ID: 948162752

View in Genome Browser
Species Human (GRCh38)
Location 2:235838340-235838362
Sequence TTTTAGCAAAATCACTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 11, 3: 42, 4: 420}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948162752_948162755 18 Left 948162752 2:235838340-235838362 CCTCCAAAGTGATTTTGCTAAAA 0: 1
1: 0
2: 11
3: 42
4: 420
Right 948162755 2:235838381-235838403 TCTGTAACATTTCATATGGTAGG 0: 1
1: 0
2: 0
3: 21
4: 196
948162752_948162756 21 Left 948162752 2:235838340-235838362 CCTCCAAAGTGATTTTGCTAAAA 0: 1
1: 0
2: 11
3: 42
4: 420
Right 948162756 2:235838384-235838406 GTAACATTTCATATGGTAGGAGG 0: 1
1: 0
2: 2
3: 11
4: 127
948162752_948162757 30 Left 948162752 2:235838340-235838362 CCTCCAAAGTGATTTTGCTAAAA 0: 1
1: 0
2: 11
3: 42
4: 420
Right 948162757 2:235838393-235838415 CATATGGTAGGAGGAAGAAGAGG 0: 1
1: 0
2: 6
3: 42
4: 456
948162752_948162754 14 Left 948162752 2:235838340-235838362 CCTCCAAAGTGATTTTGCTAAAA 0: 1
1: 0
2: 11
3: 42
4: 420
Right 948162754 2:235838377-235838399 AGTTTCTGTAACATTTCATATGG 0: 1
1: 0
2: 0
3: 28
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948162752 Original CRISPR TTTTAGCAAAATCACTTTGG AGG (reversed) Intronic
900171047 1:1269023-1269045 TGTTAGGAAAGTCACTCTGGTGG + Intronic
901148149 1:7082124-7082146 TTTTAGAAACATCACTCTGGTGG - Intronic
901353321 1:8618837-8618859 TTTTAAGAAAATAAATTTGGTGG + Intronic
901731158 1:11280848-11280870 TTTTAACAGAATTACTCTGGTGG - Intronic
902175953 1:14650987-14651009 TTTTAGGAAAGTCACTGCGGAGG - Intronic
904154513 1:28471632-28471654 TTTCAGCAAAGTCCCTTTGGAGG - Intronic
904219483 1:28953822-28953844 ATTTATCAAAATCACTTGGAAGG + Intronic
904932298 1:34098853-34098875 TTTTAGCATAATAGCTGTGGAGG + Intronic
905466697 1:38159797-38159819 TTTTAAAAAGATCACCTTGGTGG + Intergenic
907444198 1:54497590-54497612 TTTTGGGAAATTCACTGTGGAGG + Intergenic
907695579 1:56724578-56724600 TTTTAGAAAAATGACTCTGCAGG - Intronic
907766796 1:57421135-57421157 TTTAAGAAAAATTACTTTGGAGG + Intronic
907869946 1:58433849-58433871 TTTTAGCACATAAACTTTGGGGG + Intronic
908308468 1:62850381-62850403 TCTAAACAAAATCACTCTGGCGG - Intronic
908732005 1:67235842-67235864 TTTTAAAAAAATTACTTTTGGGG - Intronic
908889549 1:68828826-68828848 TTTTACAAAGATAACTTTGGAGG + Intergenic
909319415 1:74264467-74264489 TTTTAGAAAAGTAATTTTGGAGG - Intronic
909531954 1:76691933-76691955 GTTTAGCACCATCCCTTTGGTGG - Intergenic
909575365 1:77170096-77170118 TTTAAGGAAGATCACTCTGGGGG - Intronic
909761769 1:79297028-79297050 TTTCAGAAAAATCACCTTGCTGG + Intergenic
909819177 1:80038229-80038251 TGCTAGCAAAAATACTTTGGAGG - Intergenic
909918472 1:81350443-81350465 ATTTTCCAAAATCATTTTGGAGG + Intronic
910862345 1:91754216-91754238 TTTTAGCAAATTCAGGTTGAAGG + Intronic
911489538 1:98546340-98546362 TTTAAGAAAATTCACTCTGGAGG - Intergenic
911619802 1:100053806-100053828 TTTTAGCTAAATCCCCTTGTTGG - Intronic
911886069 1:103301132-103301154 GTTTAGCACCATCCCTTTGGTGG - Intergenic
912359135 1:109080256-109080278 TTTTAAAAAGATCACTTTTGCGG + Intergenic
912823571 1:112886084-112886106 TTTCAGAAATATCACTTTGATGG - Intergenic
914394602 1:147253019-147253041 TTTTAGCAAAACAAATTTGGAGG - Intronic
916883532 1:169045475-169045497 TTTTAGTAAATTCACTTCAGGGG + Intergenic
917529453 1:175821694-175821716 TTTGAACAAGATCACTTAGGAGG - Intergenic
918743367 1:188165858-188165880 TTTTAGAAACATCACTTAGGTGG - Intergenic
918962862 1:191303051-191303073 TGTCAGCAAAAGCACTCTGGTGG + Intergenic
920988598 1:210914343-210914365 TTTTAGAAAAATCAGTATGTTGG + Intronic
921074088 1:211685859-211685881 TTTTAGTATAATTATTTTGGGGG + Intergenic
921602488 1:217121407-217121429 TTTTAGAAAAATCACTCTCCTGG + Intronic
921963781 1:221065589-221065611 TTTTAGCAAAATAAGTTTAAAGG - Intergenic
922392523 1:225160018-225160040 TTTTAGGAAAACAACTCTGGTGG - Intronic
922440129 1:225648434-225648456 ATTAAGCAAAATAACTATGGAGG - Intronic
922957047 1:229611767-229611789 TTTTAGAAAACTCAGTCTGGTGG - Intronic
923112114 1:230899468-230899490 TTTCAGCAAAATCACTAATGTGG + Intergenic
923259172 1:232250465-232250487 TTTTAGCTAAAACACATTGTAGG + Intergenic
923451886 1:234125676-234125698 CTTTAGGAAAATAACTTTGTTGG - Intronic
924062813 1:240193815-240193837 TTTTAGAAAGATAACTCTGGAGG - Intronic
924083862 1:240427796-240427818 TTTTGGCAAAATTACTTTATAGG + Intronic
924715389 1:246567998-246568020 TTTTAAAAAAAACACTGTGGTGG + Intronic
1063437436 10:6045920-6045942 TCTTAGCATCATGACTTTGGAGG - Intronic
1064664855 10:17640306-17640328 TATTAGAAAAATCATTCTGGCGG + Intergenic
1065611814 10:27478970-27478992 ATTTACCAAAATCCCTTTGATGG - Intergenic
1067033561 10:42897328-42897350 TATCAGCAAACTCAATTTGGTGG + Intergenic
1068127647 10:52861309-52861331 TTTTATTAAAATCACTGTGATGG + Intergenic
1068716304 10:60192828-60192850 TTTTTAAAAAATCAATTTGGGGG - Intronic
1070935054 10:80287316-80287338 TTTTATCAATATCACTTAGTAGG + Intronic
1071362034 10:84857803-84857825 TTTTAAAAAATTCAATTTGGAGG - Intergenic
1071546129 10:86531223-86531245 TTTTAGAAATATCATTCTGGGGG - Intergenic
1071860640 10:89669189-89669211 GTTTAGCACCATCACCTTGGTGG - Intergenic
1071894979 10:90056378-90056400 TTATACTATAATCACTTTGGGGG - Intergenic
1072864455 10:99042933-99042955 TATTAGCAAAATATTTTTGGTGG - Intronic
1073187336 10:101624422-101624444 TTTTAGCAAAATCATCTCTGGGG + Intronic
1073224530 10:101906339-101906361 TGTTAGCAGCATCACTTTGAGGG - Intronic
1073582733 10:104682699-104682721 TTTTAGCAAAATAAATATGCTGG - Intronic
1074216941 10:111394375-111394397 GTTTAGCACCATCCCTTTGGTGG + Intergenic
1074808249 10:117075880-117075902 TTTTAGAAAGATAACTTTAGAGG + Intronic
1075244016 10:120804400-120804422 TTTAAGCAAAGACAGTTTGGTGG - Intergenic
1075432243 10:122396270-122396292 TTTTGAAAAAATCACTTTGGTGG + Intronic
1075991343 10:126841412-126841434 TTTGAGCAAAATCAGCTGGGTGG - Intergenic
1078374742 11:10784376-10784398 TTTTAGCAAATGCATTTTGTGGG + Intergenic
1078785561 11:14488265-14488287 TTTTATCAAAATCTTTATGGAGG + Intronic
1078963062 11:16302194-16302216 TTTAAGAAAAGTAACTTTGGTGG - Intronic
1079151982 11:17908117-17908139 TTTTAGAAAGATCACTGTGATGG - Intronic
1079391536 11:20025977-20025999 AGTTAGCATAATCATTTTGGTGG - Intronic
1079583005 11:22089215-22089237 TTTAACCAAAATTACTTTGCAGG + Intergenic
1079745844 11:24128973-24128995 TTTCAACACATTCACTTTGGGGG - Intergenic
1080068504 11:28049024-28049046 TATTAGGAAGATCACTTTGTTGG + Intronic
1081367185 11:42249693-42249715 TTTTAGCACAATGATTTAGGAGG - Intergenic
1082225014 11:49694773-49694795 ATTTAAAAAAATCATTTTGGGGG - Intergenic
1082636544 11:55601705-55601727 TTTTAGGTCAATCACTTTTGAGG + Intergenic
1083597462 11:63925151-63925173 TTTTAGAAAGATCACCCTGGAGG - Intergenic
1085331113 11:75652120-75652142 TTTTAGCAATAAAATTTTGGTGG + Intronic
1086008814 11:82073346-82073368 TTTTAGAAAAGTCACTCTGCTGG - Intergenic
1086624094 11:88924953-88924975 ATTTAAAAAAATCATTTTGGGGG + Intronic
1086879502 11:92137101-92137123 TTTTAGCATACTCACTTAGCTGG + Intergenic
1087666700 11:101057513-101057535 TTTTAGAAAAATGATTCTGGGGG + Intronic
1088721949 11:112600275-112600297 GTTTAGAAAAATTATTTTGGAGG + Intergenic
1089326419 11:117660529-117660551 TTATGGCAAAGTCATTTTGGAGG - Intronic
1089680925 11:120118481-120118503 TTTTAGAAAGATAGCTTTGGTGG - Intronic
1090170369 11:124597079-124597101 TTTTATCAACTTCACTTTGTAGG + Intergenic
1090484043 11:127096114-127096136 CTTTAGGAAGATCACTTTGTAGG + Intergenic
1090533003 11:127610691-127610713 TTTTAGCAAAACCACTCTGCAGG + Intergenic
1091114366 11:132999485-132999507 TGTCAGAAAAATCACTTTAGAGG + Intronic
1091998320 12:5013122-5013144 TTTTAGGAAGATTACTGTGGTGG + Intergenic
1093717389 12:22399287-22399309 TTTTAGGCAAATCACTTAGGAGG + Intronic
1093822786 12:23642721-23642743 GTTGAGTAAAATCACTTGGGTGG + Intronic
1095536502 12:43254589-43254611 TTTTTGAAAAAGCACTTTAGTGG - Intergenic
1097825976 12:64175045-64175067 TCATACCAAAATAACTTTGGAGG + Intergenic
1098085443 12:66837661-66837683 TTTTAGGAAAATTACTCTGTTGG + Intergenic
1098437309 12:70481649-70481671 TTTTAGATAAATCATTCTGGTGG + Intergenic
1098978285 12:76927730-76927752 TTTTAGCAATACCACATCGGAGG - Intergenic
1099061155 12:77910831-77910853 TTCAAGCAAAATGACTTTGGTGG - Intronic
1100184131 12:92120136-92120158 TTTTTTCAAAATTATTTTGGAGG + Intronic
1100220155 12:92496281-92496303 CATCAGAAAAATCACTTTGGTGG + Intergenic
1100908693 12:99333048-99333070 TTTTAGAAACATCACTCTGGAGG + Intronic
1100951943 12:99860539-99860561 TTTTAGAAAGATCCCTCTGGAGG + Intronic
1102643076 12:114383561-114383583 TTTTACAAAGATCTCTTTGGTGG + Intronic
1102986941 12:117285888-117285910 TTTTTGCAAAAGCACTGTGTTGG + Intronic
1104498346 12:129261883-129261905 TTTTAACATAATGAATTTGGAGG + Intronic
1104999370 12:132679635-132679657 TTATAGCCAAATCACTTGGTGGG - Exonic
1105742563 13:23343033-23343055 TTTTTGCAGAAATACTTTGGAGG + Intronic
1105796630 13:23860642-23860664 TTTTAGACAAATCCCTCTGGTGG + Intronic
1107305048 13:39009204-39009226 CTTTAGAAAAATCACTTAGGTGG - Intergenic
1107505914 13:41033011-41033033 TTTTTAAAAAATCATTTTGGGGG - Intronic
1111151793 13:84263013-84263035 TTTTAGAAAAATCACTGTAATGG + Intergenic
1111913010 13:94332747-94332769 TATAAACAAAATCAGTTTGGTGG + Intronic
1112071857 13:95861711-95861733 ATTTTGCAAAATAACTTTGATGG - Intronic
1112298445 13:98209494-98209516 TTTAAGGAAAATAACTTTGTTGG + Intronic
1112745116 13:102519089-102519111 TTTTAAAAAAATCAATTTGTAGG - Intergenic
1114390294 14:22300808-22300830 ATTTAGTACAATCTCTTTGGAGG - Intergenic
1115051111 14:29064653-29064675 TCCTAGCAACATCACCTTGGGGG + Intergenic
1115883172 14:37943424-37943446 TTTTTTAAAAATCACTTAGGAGG - Intronic
1115945391 14:38654081-38654103 TTTTAAAAGCATCACTTTGGTGG - Intergenic
1116130460 14:40849832-40849854 TTTAACCAAAATCATTTTCGGGG - Intergenic
1116163304 14:41298961-41298983 TTTTAAAAAAATCATATTGGTGG + Intergenic
1116304461 14:43232834-43232856 TTTTAACAAAGTCATTTTTGGGG - Intergenic
1116549520 14:46218129-46218151 TCTTAGCAAGATCACCTTGCTGG + Intergenic
1117119814 14:52554342-52554364 TTATTGCAAAAACAGTTTGGTGG - Intronic
1117613300 14:57506163-57506185 TTTGAAGAAAATCTCTTTGGAGG + Intergenic
1117965461 14:61203030-61203052 TTTTAAAAAAATCAATTAGGGGG - Intronic
1119928796 14:78524091-78524113 TTTTGTCAAAATCACTTATGAGG - Intronic
1120017341 14:79488822-79488844 TTTTAGAATGATCTCTTTGGGGG + Intronic
1120192459 14:81451824-81451846 TTCTAACACCATCACTTTGGAGG - Intergenic
1120466790 14:84868866-84868888 TATTAGCTGAATCTCTTTGGTGG + Intergenic
1121326982 14:93026278-93026300 TTTTAAAAAAATCAGTTTGTAGG - Intronic
1121923641 14:97907109-97907131 TTTTAGTAACTTCATTTTGGGGG - Intergenic
1122065252 14:99168673-99168695 TTTTAACAAAATCACACGGGAGG - Intergenic
1122245708 14:100401885-100401907 TTTTAGCATGGACACTTTGGAGG + Intronic
1202881980 14_KI270722v1_random:68791-68813 TTTTAACAAAATTACGTAGGGGG - Intergenic
1123634312 15:22288343-22288365 TTTTAAGAAAATAAATTTGGTGG - Intergenic
1124859436 15:33424371-33424393 TTTTAGAAAAATAACTCTGCAGG - Intronic
1124944285 15:34249097-34249119 TTTTAGAAAAGTCATTCTGGTGG + Intronic
1125217415 15:37291101-37291123 TTTTAGTATGATCACCTTGGGGG + Intergenic
1126063146 15:44803323-44803345 TGTTGGCAAAATCACATTGTGGG - Intergenic
1126351439 15:47748832-47748854 TTTTAGAAAGATCATTCTGGTGG + Intronic
1127759744 15:62126995-62127017 TTTCAGCAAAAATATTTTGGAGG + Intergenic
1128876198 15:71203352-71203374 TTTTAAGAAAATAGCTTTGGCGG + Intronic
1129068489 15:72931283-72931305 TTTTAAAAAAATCACTTTGTGGG - Intergenic
1129827320 15:78642157-78642179 TTATAGCAAAATGACGTGGGGGG - Intronic
1129935380 15:79443878-79443900 TATTGGCAGAATCACTTTAGAGG - Intronic
1130236209 15:82136120-82136142 CTTTATAAAAATCACTTTTGAGG + Intronic
1130430133 15:83839516-83839538 TTTTAGTAAAATAATTCTGGTGG + Intronic
1133911698 16:10071949-10071971 TTTTAGCTCTATCACTTAGGTGG - Intronic
1135629558 16:24025170-24025192 TTTTAGGAAAATGACTTAGAAGG - Intronic
1135636479 16:24080088-24080110 CTTTTGAAAGATCACTTTGGTGG + Intronic
1135636897 16:24085343-24085365 TTGTATGAAAATCACATTGGAGG + Intronic
1135828980 16:25756307-25756329 GTTTAGTAAAATCACTCTGGTGG + Intronic
1137903339 16:52293244-52293266 TTTCTGCAAAATCATTTTAGTGG + Intergenic
1138177319 16:54912552-54912574 TTTTAAATATATCACTTTGGTGG - Intergenic
1139308489 16:66008163-66008185 TATTTCCAAAATCACTTTGGAGG + Intergenic
1139848848 16:69938852-69938874 TCTTAGCAAAAGCACTTCTGGGG + Intronic
1140063874 16:71593447-71593469 TTTCTGCAAAATTACTTTGAAGG + Intergenic
1141118256 16:81330223-81330245 TTCTAGAAACATCACTCTGGCGG - Intronic
1143287684 17:5802376-5802398 TTTTAGAAAGATCCCTTGGGGGG - Intronic
1144121429 17:12157688-12157710 ATTTAGCATTATCCCTTTGGTGG + Intergenic
1144531982 17:16048361-16048383 TTTTAGACAAATCACTCAGGTGG + Intronic
1145113736 17:20188859-20188881 TTCTATTAATATCACTTTGGGGG - Intronic
1146510332 17:33442039-33442061 TTTGTGCTAAATCAATTTGGGGG - Intronic
1146585623 17:34079119-34079141 TTTTAGAAGTATCACTCTGGTGG - Intronic
1147558336 17:41493898-41493920 TTTTGGAAAAATTACATTGGTGG - Intergenic
1149462032 17:56836605-56836627 TTTTAGAAAGATCATTTGGGTGG - Intronic
1149474736 17:56950440-56950462 TCCCAGCAAAGTCACTTTGGAGG - Exonic
1149701869 17:58661973-58661995 TCTTGGCAAAGTCACTTTGGGGG - Intronic
1150903638 17:69312960-69312982 TTTTATAAAACTGACTTTGGTGG + Intronic
1151052444 17:70993644-70993666 TTATGGCAAAATTGCTTTGGGGG + Intergenic
1151712794 17:75816468-75816490 TTTTAGCTCTGTCACTTTGGTGG + Intronic
1153232888 18:2956989-2957011 TTTTAAAATAATCACGTTGGTGG - Intronic
1153602865 18:6798811-6798833 TTTTATTTAAATCACTTTGGTGG - Intronic
1153998479 18:10462925-10462947 TTTTGGAAAAATCACTTTTCTGG - Intronic
1155569200 18:27171652-27171674 GTTTAGAAAAAACACTTTCGTGG - Intronic
1156057098 18:33019794-33019816 TTGTAATAAAATAACTTTGGGGG + Intronic
1156285721 18:35693739-35693761 TTTAAGAATATTCACTTTGGGGG + Intronic
1156521014 18:37722321-37722343 ATTTAGAAAACTCACTTAGGAGG + Intergenic
1157807799 18:50671178-50671200 TTTAAGCATGATGACTTTGGAGG + Intronic
1158238688 18:55350987-55351009 TTTTAGCAGAGTCTCCTTGGAGG - Exonic
1159881742 18:73864831-73864853 TTTTAGAAAAATTACTTTGGTGG - Intergenic
1161741127 19:6021823-6021845 TTTTAGCAGGATCACTCTGGTGG + Intronic
1162756315 19:12862499-12862521 TTTTAAGAAAATCCATTTGGAGG + Intronic
1164891271 19:31825740-31825762 TTTCAGCAAGATTACTCTGGGGG - Intergenic
1168444410 19:56399511-56399533 GTTTTTCAAAGTCACTTTGGGGG + Intronic
1202631081 1_KI270706v1_random:257-279 TTTTAACAAAATTACGTAGGGGG - Intergenic
1202657597 1_KI270708v1_random:37890-37912 TTTTAACAAAATTACGTAGGGGG - Intergenic
925310938 2:2881098-2881120 TTTTAGGAAAATGGCCTTGGTGG - Intergenic
926733216 2:16053067-16053089 TTTTGGAAAGATCACTTTGGTGG + Intergenic
926883340 2:17573370-17573392 TTCTAGTAAAATTACTATGGAGG + Intronic
926931180 2:18042654-18042676 TTTTAGAAAAGTCACTCTTGGGG - Intronic
926983242 2:18593846-18593868 TTTTAGAAAGATCTCTTTAGTGG - Intergenic
927211094 2:20639507-20639529 TTTTAATAAAATCACCTTGTAGG + Intronic
927313892 2:21659942-21659964 TTTTAGGATATTGACTTTGGTGG + Intergenic
927523463 2:23716971-23716993 TTTCACCAAAATAACTTAGGAGG + Intergenic
929341829 2:40828728-40828750 TTTTACAAATATAACTTTGGGGG - Intergenic
929711783 2:44273635-44273657 TATAAGAAAAATGACTTTGGGGG - Intergenic
930166629 2:48209757-48209779 TTTTAGAAAAAGCACTCTGAGGG + Intergenic
931819823 2:65940554-65940576 TTTTAGGAACATCACATTGAAGG - Intergenic
932300054 2:70660488-70660510 TTTTAGGAAAATCCCTTTGGTGG - Exonic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933781685 2:85807017-85807039 TTTTGGAAAGATCACTTTGGTGG + Intergenic
935178054 2:100666491-100666513 TTTTAGCAAAATAACTTAAAAGG + Intergenic
935315828 2:101832953-101832975 TCTTAGCAAAATCACTGCTGGGG + Intronic
935461807 2:103344907-103344929 TTATAGCAAAATGACATTGATGG - Intergenic
935538324 2:104320566-104320588 TTTTAGCCAAATCTGTTAGGAGG - Intergenic
936021517 2:108998609-108998631 TTTTAGATAAATCACTGTAGAGG - Intergenic
936469196 2:112783490-112783512 TTTTAGAAAAATTATTTTTGAGG - Intronic
936647037 2:114384100-114384122 TTTCAGAAAAATCACCCTGGGGG + Intergenic
936702879 2:115034925-115034947 TTTTAGCAAGATAACTCTGTAGG - Intronic
937175689 2:119931858-119931880 TTTTTCCAAAAACATTTTGGAGG - Intronic
937703811 2:124894873-124894895 TTATATAAAAATCACTTTGTTGG - Intronic
937756519 2:125545803-125545825 TATTAGCAAAAACACTCTGTAGG - Intergenic
938571061 2:132562253-132562275 TTTTAAGAAAACCACTTTGGTGG - Intronic
939297629 2:140290296-140290318 TTATAGCAGATGCACTTTGGAGG + Intronic
940060146 2:149556818-149556840 TTTTAGGAAAATATATTTGGGGG + Intergenic
940441948 2:153726466-153726488 TTTTATCAAATTTACTTTGCAGG - Intergenic
941994108 2:171585326-171585348 TTTTAGGAAATTGAATTTGGAGG + Intergenic
942157399 2:173144795-173144817 TTGTAGAAAAATCAAATTGGAGG + Intronic
942625488 2:177896009-177896031 TTCCATCAATATCACTTTGGAGG + Intronic
942919907 2:181359926-181359948 TTTTGGCCAAATCACTTTTTAGG + Intergenic
943011879 2:182460122-182460144 TTTTAGGAAAGTCACTCTTGTGG - Intronic
943850291 2:192711933-192711955 TGTTAACAAAATAATTTTGGTGG + Intergenic
943918835 2:193675944-193675966 TTATAGATAAATCAGTTTGGGGG - Intergenic
944382653 2:199129432-199129454 TTTCATCAGAATCACTTTGTGGG - Intergenic
944469856 2:200041476-200041498 TTTTAGACAAATCACTGTGGTGG - Intergenic
944500016 2:200349804-200349826 TTTCAGCAAATTCAGTTTGTTGG + Intronic
945177724 2:207060402-207060424 TTTTCACATAATCACTTTGGTGG + Intergenic
945363776 2:208926167-208926189 TTTTAGTAAAATCACTTTGTGGG - Intergenic
945696071 2:213106221-213106243 TTTTAAAAAAATCTCTTTTGTGG + Intronic
946781455 2:223196034-223196056 TTTTTAAAAACTCACTTTGGGGG + Intronic
947021569 2:225683181-225683203 TTTCAGCAAAAACTTTTTGGTGG + Intergenic
948162752 2:235838340-235838362 TTTTAGCAAAATCACTTTGGAGG - Intronic
948726880 2:239939528-239939550 TTTAAGGAGAATCATTTTGGGGG + Intronic
1168746222 20:244079-244101 TTTTGGCAAAATAGCTTTGAAGG - Intergenic
1169869410 20:10235318-10235340 TTTTAGAAAAACCACATTTGTGG + Intronic
1169898854 20:10533203-10533225 TTTAAGGTAAATCACTCTGGTGG + Intronic
1170577083 20:17672205-17672227 TTTTAGGAAATTCACTCTGTAGG + Intronic
1171944230 20:31361750-31361772 TTTTAGTAAGATGAATTTGGGGG + Intergenic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1172964272 20:38822934-38822956 TGTTAGCAATACCACTTTCGTGG + Intronic
1173208117 20:41010734-41010756 TTATAGCCAAATCCCTTTTGAGG + Intergenic
1173766323 20:45613335-45613357 TTTGAGCAGAGTCATTTTGGTGG - Intronic
1174464555 20:50707234-50707256 TTTTAGAAGGATCACTGTGGAGG + Intergenic
1175868849 20:62197693-62197715 TTTTTAAAAAATCACTTTGCTGG + Intronic
1176643307 21:9326197-9326219 TTTTAACAAAATTACGTAGGGGG - Intergenic
1176875630 21:14124182-14124204 TTGTAGCACCATCATTTTGGTGG - Intronic
1176996776 21:15563992-15564014 TTTTAGCAAAATTAATTCGTAGG - Intergenic
1177544797 21:22543191-22543213 TTTTAGCTAAAACACTGTTGAGG + Intergenic
1177613198 21:23481351-23481373 TTTGACCAAAATAACTCTGGGGG + Intergenic
1177763482 21:25429993-25430015 TTTTAGAAATATCACTTTGGAGG - Intergenic
1177881236 21:26697244-26697266 TTTTAGAAACATTAATTTGGTGG - Intergenic
1178751669 21:35310403-35310425 TATTTGCAATATCACTTTGAGGG - Intronic
1180369629 22:11973019-11973041 TTTTAACAAAATTACGTAGGGGG + Intergenic
1180376609 22:12099086-12099108 TTTTAACAAAATTACGTAGGGGG - Intergenic
1181841027 22:25661100-25661122 TTTTTGAAAAATCTCTTTGCAGG + Intronic
1181844324 22:25694449-25694471 GTTGAGAAAAATCACTTAGGAGG - Intronic
1184548758 22:45192447-45192469 TTTTAGCAAAAACACGATGCTGG - Intronic
949449693 3:4171991-4172013 TTTTAGAAAGATCACATTGAAGG + Intronic
949920826 3:8999213-8999235 TTTTAGGAAAATCACTCCAGTGG + Intronic
949980050 3:9496775-9496797 TTTTAGAAAGAGCACTCTGGTGG - Intergenic
951295529 3:20929207-20929229 ACATATCAAAATCACTTTGGAGG + Intergenic
951723835 3:25733062-25733084 TTTTAGCAGAATCACAGTGCTGG + Intronic
951983606 3:28593214-28593236 TTTTAACAAAGTCAATTTGTGGG - Intergenic
953117612 3:40008765-40008787 TTTCAGCAATATCACTCTTGGGG - Intronic
954500036 3:51004218-51004240 TTTTGGATAAATCACTCTGGGGG + Intronic
955954831 3:64278069-64278091 TTTTAGGCACATTACTTTGGAGG + Intronic
956202574 3:66721568-66721590 TTTTAAAAAAATAATTTTGGGGG - Intergenic
957096760 3:75784382-75784404 TTTTAACAAAATTACGTAGGGGG + Intronic
957319628 3:78612829-78612851 ATTTTGCATAATCACTTTTGCGG + Intronic
958929502 3:100193808-100193830 TTTTAAAAAAATCAATTTTGGGG - Intronic
958999196 3:100941875-100941897 TTTTAGCATAATCAGATTGAGGG - Intronic
959467545 3:106706973-106706995 GTTTATCCAAATCACTTTTGAGG - Intergenic
959540846 3:107536427-107536449 TTTTAGCAAAGTAGCTTTTGTGG + Intronic
959819357 3:110714031-110714053 TTTTTGCAAAATCACTATCCTGG - Intergenic
959827316 3:110813891-110813913 AGTTAACAAAGTCACTTTGGAGG - Intergenic
959832363 3:110879890-110879912 TTTTAGCAAACTGATTTTGCTGG + Intergenic
962776743 3:138668101-138668123 TTCTAGCAAAATGAGGTTGGGGG + Intronic
963676778 3:148322142-148322164 TTTAAGCAGAAACATTTTGGAGG - Intergenic
964368338 3:155972577-155972599 TTTTAGGAAAATCACATAAGTGG + Intergenic
964541968 3:157789665-157789687 TTTTAGAAAGATGACCTTGGCGG - Intergenic
964797917 3:160519875-160519897 TTGTATCAAAATAAATTTGGAGG + Intronic
965124520 3:164608333-164608355 TTTTAGCAAAAGAAGTTTGCTGG - Intergenic
965411539 3:168337825-168337847 TTTCTGCCAAATCACTTTGATGG - Intergenic
965666918 3:171105069-171105091 TTTTATAAAAATTAATTTGGGGG - Intronic
966566256 3:181384806-181384828 TTTTAGAAAGATCACTTAAGCGG - Intergenic
966731676 3:183156725-183156747 TTCTCTCAAAAACACTTTGGTGG + Intronic
1202743577 3_GL000221v1_random:78832-78854 TTTTAACAAAATTACGTAGGGGG + Intergenic
969958521 4:10918027-10918049 TTTTTGCAAAAAGAATTTGGAGG + Intergenic
971798886 4:31262523-31262545 TTTTAGAAAGACCACTTTTGGGG + Intergenic
973949083 4:55992582-55992604 TTTTAGGAAGCTAACTTTGGTGG + Intronic
974004966 4:56546611-56546633 TTTTAGAAAACACACTTTTGAGG - Intronic
974474800 4:62364846-62364868 TTTATGCAAAATCGCCTTGGAGG - Intergenic
974689334 4:65275108-65275130 TTTTAATAAAATCATTATGGTGG + Intergenic
974811511 4:66952297-66952319 TTTTACCAAAATCAGTCAGGAGG - Intergenic
974918814 4:68210879-68210901 TTTTAAAAAAATCACTTTCTTGG - Intergenic
975347018 4:73303542-73303564 GTGTAGCCAAATCACCTTGGAGG - Intergenic
975415981 4:74105010-74105032 TTTTAGCAAAATAACTTTTGTGG + Intergenic
976774105 4:88688355-88688377 TTTTAGAAAGATTACTTTGGGGG + Intronic
977135482 4:93298514-93298536 TTTTAGCACAATCACATTGGTGG + Intronic
977653993 4:99501058-99501080 TTTTAACATGATCACCTTGGGGG + Intergenic
978034148 4:103973837-103973859 TTTGATCATTATCACTTTGGAGG - Intergenic
978037529 4:104014075-104014097 TTTTAGGAAGATAACTCTGGTGG + Intergenic
978274361 4:106931413-106931435 TTTTTTCAAAATTATTTTGGGGG - Intronic
978779075 4:112531058-112531080 TGTTAGAAAAATCATTCTGGTGG + Intergenic
979601864 4:122594200-122594222 TTTTGGCAAAATCAAATTGAGGG - Intergenic
979642417 4:123024543-123024565 TCCCAGCAAAGTCACTTTGGAGG + Intronic
979927481 4:126584934-126584956 TGTTTGCAAAATCTCTTTGAGGG + Intergenic
980066842 4:128198736-128198758 TTTTAGGAAGATAACTTTGGTGG + Intronic
980834807 4:138177984-138178006 TTTTAGGAGAATCACCCTGGGGG - Intronic
981401838 4:144322327-144322349 TTTCTGCAAAAGCACTCTGGTGG - Intergenic
981563250 4:146070077-146070099 TTTTAATACTATCACTTTGGGGG - Intergenic
982030990 4:151300722-151300744 TTTTATAAAAATTGCTTTGGTGG + Intronic
983168899 4:164513402-164513424 TTTTAGCACAATTACTCTGGTGG + Intergenic
983839859 4:172443956-172443978 TTTTAGATAAATCACCTTGGTGG + Intronic
984935942 4:184889411-184889433 TTTTAAGAAATTTACTTTGGAGG - Intergenic
1202758213 4_GL000008v2_random:84519-84541 TTTTAACAAAATTACGTAGGGGG - Intergenic
986843959 5:11731608-11731630 TTTTGGCAAAGTAACATTGGAGG + Intronic
986944739 5:13002354-13002376 TTTTAGGAAAAACACTTTTTAGG - Intergenic
987759800 5:22147174-22147196 TTTTAGCAAAATTAATTTCCAGG + Intronic
988579527 5:32456783-32456805 GTTCAGGAAAATCACTCTGGTGG - Intergenic
988624988 5:32865266-32865288 TTTATGCAAAATTAGTTTGGAGG - Intergenic
988994497 5:36701671-36701693 TATTGGCAAAATCACTTGGTAGG + Intergenic
989233531 5:39116195-39116217 TTTTTGCAGAATCACTTTATGGG + Intronic
989424035 5:41274977-41274999 TTTTATAAAAATGACTTTGGTGG - Intergenic
989555822 5:42793403-42793425 ATATAGCAAAATCTCTTTTGAGG - Intronic
989772573 5:45162227-45162249 TGTTTCCAAAATTACTTTGGAGG + Intergenic
991894529 5:71380602-71380624 TTTTAGCAAAATTAATTTCCAGG + Intergenic
991938903 5:71831195-71831217 TTTTACCCAAATCACTTTTCAGG - Intergenic
993701336 5:91122546-91122568 TTTTGGGAAAATTATTTTGGGGG + Intronic
993867262 5:93210450-93210472 CTTTAATAAAATCACTTTGGGGG - Intergenic
994474665 5:100251348-100251370 TTGTGGCAAAATCACTTTAATGG - Intergenic
994548498 5:101202497-101202519 TTTTAGCAGACTCACTTTGGTGG + Intergenic
995226429 5:109706330-109706352 CTTTTGAAAAATCACTTTGAAGG - Intronic
995889227 5:116932199-116932221 TTTTAATAAAGTCTCTTTGGAGG - Intergenic
996178291 5:120387212-120387234 TCTTAATAACATCACTTTGGGGG + Intergenic
996443164 5:123513177-123513199 GGTTAGCAAAATCACTCTGATGG + Intronic
997049941 5:130368037-130368059 TTTTTTTAAAATTACTTTGGGGG + Intergenic
998137795 5:139683562-139683584 TTTTTCCAAAATCACTGTTGGGG - Exonic
998445806 5:142197578-142197600 TATTAGCAAAATTCCTTTGCAGG + Intergenic
999214234 5:149918450-149918472 TGTTAGCAAACTCTCTTTGCAGG - Intronic
999676769 5:154012029-154012051 TTTTAGAAAGATCACTTTGGTGG + Intronic
1000569661 5:162895994-162896016 TGTTGGCAAAAACACTTTAGCGG - Intergenic
1001122112 5:168989337-168989359 TTGTAGAAGAATCACTTGGGTGG - Intronic
1001254575 5:170173624-170173646 TTTTATTAAAATAAGTTTGGGGG - Intergenic
1002003147 5:176209925-176209947 GTTTAGCACAATCCCCTTGGTGG - Intergenic
1002179777 5:177425208-177425230 TTTTAAAAATATCACTCTGGTGG - Intronic
1004032030 6:11879996-11880018 TTTTAGAAAAATCACCATAGTGG + Intergenic
1005049233 6:21667788-21667810 TTGTAGAAAAAGCATTTTGGGGG + Intergenic
1005180397 6:23097796-23097818 TTTTTGCAAAATCTCTCAGGGGG - Intergenic
1005822234 6:29607438-29607460 TTTTAGCAAGATCACCCTGGTGG - Intronic
1006607778 6:35271279-35271301 TATTGGCAAAATCTCTATGGAGG - Intronic
1006905423 6:37530050-37530072 TTTTAGGATACTCACTCTGGTGG - Intergenic
1007192195 6:40028939-40028961 AGTTAGAAAAAGCACTTTGGGGG + Intergenic
1008289553 6:49697017-49697039 TTTAAAGAAAATGACTTTGGAGG + Intronic
1009652693 6:66496512-66496534 TTTTAACAAAATCTCTAAGGTGG + Intergenic
1009894870 6:69735717-69735739 TTTTAACAGTATCACTCTGGTGG - Intronic
1009914097 6:69971339-69971361 CTTTAGCAAAATAATTTTGATGG + Intronic
1010255241 6:73749895-73749917 TTTTAGGAAGATCACTTTGGTGG + Intronic
1010405275 6:75497683-75497705 TTTTAACAAATTCACTTTTGGGG - Intergenic
1011183983 6:84653749-84653771 TTTTAGCACTATCACCTTGGGGG + Intergenic
1011793586 6:90927455-90927477 TTTTAGAAGGATCACTCTGGTGG + Intergenic
1012265068 6:97131802-97131824 TTTTTGCAAAATGATTTTTGAGG + Intronic
1012808631 6:103928594-103928616 TTTTTGCAACATAACTTTGAAGG - Intergenic
1012985147 6:105867654-105867676 GTTTAGAAAAATCACTTTCAAGG + Intergenic
1013405080 6:109836437-109836459 TTTTAACAAAATCAACTTGCTGG + Intergenic
1013929375 6:115512720-115512742 TTTTATCAAAATTAATTTGTTGG - Intergenic
1014576916 6:123085079-123085101 TTTAAGCAAAATCACTTTATAGG + Intergenic
1014993727 6:128115009-128115031 TTTTAGGAATATCACCCTGGGGG - Intronic
1015525653 6:134173787-134173809 TTTTAAAATAACCACTTTGGAGG + Intronic
1016142402 6:140628416-140628438 TTTTATCATGATTACTTTGGAGG + Intergenic
1017647522 6:156552680-156552702 TTCTAGGAAAATTTCTTTGGTGG - Intergenic
1017955599 6:159175015-159175037 TTGTAGCAAAATAACTTGAGAGG + Intronic
1018163244 6:161068585-161068607 TTGGAACAAAATCACTTTGTGGG + Intronic
1018167798 6:161115964-161115986 TTTTAGAAAGATCACTCTAGAGG + Intronic
1018283892 6:162216859-162216881 AGTAAGGAAAATCACTTTGGGGG + Intronic
1018966408 6:168493335-168493357 CTTTAACTAAATCACTTTTGAGG - Intronic
1021384636 7:20013364-20013386 TTAAGGCAATATCACTTTGGTGG - Intergenic
1021778114 7:24073677-24073699 TTTTAGCAAAAGTGCTTTGGAGG + Intergenic
1021848250 7:24783612-24783634 TTTTAGAAAAATCACTCTGGTGG + Intergenic
1021892369 7:25198339-25198361 TTTTAGAAAAATCTCCCTGGTGG - Intergenic
1023710176 7:42984083-42984105 TTTCAGAAGAATCATTTTGGTGG + Intergenic
1024104939 7:46073747-46073769 TTTGAGAAAAATCGCTTAGGTGG + Intergenic
1024391958 7:48824698-48824720 GTTTATCAAAATCACTTATGAGG + Intergenic
1026216900 7:68357702-68357724 TTTTAGAAAGATCATTTTGTTGG + Intergenic
1027151635 7:75738166-75738188 TTGTGGGAAAATTACTTTGGGGG - Intronic
1027406244 7:77864343-77864365 TTTAAGATAAATCACTCTGGTGG - Intronic
1027503495 7:78984955-78984977 TTTAAGAAAAATCCATTTGGAGG - Intronic
1027743186 7:82038774-82038796 TTTTAGAAATATCACTTTAGAGG + Intronic
1028520958 7:91730171-91730193 TTTTAGCAAAAATGCTCTGGAGG - Intronic
1029882919 7:103835879-103835901 TTTTAGAAAGATCACTCTGGTGG - Intronic
1029883066 7:103837219-103837241 TTTTAGAGAAATCATTTTGATGG - Intronic
1031070508 7:117156341-117156363 TTTTAGCCTAATCAACTTGGTGG + Intronic
1032354234 7:131195007-131195029 TTTTTGCGAGATAACTTTGGAGG - Intronic
1032621055 7:133532788-133532810 TTTTAGAAAATTTACTTTTGAGG + Intronic
1032809746 7:135400314-135400336 TTTTAGAAAGATTAATTTGGTGG + Intronic
1033093887 7:138412870-138412892 AATTAGTAAAACCACTTTGGGGG + Intergenic
1034166898 7:149032197-149032219 TTTTATAAAGATCACTCTGGGGG + Intergenic
1034928443 7:155141634-155141656 TGTTAGCAATAGCACTTTGAAGG + Intergenic
1035176613 7:157056419-157056441 CTTTCGGAAAGTCACTTTGGAGG - Intergenic
1036099693 8:5765536-5765558 TTATATCAAAATTACTTTGAGGG - Intergenic
1036279453 8:7387317-7387339 TTTTAAGAATAGCACTTTGGAGG + Intergenic
1036342066 8:7924560-7924582 TTTTAAGAATAGCACTTTGGAGG - Intergenic
1037252379 8:16911645-16911667 CTTTAGGCAGATCACTTTGGTGG - Intergenic
1038146580 8:24902632-24902654 TTTTAGCAAAAATAGTGTGGAGG - Intergenic
1040811255 8:51456140-51456162 TTTTAGAAAAATGTCTCTGGTGG - Intronic
1041087306 8:54268753-54268775 ATTTAGCAAAGTGACCTTGGAGG - Intergenic
1042255172 8:66795406-66795428 TTTTAGCAGTATCACATTGAAGG + Intronic
1042828525 8:73002510-73002532 TTTAAGAAAAAACAATTTGGGGG - Intergenic
1043252101 8:78087793-78087815 TTTTAGGAGGATCACTTTGATGG + Intergenic
1043627602 8:82282133-82282155 TTTCAGCACAAGAACTTTGGGGG + Intergenic
1044107448 8:88228406-88228428 GTTTATAAAAATCACTTTGATGG - Intronic
1046182145 8:110664548-110664570 TTTTAAAAAAATCAATTTGCTGG + Intergenic
1046284766 8:112080191-112080213 TTTTAATATAATCATTTTGGAGG - Intergenic
1046583702 8:116124710-116124732 TTTTATAAAAATCACTATGAGGG - Intergenic
1046844708 8:118902944-118902966 TTTTAGAAAAATCATTCTAGAGG - Intergenic
1047304547 8:123642345-123642367 TTTTAAAAAGATCACTCTGGCGG + Intergenic
1048157811 8:131977388-131977410 TTTTAGCCCAGTGACTTTGGTGG - Intronic
1048193799 8:132315101-132315123 TTTTAGGAAGATCACTTAGCTGG + Intronic
1048233541 8:132667805-132667827 TATCAGCAAAATGACTTTGCAGG + Intronic
1048533314 8:135270525-135270547 TTTTTGAAAAATCCCTTTGATGG + Intergenic
1049046174 8:140153700-140153722 CTTTAGAAAAATCACTGTGCTGG - Intronic
1049854923 8:144855468-144855490 TCGAAGCAAAATCACTGTGGTGG + Intergenic
1050435708 9:5607862-5607884 GTTTAGCAACATCATGTTGGTGG - Intergenic
1050772654 9:9221722-9221744 TTCTAGCATATACACTTTGGAGG + Intronic
1053240860 9:36493851-36493873 TTTTTGAAAAATCTCTTTGTTGG - Intergenic
1053382787 9:37662347-37662369 TTTTAGCACATGAACTTTGGGGG + Intronic
1053391459 9:37739390-37739412 TTTGAGAAAGATCACTCTGGAGG + Intronic
1055209682 9:73775693-73775715 TTTTAGCAAAAGCACTTTATAGG - Intergenic
1056839501 9:89987038-89987060 ATCTAGCTAAATCACTTTTGTGG + Intergenic
1057512106 9:95689255-95689277 TTTTAGCAAAATGAATTTCCTGG - Intergenic
1057887496 9:98841316-98841338 TTTTGGCAAGAACACTTTGTGGG + Intronic
1058601055 9:106670729-106670751 TTTTAGTAAACTCACTCTGGTGG - Intergenic
1058602655 9:106687154-106687176 GTTGAACAAAATCCCTTTGGGGG + Intergenic
1058679800 9:107430934-107430956 GTTCTGCAAGATCACTTTGGAGG + Intergenic
1058825124 9:108768755-108768777 CTTTAGTAAAATCAATGTGGGGG - Intergenic
1060684290 9:125594221-125594243 TTTGAGAAAAATCACATTGGTGG - Intronic
1060866145 9:126999283-126999305 TTTTAACAAATCCACTCTGGGGG - Intronic
1061168378 9:128937751-128937773 TTGCAGCAACCTCACTTTGGCGG + Intronic
1203712212 Un_KI270742v1:108796-108818 TTTTAACAAAATTACGTAGGGGG + Intergenic
1203539001 Un_KI270743v1:69391-69413 TTTTAACAAAATTACGTAGGGGG - Intergenic
1186108552 X:6231108-6231130 TTTTAGGACAATCACTGTGATGG + Intergenic
1186258553 X:7750270-7750292 TTTTCAGAAAGTCACTTTGGGGG - Intergenic
1187558968 X:20382016-20382038 TTTTAGGAAAATCAGTCTGGAGG - Intergenic
1187705530 X:22005997-22006019 TTTGAGCAAAATGAATTTGCGGG - Intergenic
1187828155 X:23353760-23353782 TTTTAGAAAAATAAGTCTGGTGG + Intronic
1188197600 X:27257030-27257052 ATTTAGCAAAATCATTTTAATGG - Intergenic
1188308471 X:28587351-28587373 TTTTTGAAAAATCATTTTTGGGG + Intergenic
1189059224 X:37735221-37735243 ATTTAGCTAAATCAATTTTGAGG + Intronic
1189075188 X:37906935-37906957 TTTTAGAAAAATCATTTTGGTGG + Intronic
1189692242 X:43629347-43629369 TTGAGGCAAAATCTCTTTGGTGG - Intergenic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1190937707 X:55011485-55011507 TTTTAGAAAAATCCCTCTAGTGG + Intronic
1192089525 X:68138969-68138991 TTTTGGCAAAAATACTTTAGAGG - Intronic
1193254328 X:79328735-79328757 TATTATCAAAATCACTTTCTAGG + Intergenic
1193531630 X:82661258-82661280 TTTCAGCAAATTCATTTTGGTGG + Intergenic
1193701581 X:84769017-84769039 TTTAAGTAAATTCCCTTTGGGGG - Intergenic
1195201981 X:102561018-102561040 TGTTAATAAAATCAATTTGGTGG + Intergenic
1196052976 X:111324983-111325005 TTTTAGAAGAATCAGATTGGAGG + Intronic
1196059517 X:111392222-111392244 TTTTAGAAACATGAGTTTGGTGG + Intronic
1196073981 X:111554468-111554490 ATTTAGCAAAAACAGTTTAGTGG + Intergenic
1196112224 X:111958952-111958974 TTTTAGAAGAATCATTTTGCAGG - Intronic
1196615910 X:117767080-117767102 TTTTAGAAATATCATTCTGGTGG + Intergenic
1196637277 X:118017077-118017099 TGCTAGAAAGATCACTTTGGTGG - Intronic
1196771210 X:119295896-119295918 AATTAGCACAATCACTATGGAGG - Intergenic
1196905686 X:120431621-120431643 TATTTGGAAAATCACTTTTGTGG - Intronic
1200385902 X:155890677-155890699 CTTTAGAAAGATCACTCTGGTGG + Intronic
1201488867 Y:14520322-14520344 TTTTAGGACAATCACTGTGATGG - Intergenic
1201490166 Y:14532320-14532342 TGTTGGCAAAATCACTTCTGTGG + Intronic
1201633485 Y:16096182-16096204 TCTTAACACCATCACTTTGGAGG - Intergenic
1202305696 Y:23468007-23468029 TTTTAGGAAAATAAATTTGGTGG - Intergenic
1202565113 Y:26202582-26202604 TTTTAGGAAAATAAATTTGGTGG + Intergenic