ID: 948163517

View in Genome Browser
Species Human (GRCh38)
Location 2:235844021-235844043
Sequence GAGTCCCCAAAGGACCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948163506_948163517 26 Left 948163506 2:235843972-235843994 CCGCTGCCCCAGCTCAGAGCTTG 0: 1
1: 0
2: 7
3: 53
4: 512
Right 948163517 2:235844021-235844043 GAGTCCCCAAAGGACCACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
948163515_948163517 -5 Left 948163515 2:235844003-235844025 CCTCTTGGAATCTGGCAGGAGTC 0: 1
1: 0
2: 0
3: 21
4: 216
Right 948163517 2:235844021-235844043 GAGTCCCCAAAGGACCACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
948163514_948163517 -4 Left 948163514 2:235844002-235844024 CCCTCTTGGAATCTGGCAGGAGT 0: 1
1: 0
2: 1
3: 17
4: 173
Right 948163517 2:235844021-235844043 GAGTCCCCAAAGGACCACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
948163509_948163517 18 Left 948163509 2:235843980-235844002 CCAGCTCAGAGCTTGAACCTCTC 0: 1
1: 0
2: 0
3: 18
4: 153
Right 948163517 2:235844021-235844043 GAGTCCCCAAAGGACCACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
948163507_948163517 20 Left 948163507 2:235843978-235844000 CCCCAGCTCAGAGCTTGAACCTC 0: 1
1: 1
2: 2
3: 25
4: 219
Right 948163517 2:235844021-235844043 GAGTCCCCAAAGGACCACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
948163508_948163517 19 Left 948163508 2:235843979-235844001 CCCAGCTCAGAGCTTGAACCTCT 0: 1
1: 0
2: 1
3: 16
4: 186
Right 948163517 2:235844021-235844043 GAGTCCCCAAAGGACCACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
948163512_948163517 1 Left 948163512 2:235843997-235844019 CCTCTCCCTCTTGGAATCTGGCA 0: 1
1: 0
2: 2
3: 30
4: 337
Right 948163517 2:235844021-235844043 GAGTCCCCAAAGGACCACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
948163505_948163517 27 Left 948163505 2:235843971-235843993 CCCGCTGCCCCAGCTCAGAGCTT 0: 1
1: 0
2: 3
3: 43
4: 343
Right 948163517 2:235844021-235844043 GAGTCCCCAAAGGACCACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948163517 Original CRISPR GAGTCCCCAAAGGACCACCC AGG Intronic
901038823 1:6352086-6352108 AACTCCCCAACTGACCACCCAGG + Intronic
902215957 1:14934734-14934756 CAGCCCCCAAATGACCACTCTGG - Intronic
902687665 1:18089464-18089486 GAGACCCCAATGCACCCCCCAGG + Intergenic
903705399 1:25281787-25281809 GAGGCCCCCAAGGACCTCCATGG - Intronic
903721829 1:25411543-25411565 GAGACCCCCAAGGACCTCCACGG + Intronic
909208174 1:72788426-72788448 GAGTCCCTTAAGGACCTGCCAGG + Intergenic
912519521 1:110235539-110235561 CAGTCCCCTCAGGACCACTCTGG - Intronic
914256307 1:145962815-145962837 GAGTCCCCTAAGGAACACTTAGG - Exonic
920822698 1:209396194-209396216 AAGTTCCCCAAGGAACACCCAGG - Intergenic
921271321 1:213472980-213473002 GTGTCCCCAAAGCACCAGCATGG - Intergenic
922122119 1:222681814-222681836 GAATCCCCAGATGACCACCAAGG + Intronic
922786349 1:228284294-228284316 GAGTCCCCAAGGGACGGCACAGG + Intronic
923005733 1:230048208-230048230 GAGTAGCAAAAGGTCCACCCAGG + Intergenic
924724252 1:246653579-246653601 GAGCGCCCAAAGGAAAACCCAGG + Intronic
1063199558 10:3774748-3774770 GAGTGCTCAAAGGACAACACAGG - Intergenic
1063959883 10:11298263-11298285 GAGCCCCCACAGCAGCACCCTGG + Intronic
1064190473 10:13201570-13201592 GAGTCACAAAAGCACCACACAGG - Intronic
1071385288 10:85113387-85113409 GAGGCCACAGAGGAACACCCTGG - Intergenic
1071725392 10:88193338-88193360 GGGGAGCCAAAGGACCACCCAGG - Intergenic
1074044350 10:109823437-109823459 GTGTGCCCAGAGGACCACCCAGG - Intergenic
1074864393 10:117536452-117536474 GAGTTCCCAGAGGACCAGCATGG - Intergenic
1075451476 10:122554722-122554744 AAGTCACCAAAGCACCAGCCCGG - Intergenic
1076240961 10:128907121-128907143 GAGTGCCCCAAGTGCCACCCAGG + Intergenic
1076502911 10:130950994-130951016 GAATCCTCACAGGACCTCCCTGG + Intergenic
1076869263 10:133185597-133185619 GAGTCCCCACAGGAAGAACCTGG - Intronic
1077369438 11:2174599-2174621 GAGGCCCCAAAAGTCTACCCTGG + Intergenic
1077837642 11:5938359-5938381 GAGTCCCGGAAGGGTCACCCCGG - Intronic
1088924063 11:114282776-114282798 GAGTGCCGAAAGGACCACTGGGG + Intronic
1089460534 11:118650550-118650572 GAGTTCCCACAAGGCCACCCTGG + Intronic
1090683750 11:129091296-129091318 GAGCCCCTAAGGGAGCACCCAGG - Intronic
1090848051 11:130546770-130546792 GGGACCCCAAAGGACACCCCTGG + Intergenic
1092996567 12:13956658-13956680 GAGTCCCCAGAAGACCCTCCAGG - Intronic
1093562647 12:20560806-20560828 AAGTGCCAAAAGGACCACTCTGG - Intronic
1099918979 12:88933432-88933454 GATTGCCCACAGGACCATCCTGG - Intergenic
1100607821 12:96166132-96166154 GAGTCCCCAAAGCTGCTCCCTGG - Intergenic
1101100521 12:101387356-101387378 GAGACCCCCAAGTGCCACCCTGG + Intergenic
1102594489 12:113982027-113982049 GAGTCCCCCCAGGCCCAGCCAGG - Intergenic
1105575369 13:21646311-21646333 GTGTCCCCAAAGGGCCTCTCTGG + Intergenic
1107330264 13:39292175-39292197 GAGTCCCCAAATGGGCACCAAGG - Intergenic
1107482237 13:40794668-40794690 GATTGCCCAAAGGAAAACCCTGG + Intronic
1119614439 14:76089591-76089613 GTGTCCCCAAAGGACAGCACAGG + Intergenic
1122241778 14:100373337-100373359 GAGACCCCAAGAGACCAGCCTGG - Intronic
1122889767 14:104726879-104726901 CAGTCCCCAAAGGGTCACCTGGG + Intronic
1124902051 15:33833037-33833059 GAGTCTCCATAGGACCACGTAGG + Intronic
1125206961 15:37164309-37164331 GAGTGTCCTAAGGAGCACCCTGG + Intergenic
1127489053 15:59444864-59444886 GAGTCGACAAAAGACCACCAAGG - Intronic
1128797476 15:70476360-70476382 GACCCCCCAAAGGACCCCCTTGG + Intergenic
1131830856 15:96353902-96353924 GCGTCCCCAAAGGCCCAGCCAGG - Intergenic
1134440798 16:14298623-14298645 GAAGCCCCAGAGGCCCACCCTGG - Intergenic
1136597565 16:31262041-31262063 GTCTCCCCGAAGGAACACCCAGG - Intronic
1141392817 16:83678703-83678725 GTGTTCCCAAATGACCAGCCGGG + Intronic
1143166349 17:4899123-4899145 GAGGCTCCTAAGGCCCACCCCGG - Intronic
1148200817 17:45749056-45749078 GAGTTCCCAAGCGAGCACCCAGG - Intergenic
1148747484 17:49926888-49926910 GAGGCCCCAAAGGGCCATCTGGG - Intergenic
1150790189 17:68196734-68196756 GAGGCCCCCAACGCCCACCCAGG + Intergenic
1151722992 17:75868787-75868809 GAGGCCCACAAGGACCACCAGGG + Intergenic
1151748156 17:76022559-76022581 CAGTCCCCAAAGGACCGCGGTGG + Intronic
1151957385 17:77387182-77387204 GAGGCCCCAAAGGATCAGCCTGG - Intronic
1152099396 17:78292237-78292259 GGGCTCCCCAAGGACCACCCTGG + Intergenic
1152438454 17:80290052-80290074 GAGTTCCCAAAGGCCCACGCTGG - Intronic
1152666270 17:81571512-81571534 GTGTCCCCTGGGGACCACCCTGG + Intronic
1157564949 18:48673592-48673614 GAGTCCCCAAGGAGCTACCCTGG - Intronic
1160463910 18:79059667-79059689 GAGTCCCCAGAGGCCAGCCCAGG + Intergenic
1161381868 19:3969811-3969833 GAGTCCCCTAATGGCAACCCTGG + Exonic
1162247898 19:9417801-9417823 GTGTTCACAAAGGACCGCCCTGG - Intronic
1167509369 19:49888113-49888135 GAGCCCCCAGAGGGCCAGCCCGG + Intronic
926250535 2:11153309-11153331 GAGTGCCCCCAGGACCACGCAGG - Intergenic
929156653 2:38794329-38794351 GAGTCCCCACAGAGCCAGCCCGG - Intergenic
932164486 2:69493735-69493757 GAGTGCCCATGGGACCACACTGG + Intronic
932288370 2:70554732-70554754 AAATCCTGAAAGGACCACCCAGG - Intergenic
932401027 2:71481361-71481383 GGGCTTCCAAAGGACCACCCGGG - Intronic
932424283 2:71619431-71619453 GAGTCCCCAAACGTCCCTCCTGG + Intronic
932747037 2:74342457-74342479 GAGTACCCTGAAGACCACCCAGG - Exonic
934707895 2:96497494-96497516 GAGCGCCCAGAGGCCCACCCAGG + Intergenic
934779517 2:96960756-96960778 GAGTCAGGAATGGACCACCCAGG + Intronic
939455095 2:142423608-142423630 GTGCACCCAGAGGACCACCCAGG - Intergenic
946334857 2:219029841-219029863 GATTCCCCACAGGGCCACCAGGG + Intronic
948163517 2:235844021-235844043 GAGTCCCCAAAGGACCACCCAGG + Intronic
948173736 2:235927298-235927320 GAGTCCCCAAGGAACCAACCTGG - Intronic
948615712 2:239197444-239197466 CCGTCTCCAAAGGACCAGCCAGG - Intronic
1170075355 20:12412653-12412675 CAGTCCCCAAAAGATGACCCTGG + Intergenic
1171223392 20:23421060-23421082 GAGACCCCACAGGCCCCCCCAGG - Intronic
1172096982 20:32465311-32465333 CAGGCCCCAAAGCACCACCCAGG + Intronic
1172098879 20:32473962-32473984 CAGACCCCAAAGATCCACCCCGG - Intronic
1172977492 20:38918006-38918028 GGTTCCCCAAAGGAAAACCCTGG + Intronic
1174105726 20:48161072-48161094 GAGATCCCAGAGGACTACCCAGG + Intergenic
1174203726 20:48824909-48824931 CAGGCCTTAAAGGACCACCCTGG - Intronic
1174444336 20:50580297-50580319 CATTCCCCAAAGGACCACTGTGG - Intronic
1176591229 21:8652261-8652283 GAGCCCCCAAACCACCCCCCAGG - Intergenic
1179628753 21:42664027-42664049 GAGCCCCCAGAGGACGGCCCGGG + Intronic
1180274077 22:10629372-10629394 GAGCCCCCAAACCACCCCCCAGG - Intergenic
1182834038 22:33326948-33326970 CAGTCTCCAAAGGACCCTCCAGG - Intronic
1183398211 22:37585421-37585443 GTGTCCCTCCAGGACCACCCAGG + Intergenic
1184200655 22:42967070-42967092 GAGTACCCAGAGGACCATGCAGG + Intronic
952889445 3:38030522-38030544 GAGCCCCCAGAGGGCCTCCCAGG + Intergenic
962841668 3:139238363-139238385 GAGTCCCGAAAGGACTAGGCAGG - Intronic
966064943 3:175808660-175808682 AAGTCCCCAAAGGATCACACAGG + Intergenic
969134354 4:5018595-5018617 TAGTCCCCAAAAGCCCTCCCGGG + Intronic
969303702 4:6312721-6312743 GAGACACAAAAGGAACACCCGGG - Intergenic
971209264 4:24600250-24600272 GAGTCTCCCAAGGACCTTCCCGG + Intergenic
977574277 4:98659500-98659522 GATTCCCCAGAAGACCTCCCTGG - Intergenic
978152890 4:105458057-105458079 GAGTCCCCAAAGGCCAAAGCTGG + Intronic
983403165 4:167291321-167291343 GAGTCCTCAATGGAACTCCCAGG + Intergenic
985772056 5:1817871-1817893 GAGGCCCCAAAGCTCCACCCTGG + Intergenic
985882202 5:2646615-2646637 GAGGCCCCAAAACTCCACCCTGG + Intergenic
989158902 5:38371283-38371305 GAGGACCCAAAGGAGCAGCCGGG - Intronic
989342643 5:40393400-40393422 GAGACCCTGAAGGACCACTCGGG - Intergenic
1001747168 5:174100679-174100701 GATTCACCAAAGCACCACCAGGG - Intronic
1004320471 6:14627934-14627956 GTGTTCCCACAGGATCACCCTGG - Intergenic
1006445970 6:34079987-34080009 AAGTCCCCACAGGCCCCCCCAGG + Intronic
1007098936 6:39231395-39231417 CAGTCCCCTCAGGACCCCCCTGG + Intergenic
1008232917 6:49007126-49007148 GAGCTCCCAAAGGCCAACCCTGG - Intergenic
1008441668 6:51539020-51539042 CAGTCCCCAAAGGATCCCCTAGG + Intergenic
1019158424 6:170053745-170053767 GAGTCCCCACAGCTCCAGCCAGG + Intergenic
1019270281 7:143339-143361 GAGTCCACTAAGGCTCACCCAGG - Intergenic
1019294433 7:266468-266490 GAGTCCCAAAAGGACAGCCTGGG - Intergenic
1020192757 7:6013071-6013093 GAGTTCCTAAACCACCACCCTGG - Intronic
1021107976 7:16660836-16660858 GAGTTCACAAAGGACCTCCTGGG + Intronic
1023824495 7:44000039-44000061 GAGTCCCCAGCGGAGCACCTCGG + Intergenic
1026088045 7:67278803-67278825 GAGTCCCCAGCGGAGCACCTCGG + Intergenic
1026726196 7:72871470-72871492 GAGTCCCCAGCGGAGCACCTCGG - Intergenic
1027117646 7:75494137-75494159 GAGTCCCCAGCGGAGCACCTCGG + Intergenic
1027274154 7:76541348-76541370 GAGTCCCCAGCGGAGCACCTCGG - Intergenic
1028382202 7:90211957-90211979 GACTCCCCAAGGGCCCACCCGGG - Exonic
1029719852 7:102355912-102355934 GAGTCCCCAGCGGAGCACCTCGG - Intergenic
1029752761 7:102553345-102553367 GAGTCCCCAGCGGAGCACCTCGG + Exonic
1029770712 7:102652438-102652460 GAGTCCCCAGCGGAGCACCTCGG + Exonic
1035289324 7:157827619-157827641 GCGTCCACAAAGGACCCCTCCGG + Intronic
1042195529 8:66228587-66228609 GACTGCCCAAACGGCCACCCAGG - Intergenic
1042747351 8:72121768-72121790 GTATCCCCAAAGGACAACCAAGG - Intergenic
1052269212 9:26608833-26608855 GAGTCTCTAAAGGACTTCCCTGG + Intergenic
1052288528 9:26816118-26816140 GAGTCCCCAAAGGAAGAACGGGG + Intergenic
1055936310 9:81607705-81607727 AAGTGCCCCAAGGACCTCCCAGG + Intronic
1056050391 9:82762440-82762462 GAGACCACAAAGGACCAGCAGGG - Intergenic
1057068042 9:92073390-92073412 AAGGCCCCAAAGGACCTACCAGG + Intronic
1059766661 9:117389940-117389962 GAGACCCCAGAGGGCCTCCCTGG - Intronic
1060515599 9:124263804-124263826 GAGGCGCCACAGGGCCACCCTGG - Intronic
1062452172 9:136620394-136620416 CAGACCCCAAAGGCCCAGCCAGG + Intergenic
1190533690 X:51406496-51406518 GACGCCCGAAGGGACCACCCTGG - Intergenic
1193449602 X:81649589-81649611 GAGACGCCAGAGGACCACCTGGG + Intergenic
1195941232 X:110169530-110169552 GTGTCTGCAAAGGATCACCCTGG - Intronic
1197778848 X:130139714-130139736 CAGTCCCCAAGTGCCCACCCGGG - Intronic
1199287641 X:146071672-146071694 GTGTCCCCAAAGGACAACAGAGG + Intergenic
1202584402 Y:26408681-26408703 GGGCCCCCAAAGCACCCCCCGGG + Intergenic