ID: 948158094

View in Genome Browser
Species Human (GRCh38)
Location 2:235800864-235800886
Sequence GAAGTCAGATGGTTTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 361}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948158094_948158103 26 Left 948158094 2:235800864-235800886 CCTGTTTTAAACCATCTGACTTC 0: 1
1: 0
2: 3
3: 34
4: 361
Right 948158103 2:235800913-235800935 GATGCAAAGCTCTAGAGGGGTGG 0: 1
1: 0
2: 1
3: 15
4: 147
948158094_948158100 22 Left 948158094 2:235800864-235800886 CCTGTTTTAAACCATCTGACTTC 0: 1
1: 0
2: 3
3: 34
4: 361
Right 948158100 2:235800909-235800931 CCCAGATGCAAAGCTCTAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 157
948158094_948158102 23 Left 948158094 2:235800864-235800886 CCTGTTTTAAACCATCTGACTTC 0: 1
1: 0
2: 3
3: 34
4: 361
Right 948158102 2:235800910-235800932 CCAGATGCAAAGCTCTAGAGGGG 0: 1
1: 0
2: 0
3: 15
4: 162
948158094_948158104 30 Left 948158094 2:235800864-235800886 CCTGTTTTAAACCATCTGACTTC 0: 1
1: 0
2: 3
3: 34
4: 361
Right 948158104 2:235800917-235800939 CAAAGCTCTAGAGGGGTGGCTGG 0: 1
1: 0
2: 2
3: 5
4: 134
948158094_948158098 21 Left 948158094 2:235800864-235800886 CCTGTTTTAAACCATCTGACTTC 0: 1
1: 0
2: 3
3: 34
4: 361
Right 948158098 2:235800908-235800930 ACCCAGATGCAAAGCTCTAGAGG 0: 1
1: 0
2: 1
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948158094 Original CRISPR GAAGTCAGATGGTTTAAAAC AGG (reversed) Intronic
902423737 1:16302817-16302839 GAGATCTGATGGTTTAAAAGTGG - Intronic
902545684 1:17188800-17188822 GAGATCTGATGGTTTAAAAGTGG - Intergenic
903297932 1:22357393-22357415 GAGATCTGATGGTTTAAAAGCGG - Intergenic
905487934 1:38319222-38319244 GAGATCTGATGGTTTAAAAGTGG - Intergenic
906670659 1:47651957-47651979 GAAGAAAGATGGTTAAGAACTGG - Intergenic
907152618 1:52303236-52303258 GGAGTCAGATCTGTTAAAACAGG + Intronic
907672590 1:56489854-56489876 GAGATCAGATGGTTTTAAAAAGG - Intergenic
908600732 1:65737156-65737178 GAGATCTGATGGTTTAAAATTGG + Intergenic
908922541 1:69212804-69212826 GAAGGCAGATGGGTTAAGAGGGG + Intergenic
909016519 1:70385803-70385825 GAGATCTGATGGTTTAAAAGTGG - Intergenic
909212103 1:72836971-72836993 CAGGTCTGATGGTTTAAAAGTGG + Intergenic
911465621 1:98249424-98249446 GAGATCTGATGGTTTTAAACAGG + Intergenic
912070420 1:105802138-105802160 AAAATCTGATGGTTTAAAAATGG - Intergenic
913008429 1:114658157-114658179 GAAGGAAGAAGGTTTAAAATAGG + Intronic
913031399 1:114907391-114907413 GAAGGCAGAGAGTTTAAAAGAGG - Intronic
915776414 1:158492593-158492615 GTAATTAGATGATTTAAAACTGG + Intergenic
916834318 1:168526987-168527009 AAAGTAAGATGGTGTAAATCTGG + Intergenic
919273861 1:195386032-195386054 GAGATCTGATGGTTTAAAAGTGG + Intergenic
919536299 1:198791801-198791823 AAAGTAAGATGGTTTAAAGGTGG - Intergenic
921531402 1:216286284-216286306 GAAATCTGATGGTTTCAAAAGGG + Intronic
922071736 1:222201393-222201415 GAATTGAGATGATTTAAAGCTGG - Intergenic
922135515 1:222821563-222821585 GAGATCTGATGGTTTAAAAGTGG + Intergenic
923263736 1:232292497-232292519 GAAGTTAGTTCGTTTCAAACTGG - Intergenic
923694815 1:236237662-236237684 AGAGGCAGCTGGTTTAAAACAGG + Intronic
924027900 1:239856391-239856413 GAAATCTGATTGTTTAAAAGTGG + Intronic
924688696 1:246324112-246324134 AAAATTAGATGGTCTAAAACTGG + Intronic
924816921 1:247450897-247450919 GAAGTGAGATGTTTGAAGACAGG + Intergenic
1063828914 10:9930488-9930510 GAAGTGAGAAGTTTTAAAATGGG + Intergenic
1064304637 10:14154062-14154084 AAACACAGATGGTTTAAGACAGG - Intronic
1068120271 10:52777470-52777492 GAAGTCAGGGGGTTAGAAACAGG + Intergenic
1068180327 10:53510031-53510053 GAAGTCAGAGGCTTTCAGACTGG + Intergenic
1068244023 10:54341332-54341354 GAGATCTGATGGTTTAAAAGTGG + Intronic
1070346225 10:75544879-75544901 TAAGTCAGATGTTTTAAAGTAGG + Intronic
1072902556 10:99421458-99421480 GAAGTCAGAAGGGTAAACACTGG - Intronic
1073525159 10:104174398-104174420 GAAATCAGATAGTTTTAAAAAGG - Intronic
1073579778 10:104654830-104654852 GAAGCCTGATGCATTAAAACTGG + Intronic
1073648862 10:105337490-105337512 GAGATCTGATGGTTTAAAAGAGG - Intergenic
1073703281 10:105954481-105954503 GAAGTCAGATGGGCTGGAACAGG + Intergenic
1074093495 10:110286133-110286155 GATATCAGATGGTTAAAAGCTGG - Exonic
1074271788 10:111961195-111961217 GAAGTCAGGTGGGTTAACAAAGG + Intergenic
1074506678 10:114077105-114077127 GAGATCTGATGGTTTTAAACAGG - Intergenic
1075550212 10:123387220-123387242 GAAATCTGATGGTTTTAAATGGG + Intergenic
1078818916 11:14856133-14856155 GAGATCTGATGGTTTAAAAGTGG + Intronic
1079445744 11:20554923-20554945 GAAGTCTGATGGTTTTATAAGGG - Intergenic
1079533039 11:21478170-21478192 GAGATCTGATGGTTTAAAAGTGG - Intronic
1079896581 11:26126829-26126851 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1080367998 11:31599714-31599736 GAGATCTGATGGTTTAAAAGTGG - Intronic
1080532303 11:33188879-33188901 TAAGTGAGATGGTTAGAAACAGG - Intergenic
1081352669 11:42073470-42073492 GAAATCAGATGGATTCAAAGTGG - Intergenic
1084300245 11:68245105-68245127 GAGGTCTGATGGTTTAAAAGTGG + Intergenic
1084361784 11:68673450-68673472 GAGATCAGATGGTTTAATAAAGG - Intergenic
1084723590 11:70925506-70925528 AAAGTCAGATACTTAAAAACTGG + Intronic
1084995969 11:72978665-72978687 GATATCTGATGGTTTAAAAGTGG + Intronic
1086821709 11:91443638-91443660 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1087257628 11:95974243-95974265 GAGATCTGATGGTTTAAAAATGG + Intergenic
1087438439 11:98152024-98152046 GAGATCTGATGGTTTAAAAATGG + Intergenic
1087644055 11:100786967-100786989 GAAGTCTGTTGGTTTAAAAGTGG + Intronic
1087979213 11:104590396-104590418 GAAGTCAAAGGGCTAAAAACTGG + Intergenic
1088121594 11:106376690-106376712 GAAGGGAGATGTTTCAAAACAGG + Intergenic
1088591114 11:111404117-111404139 GAAATCTGATGGTTTTATACAGG + Intronic
1090098719 11:123771366-123771388 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1091002307 11:131920207-131920229 GGAGTCAAATGGTAAAAAACAGG + Intronic
1092625949 12:10328919-10328941 GAAATCAGATGGTTTTATAAGGG - Intergenic
1092656154 12:10687359-10687381 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1092662805 12:10756606-10756628 GAGATCTGATGGTTTAAAAAGGG - Intergenic
1093977910 12:25442986-25443008 GAAGTCAGATATTATAAGACTGG - Intronic
1094704435 12:32900304-32900326 GAAGTGAGGTGGTCTAAAAGTGG - Intergenic
1095750695 12:45707371-45707393 TTATTCATATGGTTTAAAACTGG - Intergenic
1097609231 12:61797613-61797635 GAATTCAGATGGCTGAAAATTGG - Intronic
1097838787 12:64300986-64301008 GAGATCTGATGGTTTAAAAGTGG + Intronic
1098139721 12:67439031-67439053 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1098408525 12:70153350-70153372 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1098715078 12:73820553-73820575 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1098715315 12:73822458-73822480 GAGATATGATGGTTTAAAACGGG - Intergenic
1099229066 12:80002172-80002194 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1099443331 12:82724467-82724489 GAGATCTGATGGTTTAAAAGTGG + Intronic
1099932480 12:89090348-89090370 GAGATCAGATGGTTTTAAAGGGG + Intergenic
1100418524 12:94405189-94405211 GAAGTTAGATCATTTGAAACAGG - Intronic
1100474671 12:94924442-94924464 GAGATCTGATGGTTTAAAAGTGG - Intronic
1100597718 12:96086148-96086170 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1100659685 12:96683518-96683540 GAATTCAGATAGTTATAAACAGG + Intronic
1103391161 12:120574612-120574634 GTAGCCATGTGGTTTAAAACTGG + Intronic
1103734773 12:123053183-123053205 AAATTCAGAGGGTTTAAAAAGGG - Intronic
1103738526 12:123076306-123076328 GCAATCAGATGGGTTACAACTGG - Intronic
1106827354 13:33538507-33538529 GAAGTGAGATTATTTCAAACTGG - Intergenic
1107064663 13:36200275-36200297 GAAGTAGGATAGTTTACAACAGG + Intronic
1107575528 13:41716560-41716582 TAAGTCAGATGTTTTAGAAGGGG - Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1107972894 13:45661219-45661241 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1108753829 13:53476110-53476132 AAAGTCATATTGTTTATAACTGG + Intergenic
1109195299 13:59371923-59371945 GAGGTCGGATGGTTTAAAAGTGG + Intergenic
1109952487 13:69516699-69516721 GAAGTCAGAAGGTTGAAAGAAGG - Intergenic
1110178324 13:72584750-72584772 GAGATCAGATGGTTTAAAAAGGG - Intergenic
1110186861 13:72685155-72685177 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1110966735 13:81709071-81709093 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1111528947 13:89511221-89511243 GAGATCTGATGGTTTAAAAATGG - Intergenic
1111983799 13:95044916-95044938 TAAGAGAGATGTTTTAAAACTGG + Intronic
1112662619 13:101529709-101529731 GATATCTGATGGTTTAAAAGTGG + Intronic
1112923187 13:104640901-104640923 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1113355711 13:109577893-109577915 GAGATCTGATGGTTTAAAACTGG + Intergenic
1114830648 14:26137431-26137453 GAGGTCTGATGGTTTAAAAGTGG + Intergenic
1115367487 14:32574784-32574806 GAATTTAGATGGTTTATAAATGG - Intronic
1115422834 14:33217149-33217171 GAGATCTGATGGTTTAAAAGTGG - Intronic
1116364213 14:44039838-44039860 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1116516111 14:45807838-45807860 GAGATCTGATGGTTTAAAAGCGG + Intergenic
1116789590 14:49326458-49326480 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1119041935 14:71282232-71282254 GAGGTCTGATGGTTTAAAAGTGG + Intergenic
1120150572 14:81028562-81028584 GAACTAAGATGGTTGAAAACTGG - Intronic
1121174411 14:91879945-91879967 GAACTGAGATGGTTTAAAAAAGG + Intronic
1121749199 14:96333779-96333801 GAATTCAGATGGAATTAAACCGG - Exonic
1121943984 14:98101544-98101566 GATGTCTGATGGTTTAATAAGGG + Intergenic
1122442268 14:101740274-101740296 GAGATCTGATGGTTTAAAACTGG - Intergenic
1122877274 14:104674038-104674060 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1125317144 15:38442886-38442908 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1125966031 15:43876292-43876314 GAATTCAGATTCTTTCAAACTGG - Intronic
1126046513 15:44646442-44646464 GAGATCTGATGGTTTAAAAGTGG - Intronic
1128397718 15:67245780-67245802 AAAGTCAGATCGCTTAAAAAAGG + Intronic
1128959386 15:71985441-71985463 GAACTGAGATGATTTTAAACTGG + Intronic
1130068568 15:80627414-80627436 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1133738571 16:8633994-8634016 GTAGTCACCTGGTTTGAAACTGG - Intronic
1135666161 16:24337305-24337327 TAAGTCAGATGGTTGCAATCTGG - Intronic
1138075778 16:54041288-54041310 GAGATCTGATGGTTTAAAAGTGG - Intronic
1138109765 16:54314289-54314311 GAAGTCTGATGGTTTAAAAATGG + Intergenic
1138164332 16:54786180-54786202 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1138557355 16:57779997-57780019 GAGGTCTGATGGTTTAAAAGTGG - Intronic
1139830160 16:69791061-69791083 GAACTAATATGGTTTTAAACTGG + Intronic
1143916712 17:10299044-10299066 GAAGACAGATGCTTTAGAAAAGG - Intronic
1144395276 17:14837253-14837275 GAAGACAACTGGTTTAGAACAGG - Intergenic
1149153020 17:53592682-53592704 TAAGTGAGATGTTTTAATACAGG + Intergenic
1149862950 17:60134287-60134309 GAAATCAGATGGTTTTATAAGGG - Intergenic
1150190969 17:63238865-63238887 TAGATCCGATGGTTTAAAACTGG - Intronic
1152295544 17:79465081-79465103 GAAGTCAGAGGGTTTAACTCGGG - Intronic
1153488718 18:5628332-5628354 GAAGTGCGATGGATTAAGACTGG - Intronic
1153527416 18:6010652-6010674 GGAGACAGATGGGTTAAAGCGGG - Intronic
1155254811 18:23985807-23985829 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1155536481 18:26823696-26823718 GAAATCAGATCATTTAAAAATGG - Intergenic
1156042235 18:32835675-32835697 GAGATCTGATGGTTTAAAAGGGG - Intergenic
1156576541 18:38323600-38323622 GAAGTCATTTGGTTTCAAATGGG + Intergenic
1156948306 18:42862227-42862249 GAGATCTGATGGTTTAAAAGTGG + Intronic
1159420969 18:68219093-68219115 GAGATCTGATGGTTTAAAAGCGG - Intergenic
1159674175 18:71261040-71261062 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1160956574 19:1695642-1695664 GAGATCTGATGGTTTAAAAACGG + Intergenic
1161427107 19:4209757-4209779 GAACAGAGATGCTTTAAAACTGG - Intronic
1163212315 19:15850284-15850306 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1164177613 19:22789993-22790015 GAAGTCAGAAAGTTTAAAAGTGG - Intergenic
1165478402 19:36046180-36046202 GAGATCTGATGGTTTAAAAGTGG + Intronic
1167114651 19:47481799-47481821 GAACACAGATGGTCTAGAACAGG - Intronic
925594641 2:5543251-5543273 GAGATCTGATGGTTTAAAAGTGG + Intergenic
925594902 2:5545211-5545233 GAGATCTGATGGTTTAAAAGTGG + Intergenic
925655599 2:6144865-6144887 AAAGTCACATGTTTTAAAAGGGG - Intergenic
925737861 2:6980021-6980043 GAGATCTGATGGTTTAAAAGTGG - Intronic
927329272 2:21842646-21842668 GAGATCAGATGGTTTGAAAGTGG + Intergenic
928662248 2:33514769-33514791 GAAGTGGGATGGTATATAACAGG + Intronic
928797635 2:35041149-35041171 AAAATCTGATGGTTTAAAAGTGG + Intergenic
929390982 2:41468073-41468095 GAAGGATGATGTTTTAAAACTGG + Intergenic
929442797 2:41978632-41978654 GAGGTCTGATGGTTTTAAAAGGG - Intergenic
930388783 2:50734008-50734030 GAAGCCAGAAGGTCTAAACCAGG + Intronic
930462038 2:51693745-51693767 GAAGTTAGATAAGTTAAAACTGG + Intergenic
930707459 2:54519009-54519031 GAAGTCACATTTTTTAAAATAGG - Intronic
932157595 2:69432708-69432730 AGAGTCACATGGTTCAAAACTGG + Intronic
932931572 2:76046145-76046167 GAGATCTGATGGTTTAAAAGTGG + Intergenic
934698272 2:96416267-96416289 GAAATCTGATGGTTTTAAAAGGG - Intergenic
934862448 2:97775571-97775593 AAAGTAAGATGGTTAGAAACTGG - Intronic
935324831 2:101926430-101926452 GAAATCTGATGGTTTAAAAGTGG + Intergenic
935927159 2:108082036-108082058 GAAATCTGATGGTTTTATACAGG + Intergenic
936718394 2:115217656-115217678 GAGATCAGATGCTTTAGAACAGG - Intronic
937742232 2:125368843-125368865 GAAATCTGATGGTTTAAAACTGG - Intergenic
939301061 2:140339282-140339304 GAAGACATTTGTTTTAAAACAGG + Intronic
939400017 2:141680229-141680251 GAAGTTTGATGGTGAAAAACAGG + Intronic
939498144 2:142948599-142948621 GAGATCTGATGGTTTAAAAAAGG - Intronic
940698368 2:157009454-157009476 GATATCTGATGGTTTAAAAGTGG + Intergenic
941726042 2:168861331-168861353 GAAGTCAGATGGCTGCTAACAGG - Intronic
942687773 2:178551887-178551909 GAAGTCACATTGTATATAACTGG + Exonic
942991528 2:182208378-182208400 GAGATCTGATGGTTTAAAAGTGG - Intronic
943359957 2:186906554-186906576 GAATTCAGCTGGTTTAATAATGG + Intergenic
944126368 2:196297859-196297881 GAAGACAGACTGTATAAAACAGG - Intronic
944637772 2:201691205-201691227 GAAATCAGGTGTTTTATAACAGG + Intronic
945648623 2:212533473-212533495 GTAGTCACATTGTTTAAATCAGG - Intronic
945753605 2:213818794-213818816 GAGATCTGATGGTTTAAAAGTGG + Intronic
946002939 2:216498265-216498287 GAAGTTAGACAGTTTCAAACTGG - Exonic
946549828 2:220789117-220789139 GAGATCTGATGGTTTAAAAATGG - Intergenic
947084537 2:226436416-226436438 GAATTCTGATGGTTTTAAAAGGG - Intergenic
948158094 2:235800864-235800886 GAAGTCAGATGGTTTAAAACAGG - Intronic
1169346691 20:4834511-4834533 GAAGTCAGATGGGAGAAAGCTGG + Intergenic
1170871680 20:20212142-20212164 GAAGTCACATGGTCTGAAAGGGG - Intronic
1172303731 20:33866867-33866889 GAAGGCAAATGTTTTCAAACAGG + Intergenic
1172829423 20:37820628-37820650 GAAATCCAATGGTTTAAAAGTGG + Intronic
1173117142 20:40255461-40255483 GAAGTCAGATGGAAAAAAAAAGG + Intergenic
1176919092 21:14664770-14664792 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1177305943 21:19316532-19316554 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1177392511 21:20494803-20494825 GAGATCAGATGGTTTAATAAGGG - Intergenic
1177686132 21:24439568-24439590 AAGGTCTGATGGTTTAAAAATGG - Intergenic
1177929161 21:27258624-27258646 GTATTCAGATGGTTTTAAATCGG - Intergenic
1178740330 21:35194125-35194147 GAGGTCTGATGGTTGAAAAGTGG - Intronic
1178767021 21:35463927-35463949 GAAATCTGATGGTTTTAAAAAGG + Intronic
1182644523 22:31797394-31797416 GATATCTGATGGTTTAAAAGGGG - Intronic
1182785029 22:32900099-32900121 GAAGTCAGATGGTATACTTCTGG + Intronic
949808953 3:7985346-7985368 GAAATCTGATGGTTTAAAAGTGG + Intergenic
951180498 3:19653760-19653782 GAAATCTGTTGGTTTAAAAGTGG - Intergenic
953117874 3:40010575-40010597 AAAGATAGATGCTTTAAAACAGG + Intronic
953230534 3:41061193-41061215 CAAGTCAGAGGGCTTAAAACTGG + Intergenic
955459848 3:59170009-59170031 GAGATCTGATGGTTTAAAAGTGG + Intergenic
955833100 3:63025795-63025817 GAGATCTGATGGTTTAAAAGTGG - Intergenic
955970475 3:64434063-64434085 GAGATCTGATGGTTTAAAAAGGG + Intronic
956100170 3:65760035-65760057 GAAGTCAAATGGTATAATGCAGG + Intronic
956239614 3:67115141-67115163 GAAATCTGATTGTTTAAAAATGG + Intergenic
956302272 3:67785195-67785217 GAGATCTGATGGTTTAAAAATGG + Intergenic
957685942 3:83503349-83503371 GACATCATATGGTTTAAAAATGG - Intergenic
958085110 3:88796615-88796637 GAGATCTGATGGTTTAAAAGTGG - Intergenic
958583314 3:96053563-96053585 GAGGTCTGATGGTTTTAAAAAGG - Intergenic
959814851 3:110662999-110663021 GAGATCTGATGGTTTAAAAGTGG + Intergenic
963777446 3:149453299-149453321 GAAATCTGATTGTTTAAAAGTGG - Intergenic
963898082 3:150706999-150707021 GAGATCTGATGGTTTAAAAGTGG - Intergenic
964072576 3:152652862-152652884 GAAATCAGATGGTAAAAACCTGG + Intergenic
964275248 3:155002885-155002907 GAAATCTGATGGTTTTAAAAGGG + Intergenic
964425260 3:156546216-156546238 AAAATCTGATGGTTTAAAAATGG + Intronic
964427660 3:156570029-156570051 GAGATCTGATGGTTTAAAAGTGG + Intergenic
964509140 3:157431133-157431155 GAGATCTGATGGTTTAAAAGTGG + Intronic
964738074 3:159936549-159936571 GAACTCAGATGGTGAACAACTGG - Intergenic
965183373 3:165433540-165433562 GAGATCTGATGGTTTAAAAGTGG + Intergenic
965838954 3:172881432-172881454 GAGATCTGATGGTTTAAAAATGG + Intergenic
966077295 3:175952917-175952939 AAAGTTAGAGAGTTTAAAACTGG - Intergenic
966272808 3:178128843-178128865 GAAGTAAGATGGTTATAAAAGGG - Intergenic
967207053 3:187133344-187133366 GAGATCTGATGGTTTAAAAGTGG + Intronic
967312573 3:188120000-188120022 GAAGCCACATGGCTTAAAAGTGG + Intergenic
967332360 3:188303696-188303718 GAGATCAGATGTTTTATAACAGG + Intronic
967747513 3:193074432-193074454 GAGATCTGATGGTTTAAAATCGG - Intergenic
969229236 4:5818138-5818160 GAGGTCTGATGGTTTAGAAGGGG + Intronic
970031958 4:11686070-11686092 GAGATCCGATGGTTTAAAAACGG - Intergenic
970072537 4:12177715-12177737 GAGATCTGATGGTTTAAAAGTGG - Intergenic
970659072 4:18264281-18264303 GAGATCTGATGGTTTAAAAGTGG - Intergenic
971499773 4:27306082-27306104 GAGATCTGATGGTTTAAAAGTGG + Intergenic
971699265 4:29948224-29948246 GAGATCTGATGGTTTAAAAGTGG + Intergenic
971977027 4:33703450-33703472 GAGATCTGATGGTTTAAAAGTGG + Intergenic
973063735 4:45762642-45762664 GAGGTCTGATGGTTTTAAAAAGG - Intergenic
973998625 4:56486209-56486231 GAAGTTTAATGTTTTAAAACTGG + Intronic
974136784 4:57827874-57827896 AAAGTTAGAATGTTTAAAACAGG - Intergenic
974495326 4:62618270-62618292 GAAGTCAGCTGTTTAAAAAATGG + Intergenic
974631181 4:64491407-64491429 CAAGGCAAATTGTTTAAAACTGG - Intergenic
974659549 4:64869095-64869117 AAAGTCAGAAGGGTTGAAACAGG + Intergenic
974786644 4:66626237-66626259 GAGATCTGATGGTTTAAAAGTGG + Intergenic
974867501 4:67598159-67598181 AAGATCTGATGGTTTAAAACTGG + Intronic
974923326 4:68269385-68269407 GAGATCTGATGGTTTAAAAGTGG - Intergenic
975147364 4:70983285-70983307 GAAGTCAGAATGCTTCAAACTGG - Intronic
975822605 4:78287189-78287211 GAGATCTGATGGTTTAAAAGTGG - Intronic
976949932 4:90815192-90815214 GAGATCTGATGGTTTAAAAGTGG - Intronic
977097815 4:92768746-92768768 GAGATCTGATGGTTTAAAAATGG - Intronic
977866540 4:102035161-102035183 GACATAAGATGGTTTAAAGCAGG - Intronic
978255644 4:106689548-106689570 GAGATCTGATGGTTTAAAAGTGG + Intergenic
978432324 4:108645561-108645583 TTAGTCAGATGGTTGAAAAATGG - Intergenic
979069201 4:116179514-116179536 GATTTCAGAGGGTTGAAAACAGG + Intergenic
979285995 4:118925336-118925358 ACAGTCATCTGGTTTAAAACTGG - Intronic
979366276 4:119828138-119828160 GAGATCTGATGGTTTAAAAGTGG - Intergenic
979426227 4:120571366-120571388 CAAGTCTGATGGTTTAAAAATGG - Intergenic
980370943 4:131869815-131869837 TAAGTCAGATTATTTCAAACTGG + Intergenic
980960307 4:139468223-139468245 GAGGTCTGATGGTTTTAAAAGGG - Intronic
981134137 4:141190929-141190951 GAAATGAGAAGGTTTAAAATAGG - Intronic
981865011 4:149407080-149407102 GAAGTCTGATGGCTTTAAAAGGG - Intergenic
982409019 4:155052419-155052441 GAAGTCAAATCATTTAAATCAGG + Intergenic
982627425 4:157785441-157785463 GAAATCTGATGGTTTAAAAGTGG - Intergenic
983702713 4:170617276-170617298 GAAATATGATGGTTTAAAAGTGG + Intergenic
983723711 4:170892680-170892702 GAAATCTGATGGTTTTAAAAAGG - Intergenic
984571727 4:181403515-181403537 GAGATCTGATGGTTTAAAAGTGG - Intergenic
984900885 4:184585431-184585453 GAAGTGACATGGTTTCACACTGG - Intergenic
985076647 4:186223014-186223036 GAGATCTGATGGTTTAAAAGTGG + Intronic
986448607 5:7845139-7845161 GAGATCTGATGGTTTAAAAGTGG - Intronic
987857767 5:23443488-23443510 GAGATCTGATGGTTTAAAAGTGG + Intergenic
987984023 5:25122820-25122842 GAGATCTGATGGTTTAAAAGTGG - Intergenic
988108975 5:26790253-26790275 GAATGCAGTTTGTTTAAAACGGG - Intergenic
988579649 5:32458051-32458073 AAAATCTGATGGTTTAAAAGTGG - Intergenic
989259380 5:39402078-39402100 GAGGTCTGATGGTTTTAAAAGGG - Intronic
990527257 5:56640198-56640220 GAGATCTGATGGTTTAAAAGTGG + Intergenic
990634888 5:57713661-57713683 GAGGTCTGATGGTTTTAAAAAGG + Intergenic
990764184 5:59163659-59163681 GAAGTCAGAAGGTGGAAAAGAGG - Intronic
992349536 5:75915007-75915029 GAAATCTGATGGTTTTAAAAAGG - Intergenic
992954060 5:81889897-81889919 GAGTTCTGATGGTTTAAAAGTGG + Intergenic
993107644 5:83617601-83617623 GAAATCTGATGGCTTAAAAGTGG + Intergenic
993857999 5:93099321-93099343 GAAACCTGATGGTTTAAAAGTGG - Intergenic
993908605 5:93652601-93652623 GTAGTCAGATGGTATATAACTGG + Intronic
994465800 5:100128466-100128488 AAAGCCAGATGGTGTTAAACAGG + Intergenic
995324716 5:110876954-110876976 TACGTGAGATGTTTTAAAACAGG + Intergenic
996330886 5:122327547-122327569 GAAATCTGGTGGTTTAAAAGTGG + Intronic
998722197 5:144965827-144965849 AAAATAAGATGGTTTTAAACAGG + Intergenic
999792095 5:154950172-154950194 GAGATCTGATGGTTTAAAAGTGG - Intronic
999827689 5:155289997-155290019 GAAGTCAGATGGTATAATCTGGG - Intergenic
1000225755 5:159260361-159260383 GAGATCTGATGGTTTAAAAGGGG + Intergenic
1000695124 5:164371470-164371492 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1002019448 5:176353492-176353514 AAAGTAAGATGGTTGAAAAGGGG + Intronic
1002083506 5:176752187-176752209 GAATTAAGATGATTTGAAACAGG - Intergenic
1003259929 6:4507813-4507835 GAGGTCTGATGGTGTAAAAGTGG - Intergenic
1003411255 6:5864734-5864756 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1003663472 6:8087220-8087242 GGAGTCAGATGAATTAAGACAGG + Intronic
1003776069 6:9366765-9366787 GAAGTCAAATGGCTTAAAGCTGG + Intergenic
1003778115 6:9392141-9392163 GAGATCAGATGGTTTTAAAAGGG - Intergenic
1004250994 6:14023059-14023081 GAAATCTGATGGTTTAAAAGTGG + Intergenic
1004483836 6:16047034-16047056 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1005642467 6:27809285-27809307 CAAGTCAGATATTTTAAAAGTGG - Intergenic
1006737263 6:36283271-36283293 TAAGTGAGTTGGTTTAAAAATGG - Intronic
1008739190 6:54584540-54584562 GAGATCAGATGGTTTAAAAGTGG + Intergenic
1008871113 6:56272733-56272755 GAGATCTGATGGTTTAAAAGTGG + Intronic
1010933999 6:81838460-81838482 GCAGTCAGATAGTTAAAAAAAGG - Intergenic
1011083482 6:83513448-83513470 GAAGTCAGAAGGGTTAATAAGGG - Intronic
1012594390 6:101023179-101023201 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1012909101 6:105099702-105099724 GAAGGCAGAGGGTTTACTACAGG - Exonic
1013227236 6:108128798-108128820 GAGATCTGATGGTTTAAAAATGG + Intronic
1013526891 6:110982376-110982398 GAAGTCAGACGTTTTTCAACTGG - Intronic
1014622095 6:123680121-123680143 GGAGTCAGAGGGTTTAATAATGG + Intergenic
1014665489 6:124231616-124231638 GAAATCTGATGTTTTAAAAATGG + Intronic
1015397008 6:132745945-132745967 GAAAACAGATGCTTTACAACTGG + Intronic
1016786042 6:148011571-148011593 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1016843996 6:148553247-148553269 GGAGTAAGATGATTTAAAAGTGG - Intergenic
1017334775 6:153243030-153243052 GAATTGAGGTGGTTAAAAACAGG - Intergenic
1017391113 6:153940471-153940493 AAAGTCACATGGTTCATAACAGG + Intergenic
1018554217 6:165033736-165033758 GAGATCTGATGGTTTAAAAGCGG + Intergenic
1020741428 7:12023902-12023924 GAGGTCTGATGGTCTAAAAGTGG + Intergenic
1023259338 7:38342454-38342476 GAAGTCTCACGGTTTAAAACTGG + Intergenic
1023259794 7:38346775-38346797 GAAGTCTCATGGTTTAAAAATGG + Intergenic
1023260270 7:38351105-38351127 GAAGTCTCATGGTTTAAAAATGG + Intergenic
1023260782 7:38355937-38355959 GAAGTCTCACGGTTTAAAAATGG + Intergenic
1023261246 7:38360255-38360277 GAAGTCTCATGGTTTAAAAATGG + Intergenic
1023261764 7:38365067-38365089 GAAGTCTCACGGTTTAAAAATGG + Intergenic
1024826911 7:53401030-53401052 GAAATCTGATGGTTTCAAAGGGG - Intergenic
1024886561 7:54148798-54148820 GATTTCAGAGGGTTTAAAAGTGG + Intergenic
1026676990 7:72436311-72436333 GAGGTCAGATGGTTTTATAAGGG + Intronic
1027448877 7:78306307-78306329 CATGTCAGATGGTATAAAATGGG + Intronic
1028290040 7:89054748-89054770 GTAGTCAGGTGGTTTACAAAAGG + Intronic
1029185993 7:98739060-98739082 TAAGTCAAATATTTTAAAACTGG - Intergenic
1031435483 7:121727804-121727826 GAGGTCTGATGCTTTAAAAGTGG - Intergenic
1031497209 7:122465367-122465389 AAGCCCAGATGGTTTAAAACAGG + Intronic
1031650607 7:124284999-124285021 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1031705283 7:124973306-124973328 GAAATCACATGTTTTAAAAATGG + Intergenic
1032272918 7:130428082-130428104 GGAGTCAGATACTTTAAAAATGG + Intronic
1032430411 7:131856455-131856477 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1032690550 7:134282616-134282638 GAGATCAGATGGTTTAATAAGGG - Intergenic
1032726620 7:134595560-134595582 AAAATCTGATGGTTTAAAAGTGG - Intergenic
1032905072 7:136355327-136355349 GAAGGCAGAAGGTCTGAAACAGG + Intergenic
1032980362 7:137274892-137274914 GAAGTCAGATTTTTTCACACTGG + Intronic
1033410269 7:141111241-141111263 GAAATCTGATGGTTTTAAAAAGG - Intronic
1033434413 7:141320081-141320103 GAGATCTGATGGTTTAAAAGTGG + Intronic
1033777338 7:144627364-144627386 GAAATCTGATGGTTTTAAAAAGG - Intronic
1033833204 7:145277365-145277387 GAAATCTGATGGTTTTAAAAAGG + Intergenic
1033910577 7:146259051-146259073 GAAATCTGATGGTTTAAAAGTGG + Intronic
1035639795 8:1176225-1176247 GAGGTCTGATGGTTTGAAAGTGG - Intergenic
1036279306 8:7386016-7386038 GAAATCTGATGGTTTAAAAATGG + Intergenic
1036342208 8:7925857-7925879 GAAATCTGATGGTTTAAAAATGG - Intergenic
1037384385 8:18322110-18322132 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1038333925 8:26631373-26631395 GAGATCTGATGGTTTAAAAGTGG - Intronic
1038740441 8:30212225-30212247 GACGTGTGATGGTTTAAAAGTGG - Intergenic
1040703464 8:50096130-50096152 AAGGTCAGATGGCTAAAAACTGG + Intronic
1040808231 8:51419541-51419563 GAAGTCTGATGGCTTAACCCAGG + Intronic
1041164819 8:55080828-55080850 GAAGTCATATGGATTCAAGCAGG - Intergenic
1041249945 8:55924305-55924327 GAAAACAGATGGTATAGAACAGG - Intronic
1044006603 8:86944466-86944488 GAAGTCAGATTTTATGAAACAGG + Intronic
1044564950 8:93652780-93652802 GAAATCTGATGGTTTGAAAAGGG + Intergenic
1047621661 8:126613753-126613775 GAAATCTGATGGTTTTAAAAAGG + Intergenic
1047710151 8:127543558-127543580 GAATTCAGCTGGTCTAACACAGG + Intergenic
1048824279 8:138408727-138408749 GAGATCCGATGGTTTAAAAGTGG - Intronic
1050383527 9:5058397-5058419 GAGATCTGATGGTTTAAAAGTGG - Intronic
1050594030 9:7188133-7188155 GAGATCTGATGGTTTAATACAGG - Intergenic
1051637488 9:19194263-19194285 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1051718710 9:20012330-20012352 GAGATCTGATGGTTTAAAAAGGG - Intergenic
1052168178 9:25358873-25358895 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1052779225 9:32763507-32763529 CAGGTCTGATGGTTTAAAAGTGG + Intergenic
1055540413 9:77298832-77298854 GAACTCTGATGGTTTTAAAAGGG + Intronic
1056444639 9:86653950-86653972 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1056691557 9:88812579-88812601 GAAGACAGATAGTGAAAAACAGG + Intergenic
1057328211 9:94086459-94086481 GAAGGCATATGGTTTAACATGGG - Intronic
1057948694 9:99352459-99352481 GAGGTCAGATGGCTTAGAAGTGG + Intergenic
1058275414 9:103035837-103035859 GAAATCTGATGGTTTAAAAGTGG - Intergenic
1058450069 9:105088252-105088274 AAAGGCAGATGTTTTAAAACAGG + Intergenic
1059628984 9:116099258-116099280 GAAGAGAAATGGTTTAAAATTGG - Intergenic
1059647922 9:116285731-116285753 GAAATCAGATGAATTAAAGCAGG - Intronic
1059775839 9:117474509-117474531 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1059958991 9:119546742-119546764 GAAATCTGATGGTTTTAAAGAGG + Intergenic
1203793755 EBV:165178-165200 GAGGTCAGCTGGTTTAAACTGGG + Intergenic
1186379803 X:9046317-9046339 GAAGTCTGATGGTTTAAAAGTGG - Intronic
1186723419 X:12330176-12330198 AAAGTCACATGGTTCAAATCTGG - Intronic
1186765668 X:12768263-12768285 AAACACCGATGGTTTAAAACAGG - Intergenic
1186923301 X:14305065-14305087 TAAGTCAACTGGTTTAAAACAGG + Intergenic
1187462748 X:19502376-19502398 GAGATCTGATGGTTTAAAAGTGG + Intronic
1188126740 X:26377566-26377588 TAACTCAAATGGTCTAAAACGGG + Intergenic
1188129570 X:26414704-26414726 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1188513521 X:30961277-30961299 GAGATCTGATGGTTTAAAAGTGG + Intronic
1188750939 X:33905158-33905180 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1189608341 X:42704108-42704130 AAAGTCACATAGTTTAAAAGTGG + Intergenic
1190772318 X:53525685-53525707 GATATCTGATGGTTTAAAAGTGG + Intergenic
1193186730 X:78522261-78522283 GAAGTTTGATGGTTTCAAAGAGG + Intergenic
1193929911 X:87541175-87541197 GAGATCTGATGGTTTAAAAGTGG + Intronic
1196498700 X:116351770-116351792 GAGATCAGATGGTTTAAAAGTGG + Intergenic
1197372992 X:125647152-125647174 GCAATCAGATGGTCTGAAACTGG - Intergenic
1198815778 X:140588580-140588602 GAAGCCAGAAGGTTTTAATCTGG - Intergenic
1198991156 X:142516014-142516036 GAGATCTGATGGTTTAATACGGG - Intergenic
1198991680 X:142521589-142521611 GAAGTCTGATGGTTTTATAAGGG - Intergenic
1199062714 X:143377514-143377536 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1199928010 X:152489861-152489883 GAGGTCAGATGGTTTCATAAGGG + Intergenic
1199931689 X:152530079-152530101 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1199931979 X:152532057-152532079 GAGATCTGATGGTTTAAAAGTGG - Intergenic
1200814975 Y:7521998-7522020 GAGATCTGATGGTTTAAAAGTGG + Intergenic
1201338987 Y:12911203-12911225 TATGTCAGATGGATTAAAACAGG - Intronic