ID: 948162019

View in Genome Browser
Species Human (GRCh38)
Location 2:235832899-235832921
Sequence TGTTGTACACTCATGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948162019 Original CRISPR TGTTGTACACTCATGAAGCA GGG (reversed) Intronic
907749036 1:57244803-57244825 TTATGTAGACTCATAAAGCAAGG + Intronic
908497547 1:64709878-64709900 TTTTGTACACTCATGGATCCTGG - Intergenic
909164434 1:72200500-72200522 TATTGTAGACTCATTGAGCAGGG + Intronic
911067074 1:93799657-93799679 TTTTTTACAATCATGAAGAATGG + Intronic
915173183 1:153992887-153992909 GGTTGTAGACTCATGAAGTGAGG + Exonic
916836631 1:168552763-168552785 CTTTGGACACTCATGAAGCATGG - Intergenic
917585773 1:176425409-176425431 TGTTCTGCATTCATGAACCAGGG + Intergenic
924136739 1:240975037-240975059 TGCTGAAAACTCAAGAAGCATGG + Intronic
1073574600 10:104612050-104612072 TGGCTTGCACTCATGAAGCAGGG - Intergenic
1089624736 11:119743920-119743942 TGTTATACAATCAGGAAGCCTGG + Intergenic
1091487195 12:900784-900806 TGTTGTACACTGAAGAATCTGGG + Intronic
1094376449 12:29794923-29794945 AGTTGCACACCCATGAAGCCAGG + Intergenic
1096875881 12:54630121-54630143 TCTTGCACACACATGAACCAGGG - Intergenic
1098029710 12:66241172-66241194 GGTTGTACACTGAGGAAGTATGG - Intronic
1098773549 12:74584963-74584985 TTTTGTAAACTTATGCAGCAGGG + Intergenic
1099221310 12:79918339-79918361 TGTTGTGCACACATGGAGGAGGG - Intronic
1099876368 12:88410898-88410920 TGTTATACACTAAAAAAGCATGG - Intergenic
1104701507 12:130907894-130907916 TGTTGTACACCCTGGAAGCAAGG + Intergenic
1106441041 13:29770727-29770749 TATTGTACATTCATTAAGGATGG - Intronic
1107427156 13:40305590-40305612 TGTTGTTCTGTCATGAAGAAGGG - Intergenic
1109388845 13:61667537-61667559 TGGCCTGCACTCATGAAGCAGGG + Intergenic
1109855598 13:68123103-68123125 TGTGGTTAAGTCATGAAGCAAGG + Intergenic
1110288161 13:73773774-73773796 TGTTGTAGCATCATGAAGCTTGG - Intronic
1110801982 13:79708792-79708814 TATTTTACACTCATGGATCAGGG + Intergenic
1115149341 14:30266219-30266241 TGTTGAACATTCAGTAAGCATGG - Intergenic
1116156912 14:41217320-41217342 TGTAGTGCAACCATGAAGCAAGG - Intergenic
1116420736 14:44728831-44728853 TGTTGTTAATTCATGAAGGAAGG - Intergenic
1117653896 14:57934675-57934697 TGTTGTCCCCTAATGAAGCCAGG + Intronic
1118370514 14:65133722-65133744 TGATGTACACCCATGTTGCAGGG + Intergenic
1124038448 15:26078494-26078516 TGTTGTACACCCATGGTGCGAGG + Intergenic
1127712476 15:61613492-61613514 TTTAGAACATTCATGAAGCAGGG + Intergenic
1127941046 15:63696153-63696175 TGTTGGACACACAGGAGGCAAGG - Exonic
1128106707 15:65050688-65050710 TGCTGTACCCAAATGAAGCAGGG - Intronic
1137003851 16:35254521-35254543 TGTTGTACAGTGATGAAGTATGG - Intergenic
1141550273 16:84802399-84802421 TGTTGTTTGCTCCTGAAGCACGG + Intergenic
1141634166 16:85304932-85304954 GGTTGGACAGTCAGGAAGCAGGG - Intergenic
1141848206 16:86625770-86625792 TGTTTTACACAGATGAAGAAAGG + Intergenic
1144301150 17:13923792-13923814 TGGTGTGTACCCATGAAGCAGGG - Intergenic
1144570182 17:16392649-16392671 TGTTATAAACGTATGAAGCATGG - Intergenic
1147602925 17:41757037-41757059 GGTTCCCCACTCATGAAGCAGGG + Intronic
1156137654 18:34062508-34062530 TGTTATACACTTATGAAGAAAGG - Intronic
1157273920 18:46296855-46296877 TGCTGTGCACTCTGGAAGCAGGG + Intergenic
1166810733 19:45513133-45513155 GGTTGTAGAGTCATGCAGCAGGG + Intronic
927132784 2:20074555-20074577 TATTTGACACTCATGAAACATGG - Intergenic
931088481 2:58861183-58861205 TGATGTACACTCAGTAGGCAAGG + Intergenic
933014051 2:77101914-77101936 TTTTGAAGACTCATGTAGCAAGG - Intronic
933530278 2:83501014-83501036 TATTGTCCACTCATGAAAAATGG - Intergenic
935206962 2:100904418-100904440 TCGTGTACACTCATGAGACAAGG - Intronic
935578409 2:104734644-104734666 TATTGTACACTCAAGATGAAAGG + Intergenic
940858994 2:158752841-158752863 TGTTGTACAGCCATGATGAAAGG + Intergenic
941279262 2:163530247-163530269 TGTTGTAGAATCATGGAGAAGGG - Intergenic
941938852 2:171011328-171011350 TTTTTTACACTAATGTAGCAAGG - Intronic
944923975 2:204444033-204444055 TCTGGTAGACTCATGATGCATGG + Intergenic
948162019 2:235832899-235832921 TGTTGTACACTCATGAAGCAGGG - Intronic
1169716481 20:8624619-8624641 TGTTCTACACCTAAGAAGCAAGG - Intronic
1169747046 20:8953161-8953183 TGTTATGCACTCAGGAAGGATGG - Intronic
1172648582 20:36487149-36487171 AGTTATACACTCCAGAAGCATGG - Intronic
1173065867 20:39710508-39710530 TGATGTACACTTCTGAAGAATGG + Intergenic
1173759420 20:45546715-45546737 TGCTGAACACTCAGGAAGTAAGG - Intronic
1182392177 22:30007613-30007635 TGTTGTCCTTTCATGAAGCCTGG - Intronic
1182491345 22:30674269-30674291 TGTTTTACAGTCATGTAGCCTGG - Intergenic
1184529476 22:45045609-45045631 TGGTGTAGAATCAGGAAGCAAGG - Intergenic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
953927290 3:46988978-46989000 TGTTGTCCACTCTACAAGCAGGG + Intronic
955027412 3:55183061-55183083 TGTTGTCCATACATGCAGCATGG - Intergenic
956289882 3:67650336-67650358 TGTTGTATACTCAGAAAGAATGG - Intronic
956660572 3:71593078-71593100 GGTGGTACACTGATTAAGCATGG - Intergenic
959006636 3:101027148-101027170 GGTGGTCCACTCATGAAGCAGGG + Intergenic
959922891 3:111889229-111889251 TACTGTACACTGATGAAACAAGG + Intronic
961999139 3:131276673-131276695 GGTTGAAGAATCATGAAGCATGG - Intronic
965463385 3:168997333-168997355 GGTTGCAAACTCAGGAAGCAGGG - Intergenic
970298078 4:14652778-14652800 TGCTGACCACTTATGAAGCAGGG + Intergenic
972569480 4:40297177-40297199 TGCTGTACTCTCATACAGCAGGG - Intergenic
975311593 4:72909873-72909895 CTTTGTACAGTTATGAAGCAGGG - Intergenic
975614248 4:76230738-76230760 TGACTTACACTCATGAAGCAGGG + Intronic
976384919 4:84445680-84445702 TATTTTACACTCATGCAGTAAGG - Intergenic
979452279 4:120886795-120886817 TGTTGTAGACTTTTGAAGGAAGG - Intronic
980145051 4:128972449-128972471 TGTTGGAGACACAGGAAGCAAGG + Intronic
980639012 4:135548948-135548970 TTTTCTACAATCATTAAGCAAGG + Intergenic
982305439 4:153925623-153925645 TATTATACACTCATGAGGCAGGG + Intergenic
983769669 4:171533971-171533993 TGTTTTTCACTCATTAAGCAAGG + Intergenic
985009687 4:185569652-185569674 TGTAGGAAACTGATGAAGCAGGG + Intergenic
987089053 5:14495028-14495050 TGAAGAACACTCATGAATCATGG + Intronic
987230389 5:15887765-15887787 TTTGGTACACTCAAGAAGCTTGG + Intronic
994661380 5:102658389-102658411 TGTTGTAGGATCATGAAGCATGG - Intergenic
994900836 5:105767219-105767241 TGTTTTACCCTCCTGAGGCAAGG - Intergenic
998398179 5:141833077-141833099 GCTTTTACACTCGTGAAGCATGG - Intergenic
1000370281 5:160528587-160528609 TGTTGGAGACTCATGAACAATGG + Intergenic
1000422346 5:161053323-161053345 GGCTGTACACACAAGAAGCATGG + Intergenic
1003006945 6:2391317-2391339 TGGTGTCCACTCCTCAAGCAAGG + Intergenic
1014521205 6:122444392-122444414 TGTTTTAAACTCATGAAGTATGG - Exonic
1014910924 6:127092027-127092049 CTTTGTACACTCAGGAAACAAGG + Intergenic
1016162072 6:140894506-140894528 TGGCTTGCACTCATGAAGCAGGG + Intergenic
1016801351 6:148172544-148172566 TGTTGTACCCACCTGAATCATGG - Intergenic
1021777691 7:24069772-24069794 TATTGTTCACTGATGAACCAAGG + Intergenic
1022930017 7:35101499-35101521 TGTGGTCCACTCATCAAGCCAGG - Intergenic
1034908987 7:154976755-154976777 TCACGTACACTCATGGAGCATGG + Intronic
1036609705 8:10339349-10339371 TTTTGGAAACTCATGAAACAAGG - Intronic
1037021858 8:13982787-13982809 TATTGTACATTCTTGAGGCAAGG + Intergenic
1040705249 8:50118239-50118261 TCTTCTCCAGTCATGAAGCATGG - Intronic
1041213915 8:55580774-55580796 TTCTCTACACTCATGAAGCTGGG - Intergenic
1041935025 8:63324311-63324333 TGGTATGCACCCATGAAGCAGGG - Intergenic
1046453384 8:114423149-114423171 TGTTGGACACTGATAAAGAAAGG - Intergenic
1047553687 8:125905646-125905668 TATTGTACACTCACCCAGCATGG + Intergenic
1052225911 9:26086030-26086052 AGTTGTACCCCCATGAACCATGG + Intergenic
1053341013 9:37331524-37331546 TGTTTTACACTCCAGAAGGAAGG + Intronic
1053503960 9:38624391-38624413 TGTTTTACACAAAAGAAGCAAGG - Intergenic
1057286707 9:93761967-93761989 TCTTGTACACCCATGAACTAGGG + Intergenic
1058655135 9:107213410-107213432 TGATGTACACTCATAAAAAAAGG - Intergenic
1059094288 9:111395866-111395888 CTTTGAACACACATGAAGCAAGG - Intronic
1189178654 X:38982655-38982677 TGTAGCACACTCATGACCCAAGG - Intergenic
1189343086 X:40219367-40219389 TGTTGTGCAGTGATGAAGAAAGG - Intergenic
1193198821 X:78664385-78664407 TGTTGAACCATCATGAATCAGGG + Intergenic
1194838972 X:98715315-98715337 TTTTGTACATTCATGAGCCAGGG + Intergenic
1196915457 X:120530122-120530144 GGTTGTACACTTCTGAAACAAGG + Exonic
1198186357 X:134257435-134257457 TGTTGGAGAATCATGATGCAGGG - Intergenic
1199694412 X:150333732-150333754 GGGTGCACACTCATGAAGCCAGG - Intergenic