ID: 948155802

View in Genome Browser
Species Human (GRCh38)
Location 2:235779903-235779925
Sequence CATTCCAAGCACGAGTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948155802_948155804 10 Left 948155802 2:235779903-235779925 CCTCACCACTCGTGCTTGGAATG 0: 1
1: 0
2: 0
3: 9
4: 69
Right 948155804 2:235779936-235779958 AGTTTGTACTTAACAGCAAATGG 0: 1
1: 0
2: 0
3: 18
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948155802 Original CRISPR CATTCCAAGCACGAGTGGTG AGG (reversed) Intronic
903502416 1:23808458-23808480 CATTCCCAGTTGGAGTGGTGAGG - Intronic
903711288 1:25326650-25326672 CATTCCAAGCAAGAGGAGGGGGG + Intronic
903715660 1:25364779-25364801 CATTCCAAGCAAGAGGAGGGGGG - Intronic
904782897 1:32964252-32964274 CAGTCCCGGCACGAGCGGTGCGG + Exonic
914255412 1:145958074-145958096 CATGCCAATCACCAGTGATGGGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
921945448 1:220883094-220883116 CAGTCAAAGCTCGGGTGGTGGGG - Intronic
1063905171 10:10774197-10774219 AATTCCAAACACGAGAGATGGGG + Intergenic
1070312416 10:75283401-75283423 CATTTCCTGCAAGAGTGGTGGGG + Intergenic
1072254594 10:93609313-93609335 CATTACAAGCACTTGTGGTGTGG - Intergenic
1072349998 10:94547452-94547474 CATTCCAAAAACGAGTAATGAGG + Intronic
1072948018 10:99827975-99827997 CATTCCAGGCAGGTGTGGAGGGG - Intronic
1073498141 10:103912600-103912622 CACTCCAAGGCTGAGTGGTGGGG - Intronic
1075484866 10:122813977-122813999 CAGGCCAAGCAGGAGAGGTGCGG - Intergenic
1075484885 10:122814057-122814079 CAGGCCAAGCAGGAGAGGTGCGG - Intergenic
1075484904 10:122814137-122814159 CAGGCCAAGCAGGAGAGGTGCGG - Intergenic
1084461206 11:69297663-69297685 CATTCCAAGCAAGGGAGGAGAGG + Intronic
1085163706 11:74375237-74375259 CATTCCAAACACGGTTTGTGAGG + Intronic
1090009746 11:123035683-123035705 CATTCCCACCAAGAGTGGAGAGG - Intergenic
1094703818 12:32896418-32896440 CACTCCCAGCACGCGGGGTGAGG + Intronic
1095297756 12:40546388-40546410 CATTTCAGGCACTACTGGTGTGG + Exonic
1095603340 12:44038512-44038534 CAAGCCAGGCACGAGTGGTGAGG - Intronic
1099011706 12:77298910-77298932 CATTCTAAGAACGTTTGGTGAGG - Intergenic
1102483824 12:113242786-113242808 CATTTCAAGCATGAGGGATGAGG - Intronic
1109981152 13:69909644-69909666 CATTCCATGCATGAGTTCTGGGG + Intronic
1111736181 13:92141998-92142020 CATTCCAAGCATGAGATGTGAGG - Intronic
1113428757 13:110231098-110231120 CATTTCCAGCCCGCGTGGTGAGG + Intronic
1116861005 14:49995606-49995628 CACTCCAAGCAAGTGGGGTGGGG + Intronic
1117863206 14:60115025-60115047 CATTCCAAGCACTGTTGGTGTGG + Exonic
1129797184 15:78386730-78386752 CATTCCAAGCACAGGTTATGGGG - Intergenic
1131551451 15:93360638-93360660 CTTTCCAGGCACGAGTGATTTGG + Intergenic
1136170049 16:28483625-28483647 CATTCCAATCACAAGTGCTGAGG - Intronic
1138383239 16:56618005-56618027 CCTTCCCAGCACGAGTGGAGAGG + Intergenic
1138481812 16:57308119-57308141 CATTCCCAGCATGAGAGGAGAGG - Intergenic
1140262860 16:73395755-73395777 TGTTCCAAGCACCTGTGGTGAGG - Intergenic
1144573322 17:16414446-16414468 TATTCCAAGCACCATGGGTGAGG + Intergenic
1148745532 17:49916009-49916031 CATTGCAGGCACGAGTCGAGGGG - Intergenic
1151391056 17:73786843-73786865 ATGTCCAAGCAGGAGTGGTGAGG - Intergenic
1152838098 17:82548145-82548167 AACTACAAGTACGAGTGGTGGGG + Intronic
1154181869 18:12145282-12145304 GATTCCAAGCCCATGTGGTGGGG - Intergenic
1165443062 19:35841905-35841927 GATTCCAAGCATAAGTGGTTGGG - Intronic
930212031 2:48650747-48650769 CATTCCAAATAAGAGTGGAGTGG + Intronic
933894173 2:86795300-86795322 CATTCCAAGTAAGAGTGGTCAGG + Intronic
934463087 2:94232310-94232332 TATTCCAAGCGTTAGTGGTGAGG + Intergenic
936047712 2:109200087-109200109 CCTTCCAAGCCCTAGTGATGTGG + Intronic
938065333 2:128279091-128279113 CAGTGCAAGCAGGACTGGTGCGG - Intronic
939672202 2:145026213-145026235 CATTGCCAGCACGGGTGGTAGGG - Intergenic
941116546 2:161479435-161479457 CAATCCAAGCACGAAAGATGGGG - Intronic
948155802 2:235779903-235779925 CATTCCAAGCACGAGTGGTGAGG - Intronic
1177747110 21:25230131-25230153 CATTCCTACCAAGAGTGTTGAGG - Intergenic
1183356718 22:37363714-37363736 CCCTCCAGGCAGGAGTGGTGGGG + Intergenic
1185077261 22:48690119-48690141 CTTTCCATGCAGGAGGGGTGGGG - Intronic
950756807 3:15180251-15180273 CATTCAAAGAACTAGTGGAGGGG - Intergenic
952425483 3:33170514-33170536 CATTCCAGGCTTAAGTGGTGGGG - Intronic
954852703 3:53617037-53617059 CATTCCAGGCAGGTGTGCTGGGG - Intronic
955103338 3:55873146-55873168 CATTCCATGCAGGAGAGCTGTGG - Intronic
958027690 3:88068025-88068047 CACTCAAAGCACAAGTGGAGGGG + Intronic
969883574 4:10195792-10195814 CATTGCAAGAAAGAGTGGGGCGG + Intergenic
970669513 4:18380039-18380061 CATTTCTAGCAAGAGTAGTGGGG + Intergenic
978501784 4:109417728-109417750 CACTCCAAGCAGGAGAGGAGAGG + Intergenic
982352465 4:154430638-154430660 AATTCTAAGCATGAGTTGTGTGG + Intronic
982353704 4:154444124-154444146 CATTCAACGCACTGGTGGTGGGG + Intronic
986418142 5:7549138-7549160 CATATGAAGCAGGAGTGGTGAGG + Intronic
991354544 5:65754371-65754393 CATTCCAAGCAAGAGTACTGAGG + Intronic
1000636982 5:163655755-163655777 CATTCCAGGCATGCGTAGTGAGG - Intergenic
1007173509 6:39880818-39880840 CATTCAAAGCAAGATTGTTGAGG + Intronic
1010984275 6:82404194-82404216 CCTCCCAAGGACAAGTGGTGGGG + Intergenic
1021203711 7:17754060-17754082 CATTGCCAGCAGCAGTGGTGTGG - Intergenic
1021710610 7:23412512-23412534 CATTCCAGTCATGAGTGATGTGG + Intronic
1027684450 7:81264870-81264892 AATTCAGAGCATGAGTGGTGTGG + Intergenic
1033122460 7:138678185-138678207 AATTCAAAACAGGAGTGGTGGGG - Intronic
1048888104 8:138924724-138924746 CATTCTAAGCACATGGGGTGGGG - Intergenic
1050602987 9:7271631-7271653 CATTGCAAGCAAGAGGGGTGAGG + Intergenic
1054722176 9:68615167-68615189 CTTCCCCAGCACCAGTGGTGTGG - Intergenic
1055696067 9:78885589-78885611 CATTCCAAGTACTAGGGGTTTGG + Intergenic
1057395628 9:94677331-94677353 CATCCCAAACACGAGCAGTGAGG + Intergenic
1061366344 9:130173905-130173927 TGTTCCAAGCATGAGGGGTGAGG - Intronic
1186802812 X:13110611-13110633 CCTTCCAAGCACGGGCGGAGGGG - Intergenic
1194559511 X:95403514-95403536 CATTCCATGCACCACTGGTCGGG - Intergenic