944570677 2:201041945-201041967 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
945184392 2:207124403-207124425 GTCTGCAAGAGGAAGAAGGAGGG + Exonic
945198206 2:207257013-207257035 CTGTGCATGTGGCAGGGGGAAGG + Intergenic
945874094 2:215258956-215258978 GTGTGGTGGGGGCAGGGGGAAGG + Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946131345 2:217609446-217609468 GAATCCAAGGGGAAGGAGGAAGG + Intronic
946192734 2:218016041-218016063 GAGGGCCAGGGAAAGGGGGAGGG + Intergenic
946283422 2:218683726-218683748 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
946519067 2:220446583-220446605 GAGGGAAAGGGGAAGGGGGAAGG - Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947273574 2:228367065-228367087 GTGGGGTCGGGGAAGGGGGAGGG - Intergenic
947525007 2:230872330-230872352 GTGAGCAAGGGCCCGGGGGAAGG + Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947732186 2:232437406-232437428 GTGTGGAAGGGGAGGGGAGCTGG + Intergenic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
949049961 2:241892367-241892389 AGGGGCAAGGGGAAGAGGGATGG - Intergenic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169286940 20:4316862-4316884 GTGTGAAAGAGGGAGGGGAAAGG + Intergenic
1170208421 20:13823982-13824004 GTGTTCAAGGGTATGGTGGAAGG - Intergenic
1170243095 20:14191979-14192001 GTGGGGGAGGGGGAGGGGGAGGG + Intronic
1170629357 20:18055085-18055107 GTGTGCTGGGGGAAGGGGGGCGG - Intronic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1171176348 20:23052845-23052867 GTGTCCAAGGAGATTGGGGAGGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171214109 20:23339958-23339980 GTCTTCATGGGGATGGGGGATGG - Intergenic
1171399071 20:24860005-24860027 GTGAGGAAGAGGAACGGGGATGG - Intergenic
1171429253 20:25070443-25070465 GTGTGCAGGGGGTTGGGGGGGGG - Intergenic
1171474518 20:25397830-25397852 AAGGGAAAGGGGAAGGGGGAAGG + Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172101166 20:32484403-32484425 GTGCGGATGGGGAAGGGGGAGGG - Intronic
1172301380 20:33852875-33852897 TTGTGCGAGGGGATGGGGGAAGG - Intronic
1172459015 20:35101209-35101231 GCTGGCAAGGGGAAGGAGGAAGG - Intergenic
1172479781 20:35264216-35264238 GTGTGGAAGGGGAGGGGTAAAGG - Intronic
1172608217 20:36230067-36230089 GTGGGGTGGGGGAAGGGGGAAGG - Exonic
1172946106 20:38690682-38690704 GTGTGTTGGGGGGAGGGGGAAGG + Intergenic
1173375228 20:42476985-42477007 TGGTGGAAGGAGAAGGGGGAAGG - Intronic
1173375422 20:42478203-42478225 GGGTGAAAGGAGAAGGGGGAAGG + Intronic
1173500238 20:43548011-43548033 GTGTGCATGGGGAATGGGGGAGG - Intronic
1173756552 20:45521745-45521767 GTGGGCATGGGAAAGGGGGTGGG - Intergenic
1174136059 20:48380659-48380681 GTGTGCCTGGGGAAGAGGCAGGG + Intergenic
1174340198 20:49890690-49890712 GTGTGCAGGGGGATGGGCCAGGG + Exonic
1174385583 20:50186933-50186955 GTGGGCGTGGGGCAGGGGGATGG - Intergenic
1174485017 20:50855573-50855595 GACTGGAAGGGGAAGGGGAAGGG + Intronic
1174593893 20:51668116-51668138 GTGGGCGAGGGGCTGGGGGAGGG + Intronic
1174720952 20:52811970-52811992 GTGTTCAGTGGGAAGGGGCAGGG + Intergenic
1175100616 20:56576229-56576251 GAGGGCAAGGGGAAGGGGCAGGG - Intergenic
1175320519 20:58084669-58084691 GGGTGGGAGGGGAAGGAGGAAGG - Intergenic
1175555958 20:59856915-59856937 GTAGGGTAGGGGAAGGGGGAGGG + Intergenic
1175557961 20:59887143-59887165 GTGGGGTAGGGGAAGGGGGGAGG - Intronic
1175742764 20:61431803-61431825 GGTTGCCAGGGGATGGGGGAGGG - Intronic
1175869838 20:62203678-62203700 GGGTGCCCGGGGGAGGGGGAAGG - Intergenic
1175869988 20:62204560-62204582 GTGTCCAAGTGGAAGGTGGCAGG - Intergenic
1175908179 20:62392028-62392050 GTGGGCCAGGGGAAGGGCCACGG + Intronic
1175967344 20:62666135-62666157 GAGGGGAAGGGGAAGGGGAAGGG - Intronic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176863981 21:14032294-14032316 TTGGGCAAGGGGAGGTGGGAGGG - Intergenic
1177115068 21:17075317-17075339 GTGGGCAGGGGGGAGAGGGAGGG + Intergenic
1177143420 21:17381904-17381926 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1177158930 21:17527310-17527332 GTGTGCTAGTGGAGTGGGGAAGG + Intronic
1177422745 21:20882647-20882669 GGGTGCAATGGGAATGGGAACGG - Intergenic
1177779956 21:25611568-25611590 GTTTGTAAGGGAAAAGGGGAAGG + Intergenic
1178013046 21:28308646-28308668 GAGTACAAGGGGAAGTGGAATGG - Intergenic
1178093686 21:29191058-29191080 GTGGCCAAGGCGAAGGGGGCAGG - Intergenic
1178319866 21:31597207-31597229 GAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1178978464 21:37240951-37240973 GAGTGCAAGGAGAAGGGCCAGGG + Intronic
1179125506 21:38587297-38587319 ATGTTCAAGGGGATGGGGGAGGG + Intronic
1179487960 21:41722842-41722864 GTGTGCGGGGGGAAGTGGGGGGG - Intergenic
1179505527 21:41837518-41837540 GGGTGCCAGGGGCTGGGGGAGGG + Intronic
1179673944 21:42969082-42969104 GTGTGCAGGGGGCAGTGGGGGGG + Intergenic
1179904710 21:44416472-44416494 GGGTGCATGTGGAAGGGGCAGGG - Intronic
1180036473 21:45252815-45252837 GTGTGCAATGGGAGGGGTGTCGG + Intergenic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180237164 21:46469764-46469786 GTTTGCCAGGGGAAGAGGAAAGG - Intronic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1180800094 22:18627687-18627709 GTGCACAAGGGGCAGGGGGAGGG - Intergenic
1180851328 22:19023252-19023274 GTGCACAAGGGGCAGGGGGCAGG - Intergenic
1180872501 22:19154584-19154606 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1180964162 22:19777202-19777224 GTGGGGTAGGGGGAGGGGGAGGG - Intronic
1181221621 22:21367579-21367601 GTGCACAAGGGGCAGGGGGAGGG + Intergenic
1181542732 22:23582405-23582427 GGGTGCCAGGGGCTGGGGGAGGG - Intergenic
1181625918 22:24121985-24122007 CTGTGCAAGGGAAGTGGGGAAGG + Intronic
1181885666 22:26020325-26020347 ATCTGAAAGGGGAAGGGGTATGG + Intronic
1181961164 22:26622659-26622681 GTGTTCAGGGGGTATGGGGAGGG + Intronic
1182063701 22:27415890-27415912 GTGTGCATGTGAAAAGGGGAAGG - Intergenic
1182102978 22:27670721-27670743 GGGGGAAGGGGGAAGGGGGAAGG - Intergenic
1182191336 22:28463761-28463783 GTGGGGTAGGGGGAGGGGGAGGG + Intronic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182350088 22:29694524-29694546 ATGTGCAAGGGGAAGGCTGGTGG - Intronic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1182570658 22:31235255-31235277 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1182886391 22:33777630-33777652 GGGAGGGAGGGGAAGGGGGAGGG + Intronic
1182886395 22:33777636-33777658 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1183400943 22:37604027-37604049 GTGTGCAGGGGACAGGGAGAAGG - Intergenic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1183858644 22:40653257-40653279 GGGAGAAGGGGGAAGGGGGAAGG + Intergenic
1184340884 22:43885298-43885320 GTGGGCAAGGGGATGAGGAAGGG - Intronic
1184478984 22:44736353-44736375 GTGTCCAAGGGGATGGTGGGAGG - Intronic
1184503789 22:44889263-44889285 GTGTGCACGGGTAGGGGGTAGGG + Intronic
1185229808 22:49673554-49673576 GTGGGGAGGGGGAAGGGGAAGGG + Intergenic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1185420887 22:50733762-50733784 GTGTGCATGGGGAGGGAGCAGGG - Intergenic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
949493543 3:4611009-4611031 GGGAGGAAGGGGAAGGGGAAGGG - Intronic
949507872 3:4743732-4743754 TTGTTGAGGGGGAAGGGGGAGGG + Intronic
949922162 3:9011450-9011472 GTGTGACAGGGGAATGGTGAAGG - Intronic
949933508 3:9098974-9098996 GCCTGCATGGGGAAGGAGGAGGG - Intronic
950044443 3:9940716-9940738 GAGGGAAAGGGGGAGGGGGAGGG + Intronic
950085547 3:10254984-10255006 GTGGGAAGGAGGAAGGGGGAAGG - Intronic
950485905 3:13273882-13273904 GTGTGCATGGGGCAGAGTGAGGG - Intergenic
950527152 3:13531107-13531129 GGGTGCCAGGGGCAGGGGAAGGG + Intergenic
950718388 3:14865538-14865560 GAGTGAGAGGGGAAGGGGGTGGG - Intronic
951719090 3:25679517-25679539 GTGAGGAGGGGAAAGGGGGAGGG + Intergenic
951719135 3:25679618-25679640 GAGGGCGAGGGGAAAGGGGAAGG + Intergenic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952455343 3:33467035-33467057 GTGTGGGAGGGGGAGGGGGCTGG + Intergenic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
952749943 3:36816960-36816982 GTGGGAAAGGGGAAGGGGAAGGG - Intergenic
953219262 3:40954010-40954032 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
953355724 3:42254844-42254866 GTTAGCGAGGGGAAGAGGGATGG + Intergenic
953463176 3:43097494-43097516 GTGAGCAAGGGGGAAAGGGAGGG + Intronic
954298026 3:49684950-49684972 GCTTGCCTGGGGAAGGGGGAAGG + Intronic
954431411 3:50472764-50472786 GGGTGCATGGGGAATGGGGGTGG - Intronic
954522111 3:51237898-51237920 GGGTGCCAGGGGATAGGGGAGGG - Intronic
955034879 3:55257926-55257948 GTGGGAGAGAGGAAGGGGGAGGG - Intergenic
955087809 3:55720075-55720097 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
955162638 3:56479791-56479813 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
955207993 3:56914825-56914847 GGTTGCCAGGGGATGGGGGAGGG + Intronic
955370385 3:58346290-58346312 GTGTGCAAGGTGCAGTGGAAAGG + Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955873931 3:63470691-63470713 GTGGGCAAGAGGAAGAGGGTTGG - Intronic
955896440 3:63705697-63705719 GTGAGCAAAGGCAAGGAGGAAGG + Intergenic
956230142 3:67005636-67005658 GAAGGGAAGGGGAAGGGGGAGGG - Intronic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957762971 3:84583683-84583705 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
957894447 3:86403309-86403331 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
957980582 3:87504654-87504676 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
958111286 3:89149625-89149647 GTGGGGAGGGGGGAGGGGGAGGG - Intronic
958703439 3:97622257-97622279 GTTTGCCAGGGGCTGGGGGAAGG - Intronic
958880285 3:99661941-99661963 ATGTGCCAGGGGATGAGGGAAGG + Intronic
959618569 3:108375328-108375350 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
959689555 3:109183830-109183852 GTGTGCATGGGGAGAAGGGATGG - Intergenic
960094013 3:113670629-113670651 GAGCGGAAGGGGAAGGGGAAGGG + Intronic
960097936 3:113706043-113706065 GAGTGCAAGGGGAAGAAGCAAGG - Intergenic
960404580 3:117244327-117244349 GTATGCATGAGGAAGGAGGAAGG - Intergenic
960743606 3:120861878-120861900 GTGGGTTAGGGGTAGGGGGAGGG - Intergenic
960863023 3:122171123-122171145 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
960902144 3:122564167-122564189 GTGGGCGGGGAGAAGGGGGACGG - Intronic
961013060 3:123448599-123448621 GTCTCCAAGGGGAGGGCGGACGG + Exonic
961045494 3:123705115-123705137 GTGTGCAGGGGGTAGAGGGGTGG - Intronic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961606418 3:128098838-128098860 GTGAGCAAGGGGCAGGGCGGAGG - Intronic
961634620 3:128325188-128325210 TTGTTCCTGGGGAAGGGGGAAGG + Intronic
961714199 3:128847575-128847597 GGGAGGAAGGGGAAGGGGGCAGG + Intergenic
961780363 3:129317131-129317153 CTGTGCACGGGAGAGGGGGAGGG - Intergenic
962009397 3:131379735-131379757 GAATGCTAGTGGAAGGGGGAAGG + Intergenic
962158224 3:132971619-132971641 GGTTGCTAGGGGATGGGGGAGGG + Intergenic
962340052 3:134575154-134575176 GGGAGGGAGGGGAAGGGGGACGG - Intergenic
962906100 3:139804415-139804437 GTGGGGCAGGGGAAGAGGGAAGG + Intergenic
962978846 3:140469806-140469828 GTGAGGCAGGGGAAGAGGGAGGG + Intronic
963001770 3:140688195-140688217 GAGTGCACGGGGTAGGGGGAGGG - Exonic
963124677 3:141804173-141804195 GTGTGCAAGCTGAAGGTGCAAGG - Intronic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
963143266 3:141965559-141965581 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
963706063 3:148689907-148689929 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
963824975 3:149943687-149943709 GGTTGCTAGGGGATGGGGGAAGG - Intronic
964398382 3:156272444-156272466 GTCTGCCTGGGGAAAGGGGAGGG - Intronic
964412048 3:156408031-156408053 TTGTGGAAGGTGACGGGGGAGGG + Intronic
964601896 3:158511248-158511270 GTGGGGTAGGGGGAGGGGGAAGG - Intronic
964966292 3:162497158-162497180 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
965094740 3:164210649-164210671 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966461468 3:180181637-180181659 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
966555206 3:181251370-181251392 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
966698821 3:182822259-182822281 GTGGGGTAGGGGCAGGGGGAGGG - Intronic
966799324 3:183748221-183748243 GGGGACAAGGGGAAGGGGAAAGG - Intronic
966886888 3:184381816-184381838 GTGAGAAAGGGGAAGGAGCAAGG + Intronic
966901862 3:184492479-184492501 GTGAGGAAGGGGGAGGGTGAAGG + Intronic
966938411 3:184729773-184729795 GTGTGCATGGGGAGAGGGCAAGG - Intergenic
966944435 3:184767806-184767828 GTCAGCAAGTGGAAGGGGCAGGG + Intergenic
966954750 3:184864142-184864164 GAGGGGGAGGGGAAGGGGGAAGG + Intronic
966982888 3:185153699-185153721 GGGTGGGAGGAGAAGGGGGAGGG - Intergenic
967422878 3:189293288-189293310 GTGTGACAGCGGAAGTGGGAGGG - Intronic
967431082 3:189385967-189385989 GTGGGGTAGGGGGAGGGGGAAGG - Intergenic
967715072 3:192753287-192753309 GTGTGCGAGGGAGAGGGAGAGGG - Intronic
967790937 3:193548332-193548354 GGGTGTAATGGGAAGGGGAAGGG + Intronic
968135647 3:196217787-196217809 GGGGGCTGGGGGAAGGGGGAGGG - Intronic
968339312 3:197941467-197941489 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
968339315 3:197941473-197941495 GGGAGGGAGGGGAAGGGGGAGGG - Intronic
968377599 4:56315-56337 GTGGGCAAGGGGAGGTGGGAGGG - Intronic
968426309 4:525838-525860 GTGAGGAAGCGGAGGGGGGACGG + Intronic
968475671 4:805932-805954 GGGTGCGAGGGGCTGGGGGAAGG + Intronic
968620606 4:1601922-1601944 GTGGGCCAGGGGAGGTGGGACGG + Intergenic
968647873 4:1749164-1749186 GTGGGGAGGGGGCAGGGGGAGGG - Intergenic
968669241 4:1839865-1839887 GTATGTACGGGGAAGGGGCATGG - Intronic
968846093 4:3042260-3042282 TTGTACGAGGGGAAGGGGAAGGG + Intergenic
968940087 4:3633281-3633303 GGGAGGGAGGGGAAGGGGGAGGG - Intergenic
969291322 4:6241786-6241808 GTGTGCAAAGGGAAGGAGATTGG + Intergenic
969348882 4:6586629-6586651 GGGTGCTAGGGGCTGGGGGAGGG + Intronic
969390247 4:6887377-6887399 GGCTGGAGGGGGAAGGGGGAGGG + Intergenic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969582548 4:8073529-8073551 CTGAGCAAGGGGAGGGGTGAGGG + Intronic
969583386 4:8078326-8078348 GTGTGCGTGGGGAGAGGGGATGG - Intronic
969621903 4:8282906-8282928 GTGTGCAAGGAGCAGAGGCATGG + Intronic
970043447 4:11822728-11822750 GTGTGCAAGGTGGAGGTGGTTGG + Intergenic
970346987 4:15161930-15161952 GTGTGGCAGGGGGTGGGGGAAGG + Intergenic
970572133 4:17393358-17393380 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
970652431 4:18193493-18193515 GTGTGTATTGGGTAGGGGGAAGG - Intergenic
970775836 4:19672861-19672883 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971233547 4:24820145-24820167 GTGTGCAAGGGTTAGGGCTAGGG - Intronic
972073550 4:35054951-35054973 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
972117180 4:35650915-35650937 GTGGGGCAGGGGAAGGGGGGAGG + Intergenic
972668299 4:41189352-41189374 GTCTGGAAGGGGCAGGAGGAAGG + Intronic
972741277 4:41889006-41889028 GTGTGGAAAGGGAAAGGGGTTGG - Intergenic
974245161 4:59304840-59304862 GTGGGGTAGGGGGAGGGGGAAGG + Intergenic
974586303 4:63883084-63883106 GTGAGGAAGGGGATGGGGGGTGG - Intergenic
974597688 4:64036622-64036644 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
974597699 4:64036640-64036662 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
974974231 4:68870217-68870239 GTGGGGTAGGGGGAGGGGGAAGG - Intergenic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
976114182 4:81709451-81709473 GTTTGCCAGGGCAAGGGAGAAGG + Intronic
976216722 4:82721983-82722005 GTGTGCAACAGGAAGGGTGGAGG - Intronic
976244070 4:82990050-82990072 GTGGGCAAGGGCAGTGGGGATGG - Intronic
976389714 4:84496357-84496379 GGGGGAGAGGGGAAGGGGGAGGG + Intronic
976451330 4:85194603-85194625 GTGGGGTTGGGGAAGGGGGAGGG + Intergenic
976456473 4:85253308-85253330 GTTTGCAAGGGGCTGAGGGAGGG - Intergenic
976571541 4:86617566-86617588 TGCTGGAAGGGGAAGGGGGAGGG - Intronic
976691024 4:87867353-87867375 GAGTGCAAGAGGAAGGGGAAAGG - Intergenic
976753750 4:88477277-88477299 GAAGGGAAGGGGAAGGGGGAGGG + Intronic
976753860 4:88477545-88477567 GTGGGGGAGGGGAAGGGGAAGGG + Intronic
977140199 4:93361983-93362005 GTGGGGTGGGGGAAGGGGGAAGG - Intronic
977597225 4:98896403-98896425 GAATGGAAGGGGAAGGGGAAAGG + Intronic
977732461 4:100370328-100370350 ATGTCCTGGGGGAAGGGGGAAGG + Intergenic
977986759 4:103391378-103391400 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
978210095 4:106124850-106124872 GTGGGCTGGGGGGAGGGGGAAGG + Intronic
978285080 4:107067778-107067800 GTGTGCAATGGAGAGGGGGCAGG + Intronic
978378975 4:108106391-108106413 GTGTGCCGGGTGAAGGGGAAAGG + Intronic
978438066 4:108707161-108707183 GGGGGAAAGGGGCAGGGGGAGGG + Intergenic
979438992 4:120728666-120728688 GTATGTAAGGGGCAGGGGGCGGG - Intronic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
979751712 4:124287596-124287618 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
980000883 4:127486357-127486379 GAATGCAAGGGGAAGGTAGAGGG + Intergenic
980081033 4:128344347-128344369 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981443946 4:144813013-144813035 GTGGGTAGGGGGAAAGGGGAGGG + Intergenic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
981968814 4:150639202-150639224 GTGGGGTAGGGGAAGGGGGGAGG + Intronic
981990060 4:150907338-150907360 GGGAGGAAGGGGAAGGGGGAGGG + Intronic
981994664 4:150963174-150963196 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
983272917 4:165584161-165584183 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
983905169 4:173174145-173174167 GTGTGGGGGGAGAAGGGGGATGG - Intronic
984189127 4:176583664-176583686 GTGTGTATGGGGAAGAGAGAAGG + Intergenic
984310383 4:178051003-178051025 TGGTGTAAGGGGATGGGGGAGGG - Intergenic
984514089 4:180716964-180716986 GAGTGCAAGGTGATGGAGGATGG + Intergenic
984782875 4:183541839-183541861 CTGTGCAAGGGGAATGCAGAAGG - Intergenic
984869821 4:184316187-184316209 GAGGGGAAGGGGAAGGGGAAAGG - Intergenic
984911425 4:184676908-184676930 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
984911429 4:184676915-184676937 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
985690114 5:1304252-1304274 AAGTGGAAGGGGAAGGGGAAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986034940 5:3928257-3928279 GTGTGTAGGGGGAGGCGGGAGGG - Intergenic
986136312 5:4982359-4982381 GTGTGCAGGGGGCAGGCGGGGGG + Intergenic
986362395 5:6993107-6993129 GAGGGCAAGGGGAAGGGGAAGGG - Intergenic
986668071 5:10120412-10120434 AGGTCCAAGGGGAAGGGCGAAGG + Intergenic
987332546 5:16869913-16869935 GAAGGGAAGGGGAAGGGGGAGGG + Intronic
987958104 5:24766130-24766152 CTGGGCTAGGGGAGGGGGGAGGG + Intergenic
988727569 5:33939308-33939330 ATGTGCAAGGGGAATTGGGGCGG + Intergenic
989194934 5:38707442-38707464 GGGTGAAAGGGGAGGTGGGAGGG - Intergenic
989663631 5:43825349-43825371 CCGTGCAAAGGGTAGGGGGAGGG + Intergenic
989690607 5:44138625-44138647 GTGTGTTGGGGGGAGGGGGAGGG + Intergenic
989745490 5:44824649-44824671 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
989750604 5:44888707-44888729 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
989751261 5:44896506-44896528 GGTTGCCAGGGGATGGGGGAAGG - Intergenic
990337955 5:54793660-54793682 TTGGGCAAGGGGAGGGGAGATGG - Intergenic
990486406 5:56263396-56263418 GTCTGCTAGTGGAAGGGGGGAGG - Intergenic
990582085 5:57174533-57174555 GTGTGCAAGAGGCCGGGGGAAGG - Intronic
990589644 5:57249751-57249773 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
990734091 5:58841099-58841121 GTCTGCAGGGGGCAGGGGGCAGG + Intronic
990943901 5:61230252-61230274 GAGTTTAAGGGGAAGGGAGACGG + Intergenic
991375274 5:65958656-65958678 GTGAGGGAGGGGGAGGGGGAGGG + Intronic
991620930 5:68544893-68544915 GGGAGCAAGGTGGAGGGGGAAGG + Intergenic
992052513 5:72954563-72954585 GGGTGCGGGGGGAAGGGGGGGGG + Intergenic
992157688 5:73971096-73971118 CTCTGCAAGGGGCAGGGGGTGGG + Intergenic
992487046 5:77207729-77207751 GTGTGCAAGTGGAGGGGAAATGG - Intergenic
992578980 5:78151847-78151869 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
992579074 5:78152036-78152058 GAAGGGAAGGGGAAGGGGGAGGG - Intronic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
992640327 5:78763435-78763457 GGGTGAGAGGGGAAGGGGAAGGG - Intronic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
993663042 5:90662753-90662775 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
993705861 5:91169434-91169456 GGTTGCCAGGGGATGGGGGAGGG + Intergenic
993901154 5:93584928-93584950 GAGGGGAAGGGGAAGGGGAAGGG - Exonic
993904957 5:93612319-93612341 GGGGGTAAGGGGAAAGGGGAGGG + Intergenic
994352341 5:98761043-98761065 GGATGCCAGGGGCAGGGGGAGGG - Intergenic
994531435 5:100977764-100977786 GTGGGGGAGGGGGAGGGGGAAGG - Intergenic
994988996 5:106974658-106974680 TTCTGCAAGGAGAGGGGGGATGG + Intergenic
995106264 5:108381084-108381106 GTGTGCAAGCGGAAGGGGGCCGG - Exonic
996012450 5:118495882-118495904 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
996256273 5:121408039-121408061 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
996423287 5:123285703-123285725 GGGGGGAAGGGGAAGGGGAAGGG - Intergenic
996778706 5:127160312-127160334 GTTTGGGAGGGGAATGGGGATGG - Intergenic
996909866 5:128643450-128643472 GTGTGCGTGGGGCTGGGGGAGGG + Intronic
997291866 5:132742913-132742935 GGGTGGAAGGGAAAGAGGGAGGG - Intergenic
997813777 5:136996873-136996895 GTGTGGAAGGGGAACCGAGAGGG - Intronic
998025481 5:138811942-138811964 GAGAGGGAGGGGAAGGGGGAGGG + Intronic
998147013 5:139734729-139734751 GTGGGCAAGGGTGAGGGAGAAGG - Intergenic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998392398 5:141795674-141795696 GTGGACAAGGGGCAGGGGCAGGG + Intergenic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999700806 5:154225982-154226004 GTGGGGTAGGGGAAGGGGGGAGG + Intronic
999721514 5:154402228-154402250 GGGAGAAAGGGGAAGAGGGATGG - Intronic
1000833223 5:166128523-166128545 GCGTGCAAGGGGAAAGGCTAGGG + Intergenic
1001437530 5:171711894-171711916 GTTTGCAAAGAGAAGGGAGACGG + Intergenic
1001543977 5:172558703-172558725 GTGTGGAAGGGGAACTGGGTGGG - Intergenic
1001696451 5:173673817-173673839 GTGTGGAAGGGCATGAGGGAGGG + Intergenic
1001959264 5:175870642-175870664 GAGTGCAAGGGGAAGAGGAAAGG + Intronic
1002058281 5:176610737-176610759 GTATCCAGGGGGAGGGGGGAGGG - Intergenic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002426575 5:179180306-179180328 GGCTGCAAGAGGAAGTGGGACGG + Intronic
1002493893 5:179599071-179599093 GTGTGCAAGGGGCCTGGGGAGGG + Intronic
1002686740 5:181017818-181017840 GGGTGGAGGGGGAAAGGGGAGGG + Intergenic
1003060405 6:2858268-2858290 GGGTGGAAGGGGGAGGGGGAGGG - Intergenic
1003102155 6:3184975-3184997 ATGTGCAGGGGTATGGGGGAAGG + Intergenic
1003230896 6:4252819-4252841 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1003234340 6:4282349-4282371 GTATGCAAGGTGTGGGGGGAGGG + Intergenic
1003381920 6:5632577-5632599 GCGGGAAGGGGGAAGGGGGAAGG - Intronic
1003649226 6:7943325-7943347 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1004114029 6:12749541-12749563 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
1004293253 6:14387424-14387446 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1004808681 6:19234165-19234187 ATCTGCAGAGGGAAGGGGGAAGG + Intergenic
1004845177 6:19633896-19633918 GTGTGGAAAGGGAGGTGGGATGG + Intergenic
1004921634 6:20381457-20381479 GTGGGCAAGGGGATGGGGAATGG + Intergenic
1004925425 6:20411443-20411465 GAGGGCAAGGCGAAGGGGAAGGG - Intronic
1004980907 6:21022603-21022625 GTGTGAGGAGGGAAGGGGGATGG + Intronic
1005399240 6:25414760-25414782 ATGTGGAAGGGGATGGGGGTTGG - Intronic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1005496338 6:26391339-26391361 GTCTGCCAGGGGAAGGGGTTTGG + Intronic
1005677497 6:28170181-28170203 GAGTGCAAGGCCAAGGAGGATGG - Intergenic
1005773542 6:29103146-29103168 GTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1005986242 6:30877423-30877445 GTGTGTATGGGGGATGGGGATGG + Intronic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006152189 6:31995545-31995567 GGGTGCAAGGGCAAGCAGGAGGG + Intronic
1006158491 6:32028283-32028305 GGGTGCAAGGGCAAGCAGGAGGG + Intronic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006445397 6:34076976-34076998 GGGAGCAAGGGCAAGGGGCAGGG + Intronic
1006567608 6:34973841-34973863 GAGGGCAAGGGGAAGGGGAAGGG - Intronic
1006567656 6:34973948-34973970 GAAGGCAAGGGGAAGGGGAAGGG - Intronic
1006567750 6:34974177-34974199 GAAGGGAAGGGGAAGGGGGAAGG - Intronic
1006567832 6:34974383-34974405 GAATGGAAGGGGAAGGGGAAGGG - Intronic
1006984063 6:38166241-38166263 GTGCGCAGGGGGGAGGTGGAGGG - Intergenic
1006984156 6:38166548-38166570 GTGCGGAGGGGGAAGGTGGAGGG - Intergenic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007114859 6:39336256-39336278 GAGTGCTAGGGGCAGGGTGAAGG - Exonic
1007155836 6:39742404-39742426 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1007231067 6:40348020-40348042 GTGTGCTGGGGGAAGGGGCAGGG + Intergenic
1007335659 6:41153545-41153567 GTGTGGAAGGGGGAAAGGGATGG + Intronic
1007373955 6:41443757-41443779 GTGTGCGAGGGGATGGGGGAAGG + Intergenic
1007590159 6:43016232-43016254 GTGTGCAATGCAAAGGGGAAGGG - Intronic
1007943837 6:45807527-45807549 GTGTTCAAAGGGAAGGTTGAGGG - Intergenic
1008375828 6:50790331-50790353 GTGTGAGAGGGGAAGGAGGTGGG - Intergenic
1008400565 6:51058004-51058026 GTGTGGTGGGGGGAGGGGGAAGG - Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1010024417 6:71199124-71199146 GTGTGAATGTGGAAGGGGCAGGG + Intergenic
1010251096 6:73708140-73708162 GTGGGATGGGGGAAGGGGGAAGG - Intronic
1010449526 6:75987445-75987467 GGGGGCAGGGGGGAGGGGGAGGG - Intronic
1010463284 6:76138041-76138063 GTGAGGTAGGGGAAGGGGGGAGG - Intergenic
1010503880 6:76632564-76632586 GGCTGCTAGGGGATGGGGGAAGG + Intergenic
1010529706 6:76952664-76952686 GTGTAAAAGGGGATGTGGGATGG + Intergenic
1010550590 6:77217572-77217594 GACTGAAAGTGGAAGGGGGATGG + Intergenic
1010887421 6:81261880-81261902 GAGGGGAAGAGGAAGGGGGAGGG + Intergenic
1011096339 6:83668679-83668701 GTGGTGTAGGGGAAGGGGGAGGG + Intronic
1011206569 6:84905528-84905550 GTTAGCAAGGGCAATGGGGAAGG + Intergenic
1011365432 6:86576576-86576598 GTAGGGAAGGGGAAGGGGGCAGG - Intergenic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1011734343 6:90296636-90296658 GAGTGCGCCGGGAAGGGGGAGGG + Exonic
1011959559 6:93070248-93070270 GTGGGGAAGGGGAAAGGGAAAGG + Intergenic
1012236253 6:96819517-96819539 GGGTGCAGGGGGACAGGGGAGGG + Intronic
1012289691 6:97437480-97437502 GTGTGCATGATGAAGGAGGAAGG - Intergenic
1012790101 6:103682408-103682430 GTGTGTAGGGGGGTGGGGGAAGG - Intergenic
1013231953 6:108167800-108167822 GAGTGAAAGGGGGAGGGGGAGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013647147 6:112156233-112156255 GTGTGAAAGGGCAGGGGTGAGGG - Intronic
1013744841 6:113333567-113333589 GTGTGCATGGGGAAACTGGAAGG + Intergenic
1013759762 6:113503578-113503600 GTGTGTGAGTTGAAGGGGGAGGG + Intergenic
1013869784 6:114743156-114743178 GTGTGGAGGGGGAGTGGGGAGGG - Intergenic
1014146397 6:118002450-118002472 GTGGGGTAGGGGGAGGGGGAGGG + Intronic
1014290378 6:119551329-119551351 GTGAGCAAGGGGAGGATGGAAGG - Intergenic
1014422866 6:121266911-121266933 GTGGGGAAGGGGCAAGGGGAGGG + Intronic
1015366837 6:132405056-132405078 GACTGCAAGGGGTTGGGGGAAGG + Intergenic
1015616955 6:135087509-135087531 GTTGGGAAGGGGAAGGGGAAGGG - Intronic
1015675765 6:135746497-135746519 GTGGGTCGGGGGAAGGGGGAGGG + Intergenic
1016851602 6:148624823-148624845 GGGTGCCAGGGGCAGGTGGAGGG + Intergenic
1017067594 6:150543548-150543570 GTGTGAGAGGGGTAGGGGTAAGG - Intergenic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017346702 6:153391388-153391410 GTGGTCAAGGGGAAGGGACATGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1018096684 6:160393431-160393453 GTGTGGTAGGGGGAGGGGGGAGG - Intronic
1018196299 6:161358709-161358731 GGGTGCACTGGGAAGTGGGAGGG - Intronic
1018270732 6:162074479-162074501 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018726727 6:166618423-166618445 GTGTGGAAGGGGTATGGGTAGGG + Intronic
1018876687 6:167827368-167827390 GTGGGCCTGGGGGAGGGGGAGGG - Intronic
1018893440 6:167997599-167997621 GTGAGGAAGGGGCAGGGGCAGGG - Intronic
1018976163 6:168568688-168568710 GTTTCCAAGGGTGAGGGGGAAGG - Intronic
1019478689 7:1256165-1256187 GTGTGCGTGGGGAAGGCGGGAGG - Intergenic
1019563973 7:1670675-1670697 GTGCGGACGGCGAAGGGGGACGG - Intergenic
1019566095 7:1679746-1679768 GTGGCCAGGGGGCAGGGGGAAGG - Intergenic
1019750370 7:2725345-2725367 CTGCGCGAGGGGAAGGGCGAAGG + Intronic
1020004018 7:4772163-4772185 GTGTGCCAGGGGCAGGGGGTTGG - Intronic
1020258554 7:6516920-6516942 GTGTACAAGGCAAAGGGGCAGGG - Intronic
1020418147 7:7969233-7969255 GTGTGTAAGGGGGAGGGGCGGGG - Exonic
1021303852 7:19006725-19006747 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1021782900 7:24123066-24123088 GCGTGTAAGAGGAAGGGAGATGG + Intergenic
1022070447 7:26908512-26908534 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
1022509677 7:30927123-30927145 GTGGGCATGGGGAGGGGGAAGGG + Intergenic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1022937753 7:35197779-35197801 GTGTGCTGGGGGTGGGGGGAAGG - Intergenic
1023077468 7:36498366-36498388 TTGAGCCAGGGGATGGGGGATGG + Intergenic
1023109746 7:36797248-36797270 GTGTGCTTGGTGAAGGGGGCAGG - Intergenic
1023332452 7:39132758-39132780 GCGAGGAAGGGGAAGGGGAAAGG + Intronic
1023666150 7:42525348-42525370 GGGAGAAAGGGGAAGAGGGAGGG + Intergenic
1023926754 7:44675076-44675098 GTGTCCTGGGGGGAGGGGGAGGG + Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024482650 7:49880681-49880703 GTGGGATGGGGGAAGGGGGAAGG + Intronic
1024616338 7:51117074-51117096 TTGTGCAGGGGGAGGGGGGAGGG - Intronic
1024742533 7:52370630-52370652 GTGAGAAAAGGGAAGGGTGAAGG + Intergenic
1024866698 7:53911542-53911564 GTGTGCATGTGGATGGGGGCGGG - Intergenic
1024977326 7:55125945-55125967 GAGTGTGAGGGGAAGTGGGATGG - Intronic
1025108988 7:56196896-56196918 GAGGGGAAGGGAAAGGGGGAGGG - Intergenic
1025134708 7:56401299-56401321 GTGGGGTTGGGGAAGGGGGAGGG + Intergenic
1025597457 7:62949256-62949278 GTGGGGTAGGGGAAGGGGGCAGG - Intergenic
1025777355 7:64570509-64570531 AGGGGCAAGGGGGAGGGGGAAGG + Intergenic
1026308739 7:69166085-69166107 GTGGGGGAGGGGAGGGGGGAGGG + Intergenic
1026761274 7:73127597-73127619 GAGAGGAAGGGGAAGGGGAAGGG + Intergenic
1026762540 7:73137707-73137729 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
1027039003 7:74947483-74947505 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
1027084684 7:75254993-75255015 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1027085947 7:75265057-75265079 GAGAGGAAGGGGAAGGGGAAGGG - Intergenic
1027196294 7:76032832-76032854 TTGGGCAAGAGGAAGAGGGAGGG + Intronic
1027241193 7:76330357-76330379 GTGGGCTGGGGGAAGGGGGCTGG + Intronic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1027253496 7:76414664-76414686 GAGGGGAAGGGGAAGGGGAAAGG - Intronic
1027276357 7:76561341-76561363 GTGGGGTAGGGGAAGGGGGGAGG - Intergenic
1027564948 7:79780072-79780094 GTGGAGTAGGGGAAGGGGGAAGG - Intergenic
1027581000 7:79995662-79995684 GTGTGGTAGGGGGAGAGGGAAGG - Intergenic
1027935005 7:84590590-84590612 GTGGGGTAGGGGAAGGGGGAGGG - Intergenic
1028124625 7:87097746-87097768 GTGGGGTAGGGGTAGGGGGAGGG + Intergenic
1028720973 7:94031162-94031184 GTGTGCAACTGGAAGGATGAAGG - Intergenic
1028849467 7:95520640-95520662 GTGTGGATGGGGATGGGGGGTGG - Intronic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1028950205 7:96626147-96626169 GTTTGGAAGGGGAGGTGGGATGG - Intronic
1029029603 7:97453898-97453920 GGGGGAAAGGGGAAAGGGGAGGG - Intergenic
1029241220 7:99164487-99164509 GTGGGGTAGGGGTAGGGGGAGGG + Intergenic
1029269285 7:99367036-99367058 GTGTGCAAGGGGGCGGGAAAGGG + Intronic
1029456886 7:100676071-100676093 GTAAGCAAGGGGAGGGGGAAGGG - Intronic
1030322142 7:108180264-108180286 GTGGTCAATGGGAAAGGGGAGGG - Exonic
1030433988 7:109491414-109491436 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1031049662 7:116932184-116932206 GTGCACAAGAGTAAGGGGGAAGG - Intergenic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031693444 7:124818730-124818752 GTGGGGAACTGGAAGGGGGATGG - Intergenic
1032083989 7:128874210-128874232 GAGGGCAAGCGGAAGGGGCAGGG - Intronic
1032290779 7:130588645-130588667 GTGGGGCAGGGGGAGGGGGAAGG + Intronic
1032540352 7:132697707-132697729 ATGTGCAAGGAGAAGGGAAAGGG + Intronic
1033066814 7:138163927-138163949 GTGTGCATTGGGAAGTGGGATGG + Intergenic
1033129772 7:138735703-138735725 GTGAGCAAGGGGAATGCCGAGGG - Intronic
1033215108 7:139487686-139487708 GAGGTGAAGGGGAAGGGGGAGGG + Intergenic
1033267647 7:139899788-139899810 GTGTGCAAGGGAAAGCAGGCAGG - Intronic
1033636242 7:143213894-143213916 GTTTGCAGGGGGTAGGAGGAAGG - Intergenic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1033983968 7:147200063-147200085 GTGAGAAAGGAGGAGGGGGAGGG - Intronic
1034412091 7:150947117-150947139 GTGGGGAAGGGGAAGGGGAGGGG + Intronic
1034430135 7:151037107-151037129 GGGTGCCAGGGGCTGGGGGAGGG - Intronic
1034439050 7:151077287-151077309 GTGAGCAAGGGGCAGGCGGCAGG - Intronic
1034875937 7:154724750-154724772 GGGTGCCAGGGGCTGGGGGAGGG + Intronic
1035685256 8:1519606-1519628 GTGTCCATGGGGAAGGTGCATGG - Intronic
1036081120 8:5557085-5557107 GTGGGTGGGGGGAAGGGGGAGGG - Intergenic
1036622964 8:10438864-10438886 GTGCGACAGGGTAAGGGGGAAGG - Intergenic
1037169396 8:15873868-15873890 GTAGGAAGGGGGAAGGGGGAGGG - Intergenic
1037386409 8:18347422-18347444 GTGTGCAGGTGGAGGGGAGATGG + Intergenic
1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG + Intergenic
1037588522 8:20294650-20294672 CAGTGCAAGGGGAGGAGGGAGGG - Intronic
1037735882 8:21565633-21565655 GTGTGCACAGGGAAAGTGGAGGG - Intergenic
1037806234 8:22059149-22059171 GGGTGAAAGGGAAAGAGGGAGGG + Intronic
1037881122 8:22573969-22573991 GTGTGCAGGGAAAAGGGGCAGGG + Intronic
1037886652 8:22599391-22599413 AGGGGCGAGGGGAAGGGGGAGGG - Intronic
1038147570 8:24913139-24913161 GAATGCAAGGGGAAGGAGGGAGG + Exonic
1038166305 8:25088068-25088090 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1038576895 8:28712280-28712302 GAGAGCAAGGGGAAGAGCGATGG + Intronic
1039125826 8:34200605-34200627 GTGGGGTAGGGGGAGGGGGAGGG - Intergenic
1039742687 8:40396772-40396794 GAGTGGAAGGGGTAGGGAGAGGG + Intergenic
1039834596 8:41246497-41246519 GTCCCCAAGGGGAAGGGAGAGGG + Intergenic
1040607997 8:48954044-48954066 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1040856183 8:51950406-51950428 GGTTGCCAGGGGATGGGGGAAGG + Intergenic
1041230731 8:55748540-55748562 GTGTGCAAGGGAGAGAGGGAGGG + Intronic
1041251773 8:55941175-55941197 GTGTGCAAGGTGGAGTGGGGTGG - Intronic
1041374022 8:57193747-57193769 TTGGGCAGGGGGAAGGGCGAGGG + Intergenic
1041729311 8:61048818-61048840 GTGAGGGAGGGGAAGAGGGAAGG - Intergenic
1041860567 8:62508350-62508372 ATGTCCAAGGTGGAGGGGGAGGG - Intronic
1041924398 8:63221581-63221603 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1042020549 8:64369305-64369327 GGGAGAAAGGGGAGGGGGGAGGG + Intergenic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1042549201 8:69979027-69979049 GTGGGCAAGGGGAATAGAGAAGG - Intergenic
1042684392 8:71421879-71421901 GTGTGCAAAGGGAGGGGGACAGG + Intronic
1042817925 8:72898291-72898313 GTGGGGTAGGGGAAGGGGGGAGG + Intronic
1043147873 8:76679034-76679056 GTGTGCATGGGGAAGGGGAGTGG - Intergenic
1043178205 8:77048142-77048164 GGGAGAAAGGGGAGGGGGGAGGG + Intergenic
1043333250 8:79142832-79142854 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1043511608 8:80955526-80955548 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1043817544 8:84820694-84820716 GGGGGCAAGGGGAAAGGGGAGGG - Intronic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1043938281 8:86167967-86167989 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044115545 8:88328848-88328870 GGCTGAAAGAGGAAGGGGGAAGG + Intergenic
1045231868 8:100313512-100313534 GTGGGCCAGGGGACGGGGGGTGG + Intronic
1045284880 8:100781893-100781915 GGGTGCATGGGGAAGGGAGAGGG - Intergenic
1045319333 8:101069920-101069942 GTGTGCGAGGGGGTGGGGGAAGG + Intergenic
1045757077 8:105556670-105556692 GGGGGAAAAGGGAAGGGGGAAGG - Intronic
1045816257 8:106280558-106280580 GTTTGCAAGGGGATGGGTGATGG + Intronic
1045947794 8:107816449-107816471 GTGGGGTAGGGGAGGGGGGAGGG - Intergenic
1045977542 8:108146751-108146773 GAGTGCAAGGGGTAAGAGGAAGG - Intergenic
1046246862 8:111575286-111575308 GTGGGGTAGGGGTAGGGGGAGGG - Intergenic
1046323708 8:112612926-112612948 GAGTGCAGCGGGGAGGGGGATGG + Intronic
1046469562 8:114653174-114653196 GTGGGCTGGGGGGAGGGGGAAGG - Intergenic
1047907006 8:129483142-129483164 GAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1047907034 8:129483206-129483228 GGGAGAAGGGGGAAGGGGGAAGG + Intergenic
1047936722 8:129788110-129788132 GTGTGCAGGGGTAGGGGGAATGG - Intergenic
1048628166 8:136210019-136210041 TGGTGCAAGGAGAAGGGGGTTGG - Intergenic
1048727023 8:137398168-137398190 GGTGGCAAGGGGGAGGGGGAGGG + Intergenic
1048927603 8:139284624-139284646 GTGGGCAGGGGGAAGGTTGACGG - Intergenic
1049093182 8:140532326-140532348 TTCTGGAAGGGGAAGGGGCAGGG - Intronic
1049236373 8:141514413-141514435 GGGTGCAATGGGAAGGGTTAAGG + Intergenic
1049291460 8:141805140-141805162 GTATCCTAGGGGAAGGAGGATGG + Intergenic
1049359557 8:142205810-142205832 GGATGTGAGGGGAAGGGGGAAGG + Intergenic
1049404179 8:142444299-142444321 GAGAGGAAGGGGATGGGGGATGG + Intergenic
1049446097 8:142632324-142632346 GTGGGCAAGGGGCAGGTGGCAGG + Intergenic
1049526002 8:143127316-143127338 GAGTGGTAGGGGATGGGGGAAGG + Intergenic
1049698753 8:143996974-143996996 GGGGGCAGCGGGAAGGGGGAGGG + Intronic
1049976176 9:862503-862525 CCGTGCAATGGGGAGGGGGAGGG + Intronic
1050107946 9:2185186-2185208 GGGTGCCAGGGGCTGGGGGAAGG - Intronic
1050497324 9:6258169-6258191 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1050904302 9:10984816-10984838 GTGTGGAAGGCAAATGGGGATGG - Intergenic
1050905121 9:10993981-10994003 GTGTGGAAGGGAAACGGGGGGGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG + Intergenic
1052081790 9:24214934-24214956 GTGGGGAGGGGGAAGGGGGGAGG + Intergenic
1052951812 9:34219726-34219748 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1052951856 9:34219822-34219844 GAGGGGAAGGGGAAGGGAGAGGG - Intronic
1052995915 9:34551629-34551651 GGGTGCTGGGGGGAGGGGGATGG + Exonic
1053313958 9:37036650-37036672 GTGGGCAAGGGGACGGCGGCTGG - Intergenic
1053364421 9:37512443-37512465 TTGTTCGAGGGGGAGGGGGAGGG + Exonic
1053489132 9:38486888-38486910 GGGTGCGGGGGGAAGGGGAAGGG - Intergenic
1053699543 9:40675859-40675881 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054310832 9:63475260-63475282 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054406486 9:64767392-64767414 GTGAGCAAGGGAGAGGAGGAGGG - Intergenic
1054409621 9:64799411-64799433 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054450663 9:65401992-65402014 GGGAGGGAGGGGAAGGGGGAGGG + Intergenic
1054708615 9:68488239-68488261 GTGTGCTGGGGGATGGGAGAGGG - Intronic
1054766374 9:69045830-69045852 GTGTGCAAGGGCAAGTGGGGGGG + Intronic
1055037646 9:71835586-71835608 GTGGGCAGGGGGATAGGGGATGG - Intergenic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055950263 9:81723846-81723868 GTGTGGAATGGGCAGGGTGAGGG - Intergenic
1056026354 9:82499831-82499853 GTGTGCAAGGAAAATAGGGAAGG + Intergenic
1056235721 9:84592069-84592091 GTGTGCTGGGGGTAGGGAGAAGG + Intergenic
1056925218 9:90828709-90828731 GTGTGCTCAGAGAAGGGGGAAGG - Intronic
1057117709 9:92541401-92541423 GTGGGGAGGGGGAAGGGGGGTGG - Intronic
1057307030 9:93918424-93918446 GACTGCATGGGGATGGGGGATGG - Intergenic
1057545773 9:96019853-96019875 GTGAGAGAGAGGAAGGGGGACGG + Intergenic
1057550361 9:96047632-96047654 TTTTGCAGGGGGAAGGGTGAGGG - Intergenic
1057669482 9:97076202-97076224 GGGTGCGGGGGGAAGGGGAAGGG - Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058139511 9:101342527-101342549 GAGTGGGAGGGGGAGGGGGAAGG + Intergenic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058228323 9:102394252-102394274 GTGGGGTAGGGGGAGGGGGAAGG + Intergenic
1058235816 9:102487842-102487864 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1058698037 9:107576317-107576339 AGGTGCATGGGGAAGGGGGTAGG + Intergenic
1058699270 9:107587539-107587561 GTCTGCCTGGGGAAGGGAGAAGG - Intergenic
1058939184 9:109797628-109797650 GTGTGCAACGGGGAGGGTGACGG - Intronic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1060158638 9:121338935-121338957 GTGGGCCAGGGGAAGGGGACAGG - Intergenic
1060190322 9:121588535-121588557 GGGGGAAAGGGGAAGGGTGAAGG + Intronic
1060190330 9:121588549-121588571 GGGTGAAGGGGGAAGGGGGAAGG + Intronic
1060967669 9:127720871-127720893 GGGAGGAAGGGGAAGGGGGAGGG - Intronic
1061199356 9:129127712-129127734 GTGGGAAAGGTGTAGGGGGATGG + Intronic
1061250165 9:129421796-129421818 GAGAGCAAGGGGCAGGGGGTGGG + Intergenic
1061251473 9:129428871-129428893 GGGTGGAAGGGGAAGGAGGGTGG - Intergenic
1061259030 9:129469530-129469552 AATTGCATGGGGAAGGGGGAGGG - Intergenic
1061294567 9:129669998-129670020 GGGTGCCAGGGGCTGGGGGAGGG - Intronic
1061360411 9:130138436-130138458 GAGGGGATGGGGAAGGGGGAAGG - Exonic
1061360433 9:130138486-130138508 GAGCGGAAGGGGAAGGGGGAGGG - Exonic
1061632761 9:131883534-131883556 GTGGGGAAGGGGCAGGGTGAGGG + Intronic
1061695321 9:132369068-132369090 GCGGGGAAGGGGAAGGGGAAGGG - Intergenic
1061741629 9:132710840-132710862 GAAGGGAAGGGGAAGGGGGAAGG - Intergenic
1061901097 9:133672503-133672525 GTCTGCGAGGAGCAGGGGGAAGG + Intronic
1061940252 9:133880155-133880177 GTGGGCAAGGGGCTGGTGGAGGG - Intronic
1062023633 9:134330535-134330557 GTGGGCAAGGTGCAGGGGGGAGG - Intronic
1062084223 9:134640734-134640756 TTGTTCAAAGGGAATGGGGATGG + Intergenic
1062123625 9:134847875-134847897 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1062143715 9:134976690-134976712 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1062215299 9:135385890-135385912 GTGGGCACGGGGAGGGTGGAGGG - Intergenic
1062240723 9:135536377-135536399 GACTGCAAGGAGAAGGGGGCGGG - Intergenic
1062298678 9:135850848-135850870 GTTTGTAAAGGGCAGGGGGAAGG + Intronic
1203571638 Un_KI270744v1:137932-137954 GTGGGCAAGGGGAGGTGGGAGGG + Intergenic
1185550526 X:980193-980215 GGCTGCAAGGGGGAGGAGGAGGG + Intergenic
1185566844 X:1101396-1101418 GTGTGAATGGGGAAGGGCCATGG + Intergenic
1185566875 X:1101596-1101618 GTGTGAATGGGGAAGGGCCATGG + Intergenic
1185566928 X:1101956-1101978 GTGTGAATGGGGAAGGGCCATGG + Intergenic
1185566978 X:1102236-1102258 GTGTGAATGGGGAAGGGCCATGG + Intergenic
1185567022 X:1102516-1102538 GTGTGAATGGGGAAGGGCCATGG + Intergenic
1185567037 X:1102636-1102658 GTGTGAATGGGGAAGGGCCATGG + Intergenic
1185581350 X:1213202-1213224 GGGAGGAAAGGGAAGGGGGAGGG - Intergenic
1185906491 X:3938739-3938761 GTGTGCAAGGGCAAGTGTAAAGG + Intergenic
1186055232 X:5643012-5643034 GGTTGCCAGGGGAAAGGGGAAGG + Intergenic
1186647254 X:11520303-11520325 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1187093816 X:16125771-16125793 ATGTGCAAGCCGAAGGGGAATGG - Intronic
1187323011 X:18257952-18257974 GAGAGGAAAGGGAAGGGGGAAGG + Intronic
1187527390 X:20066386-20066408 GTGGGAATGAGGAAGGGGGATGG + Intronic
1187769883 X:22683146-22683168 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1187805030 X:23110432-23110454 TTGTGGGAGGGAAAGGGGGAGGG - Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1187948644 X:24450801-24450823 GGGAGGAAGGGAAAGGGGGAGGG + Intergenic
1188243352 X:27814193-27814215 GGGTGTGAGGGGCAGGGGGAGGG - Intronic
1188316023 X:28674353-28674375 GAGTGCATAGGGAAGGGGGGTGG - Intronic
1188335065 X:28921510-28921532 GGGAGGAAGGGGAAGAGGGAGGG - Intronic
1188668251 X:32851689-32851711 CTCTGCCAGGGGATGGGGGAGGG - Intronic
1188734594 X:33696748-33696770 GGGTGCAAGGGGAAGGGGAGGGG + Intergenic
1188894219 X:35646240-35646262 GTCTTCAAGGAGAAGGGAGAAGG + Intergenic
1189117022 X:38353386-38353408 GTGGGGAAGGGAAAGGGGAAGGG + Intronic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1189208271 X:39260668-39260690 AGGTGTAAGGGGAAGGGGCATGG - Intergenic
1189331223 X:40146089-40146111 GTGTGCTAGGGGAAGAGGAAGGG - Intronic
1189498264 X:41529334-41529356 CTGTGCAAGGGCAAGGAGAAAGG + Intronic
1190298192 X:49040744-49040766 GTGGGGAAGGGAAAGGGGGATGG - Intronic
1190403809 X:50066011-50066033 GTGGGGAGGGGGGAGGGGGAAGG + Intronic
1190522313 X:51292952-51292974 GTGTGCATGAGAAACGGGGAGGG + Intergenic
1190525537 X:51326095-51326117 GTGTGCATGAGAAACGGGGAGGG + Intergenic
1190543943 X:51505535-51505557 GTGTGCATGAGAAACGGGGAGGG - Intergenic
1190595472 X:52049158-52049180 GTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1190613352 X:52204915-52204937 GTGGGTAGGGGGAGGGGGGAGGG - Intergenic
1190722091 X:53157833-53157855 GTTTTCAAGGGGATGGGGGTGGG - Intergenic
1190741070 X:53289152-53289174 GTGTGGAGGGGGAAGGGCTAGGG - Intronic
1190910168 X:54764401-54764423 GTGGGGAGGGGGAAGGGGGGAGG - Intronic
1191701138 X:64044054-64044076 GAGTGGGAGGCGAAGGGGGAAGG + Intergenic
1191767347 X:64712674-64712696 GTGGGGCAGGGGGAGGGGGAAGG - Intergenic
1191779537 X:64850597-64850619 GTGTGCAAGGGGAAAGGCTTGGG - Intergenic
1191932369 X:66388298-66388320 GGGGGAAGGGGGAAGGGGGAAGG - Intergenic
1191932373 X:66388305-66388327 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1192537778 X:71943044-71943066 GTGTGAAAATGGAAGAGGGAGGG - Intergenic
1192906931 X:75561412-75561434 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1193326786 X:80187686-80187708 GTGGGGTAGGGGAAGGGGGGAGG - Intergenic
1194337227 X:92663052-92663074 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1194427848 X:93762165-93762187 GTGGGCAGGGGGCAGGGGGGTGG - Intergenic
1194517112 X:94868237-94868259 GTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1194587611 X:95755483-95755505 GCCTGCAGGGGGAAGGTGGATGG - Intergenic
1195116514 X:101704401-101704423 GTGTGTATGTGGAATGGGGATGG - Intergenic
1195166270 X:102223623-102223645 TTGGGCAAGGGGTAGGGAGAAGG + Intronic
1195192590 X:102463465-102463487 TTGGGCAAGGGGTAGGGAGAAGG - Intronic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195758855 X:108225045-108225067 GGGGGCGGGGGGAAGGGGGAAGG + Intronic
1195917596 X:109951068-109951090 GGGGGCAAGGGGGAGTGGGATGG + Intergenic
1196029953 X:111086103-111086125 GTGTGCACTGGGCAGGGGGGCGG + Intronic
1196624029 X:117857248-117857270 GTCAGGAAGGGAAAGGGGGAAGG + Intergenic
1196632100 X:117953403-117953425 GTGGGGTGGGGGAAGGGGGAAGG + Intronic
1197013836 X:121599945-121599967 GTGTGCTTGAGGATGGGGGATGG - Intergenic
1197059511 X:122160719-122160741 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1197107036 X:122729092-122729114 GTGGGGTAGGGGCAGGGGGAGGG + Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197706778 X:129639898-129639920 GAGTGCAGGGGGATGGAGGAGGG - Intergenic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1197847867 X:130822626-130822648 GTGGGGTAGGGGGAGGGGGAAGG + Intronic
1197892185 X:131278800-131278822 GGGTTCAAGGGCAAGGAGGAGGG - Intronic
1197904817 X:131413367-131413389 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1197983572 X:132244177-132244199 GTGAGGTAGGGGGAGGGGGAGGG - Intergenic
1198517826 X:137427060-137427082 GGGAGGAAGGGGATGGGGGAGGG + Intergenic
1198563215 X:137874743-137874765 GTTTGCTAGGGGCTGGGGGAAGG + Intergenic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1198997151 X:142586048-142586070 GGGGGGAAGGGGGAGGGGGAAGG + Intergenic
1200120206 X:153786564-153786586 GGGTGCCAGGGGTTGGGGGAAGG + Intronic
1200213349 X:154356644-154356666 GGGGGATAGGGGAAGGGGGAAGG + Intronic
1201328985 Y:12798069-12798091 GAGAGGGAGGGGAAGGGGGAGGG - Intronic
1201403017 Y:13623505-13623527 GTGTGGCTGGGGAAGGGGGGAGG - Intergenic
1201512221 Y:14777623-14777645 GTGTGAGGGGGGAAGAGGGAGGG + Intronic
1201721065 Y:17097926-17097948 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1201948143 Y:19535185-19535207 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1202628283 Y:56882878-56882900 GTGGGGTAGGGGGAGGGGGAAGG - Intergenic