ID: 948166477

View in Genome Browser
Species Human (GRCh38)
Location 2:235866539-235866561
Sequence TGCCATCAGTGTGCTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948166469_948166477 -6 Left 948166469 2:235866522-235866544 CCACCTCCCATGCTGGGTGCCAT 0: 1
1: 0
2: 1
3: 22
4: 271
Right 948166477 2:235866539-235866561 TGCCATCAGTGTGCTGGAGGGGG 0: 1
1: 0
2: 4
3: 20
4: 230
948166470_948166477 -9 Left 948166470 2:235866525-235866547 CCTCCCATGCTGGGTGCCATCAG 0: 1
1: 0
2: 1
3: 17
4: 197
Right 948166477 2:235866539-235866561 TGCCATCAGTGTGCTGGAGGGGG 0: 1
1: 0
2: 4
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948166477 Original CRISPR TGCCATCAGTGTGCTGGAGG GGG Intronic
900364262 1:2304417-2304439 CGCCCCCAGTGGGCTGGAGGCGG + Exonic
900569766 1:3352429-3352451 TGCCCGCAGTGGGCTGGGGGAGG + Intronic
902688133 1:18092217-18092239 TGTCCTGAGTGTGTTGGAGGAGG - Intergenic
902766007 1:18615778-18615800 TGTCAGCAGTGTTCTGAAGGAGG + Intergenic
903003434 1:20282633-20282655 TGCCATCAGTGAGCTGCCTGGGG + Intergenic
903028097 1:20443667-20443689 TGCCCTCAAGGAGCTGGAGGTGG - Intergenic
903928940 1:26851120-26851142 TGCCCTCACCGTGCTGGAGTTGG + Exonic
904378241 1:30095077-30095099 TGAGATCAGTGTCCTGGAGACGG - Intergenic
905153000 1:35947599-35947621 TGGCATGAGTGTGATGGTGGGGG + Intronic
905790721 1:40787864-40787886 TGAAGTCAGAGTGCTGGAGGGGG + Intronic
905866505 1:41379765-41379787 TCCCACCAGTCTCCTGGAGGAGG - Intronic
906568734 1:46818652-46818674 TGCCATGAGTGAGATGAAGGTGG + Exonic
906580433 1:46931004-46931026 TGGCTTCAGTGTGCTGGGAGGGG - Intronic
906708528 1:47912536-47912558 TCCCAAAAATGTGCTGGAGGTGG + Intronic
907571142 1:55485133-55485155 TGCCAGAAGTGTGCTGGGGAAGG - Intergenic
907722577 1:56985836-56985858 GGCCATCAGTGAGTTGGAGGAGG - Intergenic
909217331 1:72906924-72906946 TGTCATCAGTGTGCTTTTGGGGG + Intergenic
914245893 1:145885720-145885742 CGCCACCTGTGTGCTGGAGCAGG + Exonic
915172474 1:153987595-153987617 TGCTATATGTGTGCTGGGGGTGG + Intergenic
918046601 1:180945327-180945349 TGCCCTCAGTGTGGAGGACGTGG + Exonic
919093125 1:192997837-192997859 TGCCAGCAGTGGGCTGTTGGTGG + Intergenic
919918740 1:202155402-202155424 TGACAGCAGTGAGCTGGAGCAGG + Intronic
920038065 1:203078172-203078194 TGCCATCAGGTTGCTGGGAGTGG + Exonic
920051817 1:203168936-203168958 GGCCATAAATGTGCTGGGGGAGG - Exonic
921172330 1:212560605-212560627 TCCCAGAAGTGAGCTGGAGGCGG - Intergenic
921383472 1:214548256-214548278 GGCTGTCAGTGTGCTGGAGCAGG - Intronic
921437997 1:215149346-215149368 TGCCATGAGTGTTCGGGAGAAGG + Intronic
922823264 1:228499069-228499091 TGCCATCTTTTTGCTGGGGGAGG + Intergenic
1064855304 10:19760667-19760689 TGCTTTCAGAGTTCTGGAGGAGG - Intronic
1065875347 10:29993166-29993188 TGCCATCATTGTTCTGACGGTGG + Intergenic
1067528739 10:47055234-47055256 AGACATCATTTTGCTGGAGGTGG + Intergenic
1067544202 10:47181180-47181202 TGCCGTCCGAGGGCTGGAGGAGG + Intergenic
1068354147 10:55889277-55889299 TTCCATCGATGTGCTGGAGCTGG - Intergenic
1071574457 10:86715485-86715507 TGCTCTCAGGGAGCTGGAGGAGG + Intronic
1071600920 10:86958384-86958406 TGCCCTCCATGGGCTGGAGGGGG - Intronic
1071843067 10:89493049-89493071 TGCCAACAGTGAGCTGCAGGTGG + Intronic
1073624743 10:105085291-105085313 TTCCCTCTGTGGGCTGGAGGAGG + Intronic
1074418502 10:113287790-113287812 AGCCTTCAATGTGCTAGAGGGGG + Intergenic
1075165317 10:120063016-120063038 TGGTATCAGTGGGATGGAGGTGG - Intergenic
1075675759 10:124294723-124294745 TGCCAACACTGCTCTGGAGGTGG + Intergenic
1076215611 10:128691255-128691277 TTCCATCAGAGTGTGGGAGGAGG - Intergenic
1077187754 11:1243068-1243090 TGCCGTCCCTGGGCTGGAGGAGG - Exonic
1077188176 11:1244739-1244761 TGCCGTCCCTGGGCTGGAGGAGG - Exonic
1077188710 11:1246839-1246861 TGCCGTCCCTGGGCTGGAGGAGG - Exonic
1077189130 11:1248510-1248532 TGCCGTCCCTGGGCTGGAGGAGG - Exonic
1077189695 11:1250694-1250716 TGCCGTCCCTGGGCTGGAGGAGG - Exonic
1077283415 11:1755532-1755554 GGCCATCAGTGGTCTGGATGAGG - Intronic
1078590009 11:12632257-12632279 TGCCATGAGACTCCTGGAGGTGG - Intergenic
1079920423 11:26427289-26427311 TGCCATCAAGGTGCAGGTGGAGG - Intronic
1084565440 11:69925979-69926001 TGCCATCAGTGGGGTTGTGGGGG + Intergenic
1084643201 11:70438059-70438081 TGCTCTCAGCCTGCTGGAGGAGG + Intergenic
1084904201 11:72333661-72333683 TGTCATCAGTGTGCTGAAGGAGG + Intronic
1086494171 11:87385246-87385268 TGCCATCAGGGATCTGTAGGTGG + Intergenic
1088308636 11:108436813-108436835 TGCCATCTGAGTGCTGAGGGGGG + Intronic
1089495415 11:118906247-118906269 TGACATAAGTGAACTGGAGGTGG + Intronic
1090752607 11:129760479-129760501 GGCCATCAGAGAGCTGGGGGTGG - Intergenic
1091703656 12:2679752-2679774 TGCCATCCGGGTGCAGGAGGTGG + Exonic
1091805391 12:3352403-3352425 AGTCATCAGATTGCTGGAGGTGG - Intergenic
1094042669 12:26133950-26133972 TGAATTCAGTGTGGTGGAGGGGG - Intronic
1101182575 12:102235394-102235416 TTCCATCACTGTGGTGGAGTGGG - Intergenic
1104908602 12:132228671-132228693 TGCCTTCCGTGTGCAAGAGGAGG + Intronic
1105423275 13:20272032-20272054 TCCCATCTCTGTGCTGGAGATGG + Intergenic
1105602701 13:21901524-21901546 TTCCATGTGTTTGCTGGAGGAGG + Intergenic
1106880196 13:34120865-34120887 TTCAATCAGTTTGCTGTAGGAGG - Intergenic
1109128942 13:58556037-58556059 TTCCCACAGTGTGCTGGAGTTGG + Intergenic
1111966864 13:94870098-94870120 TGCCATCAAAGTGCTAGAGCTGG - Intergenic
1115682377 14:35755611-35755633 TGCCATAAGTGTTCTGTAGTGGG - Intronic
1119425693 14:74533502-74533524 TGTCTGCAGTGAGCTGGAGGAGG + Intronic
1122324968 14:100876337-100876359 TGACATCAGTGACCTGGGGGTGG + Intergenic
1124397306 15:29314450-29314472 TGTCATCTGTTTGCTGGTGGAGG - Intronic
1124504368 15:30260644-30260666 TGCTGGCAGTGTGCTGGAAGTGG + Intergenic
1124739183 15:32277991-32278013 TGCTGGCAGTGTGCTGGAAGTGG - Intergenic
1125877081 15:43158519-43158541 AGCCAGCAGTGTGCTGGAGCTGG - Intronic
1125993201 15:44130338-44130360 TGCCATCAGGGTCCTGGGGAAGG - Intronic
1126248165 15:46535683-46535705 TGTCATCAGTGTTCTGGATTTGG + Intergenic
1127397517 15:58554492-58554514 TAGCATCATTGTGCTGGGGGTGG + Intronic
1128305897 15:66598757-66598779 TGCCCTCAGAGTGCTGGGAGGGG + Intronic
1128650422 15:69408306-69408328 TTCCTTCTGTGTTCTGGAGGAGG - Intergenic
1129596517 15:76968564-76968586 TGCCATCAGTGAGGAGGAGATGG + Intergenic
1129946246 15:79541513-79541535 TGCCCTCAGGGTTCTGAAGGAGG + Intergenic
1132244663 15:100285077-100285099 TGCCAGCACCTTGCTGGAGGTGG + Intronic
1133269070 16:4601861-4601883 TGCCAGGAGGGAGCTGGAGGGGG + Intergenic
1134247886 16:12553506-12553528 TGCCATCACAGTGCTGGAGGAGG + Intronic
1134771872 16:16816128-16816150 TGCCAACACTGTCCTGGAGTAGG - Intergenic
1136402175 16:30024922-30024944 TGCCCTCAGTGGGTGGGAGGCGG + Exonic
1136930212 16:34411428-34411450 TGCTGTCAGGCTGCTGGAGGAGG + Intergenic
1136974362 16:35000377-35000399 TGCTGTCAGGCTGCTGGAGGAGG - Intergenic
1138103523 16:54273973-54273995 TGCCTTCAGTCTACTGGAAGTGG - Intergenic
1138157395 16:54718778-54718800 TGTGATCAGTGTCCTGGAGTTGG - Intergenic
1139360410 16:66395826-66395848 TGCCATCACTGGACTGGAGGTGG - Intronic
1139379361 16:66520931-66520953 AGCCATGAGTTTGCTGGAGTAGG - Intronic
1139583087 16:67884757-67884779 TCCCATCTGGGTGTTGGAGGCGG + Intergenic
1140245286 16:73242831-73242853 TGCCATCAGTGTGGAGGTGTGGG + Intergenic
1140898943 16:79350628-79350650 AGCCAACAGTGGGCTGGAGAGGG + Intergenic
1142116464 16:88358571-88358593 TTCCATCAGTGACATGGAGGAGG + Intergenic
1142380519 16:89729456-89729478 TTCCCTCAGTGAGCGGGAGGCGG + Intronic
1142557921 17:792112-792134 TCCCACCAGTGTGCTGGTGTAGG - Exonic
1143109238 17:4544195-4544217 TGCCAACAGTGCCCTGGAGCTGG - Intronic
1143109253 17:4544255-4544277 TGCCAACAGTGCCCTGGAGCTGG - Intronic
1143408716 17:6695868-6695890 TGCCCTCAAGGTGCTGCAGGAGG - Exonic
1144031865 17:11330237-11330259 TGCCACCAGGGACCTGGAGGAGG + Intronic
1144719120 17:17455456-17455478 AGCCGTCAGTGGGCAGGAGGAGG + Intergenic
1146787471 17:35732073-35732095 TGCCTGCAAGGTGCTGGAGGCGG + Intronic
1146922583 17:36723153-36723175 TAGCTTCAGTGTGGTGGAGGTGG + Intergenic
1147197865 17:38779707-38779729 TGCCAACAGGAGGCTGGAGGTGG - Intronic
1147390051 17:40103521-40103543 TGCAATCAGTGAGAAGGAGGAGG + Intergenic
1149567801 17:57652197-57652219 TGCCCCCAGTGTGCAGGGGGAGG + Intronic
1149858660 17:60107671-60107693 TGTCCTGAGTGTGCTGGAGCTGG + Intergenic
1151407244 17:73896586-73896608 TGCCCTCTGGGTGCTGGAGTCGG + Intergenic
1152220453 17:79061780-79061802 TGTCATCATTTTGCTGGTGGAGG - Intergenic
1153594717 18:6713699-6713721 TGCCAGTACTGTGCTGAAGGTGG - Intergenic
1157306204 18:46519386-46519408 TCCCATCATTGTCCTGGTGGGGG + Intronic
1158549908 18:58426932-58426954 AGCCATCATTATGGTGGAGGAGG - Intergenic
1160787809 19:909397-909419 TGCCAGCTGTGTCCTGGTGGGGG - Intronic
1160984021 19:1829130-1829152 TGCCAGCAGTGTGCCAGCGGTGG + Intronic
1161444651 19:4311362-4311384 TTCCATCAGTGGGTTGGGGGAGG - Intronic
1163138818 19:15332524-15332546 TGACGTCAGTGCGCTGGCGGCGG - Intronic
1164485638 19:28653500-28653522 TGCCCTCAGTGTCCTGAGGGAGG - Intergenic
1165721337 19:38081865-38081887 TGCCATCTGTGTCCTGGGAGGGG - Exonic
1166198403 19:41220888-41220910 TGCCCTCTGTGTGACGGAGGTGG - Intronic
1166336855 19:42113501-42113523 TGACATCAGAGGGCTGGAAGGGG + Intronic
1166661742 19:44651706-44651728 TGCCATGAGGGAGCTGGTGGAGG - Intronic
926006569 2:9377640-9377662 AGCCATGTGTGTACTGGAGGAGG + Intronic
927617411 2:24613421-24613443 TGCCATCAGGGGACTGTAGGTGG - Intronic
932099746 2:68887625-68887647 TGCCAGCGGGATGCTGGAGGGGG + Intergenic
932436817 2:71706588-71706610 TGCCATCTGTGTGTGGGAAGAGG + Intergenic
933971575 2:87474045-87474067 TGTCATCAGTCTGGTGGAGCAGG - Intergenic
935789993 2:106582197-106582219 TGCCATGCGTGGGGTGGAGGCGG - Intergenic
936322155 2:111476154-111476176 TGTCATCAGTCTGGTGGAGCAGG + Intergenic
936652551 2:114445501-114445523 GGCCAAAAGTGTGCAGGAGGAGG + Intronic
937724494 2:125145785-125145807 GGACCTCAGTGTGCTGGAGGAGG + Intergenic
938243784 2:129762212-129762234 TGCCAGCAGTGGGCAGGAGCTGG - Intergenic
939044288 2:137231700-137231722 TGCCAGCATTCTGCAGGAGGGGG + Intronic
943795775 2:191991646-191991668 TGCCATAAGTGTGCAGCAGCTGG - Intronic
944470753 2:200051177-200051199 TGCCAACAGTAAACTGGAGGTGG + Intergenic
948166477 2:235866539-235866561 TGCCATCAGTGTGCTGGAGGGGG + Intronic
948604758 2:239127836-239127858 TGGCATCAGTGTCCTGGGGGAGG - Intronic
1169475546 20:5928205-5928227 TGCCATCATTGTCCTGCAGGTGG + Intergenic
1170531371 20:17295919-17295941 TGCTATCAGCTTGCTTGAGGAGG - Intronic
1171088622 20:22262964-22262986 TGCCATCACTGTGCTGTACTTGG + Intergenic
1172622905 20:36331358-36331380 GGCCATCGGTGAGCTGGAGGAGG - Intronic
1172741655 20:37173122-37173144 TGCAATCAGTGTGATGGGGGTGG - Intronic
1173834282 20:46114940-46114962 TGAGAAGAGTGTGCTGGAGGAGG - Intergenic
1174474040 20:50783327-50783349 TGCCATCAGGGTGTTGGCTGGGG + Intergenic
1178106548 21:29325325-29325347 TGCCTTCTGTGTACTGGAGTTGG + Intronic
1178323297 21:31622584-31622606 TGTTATCTGTGTGCTGAAGGAGG - Intergenic
1178577430 21:33807295-33807317 TGTTATCAGTTTACTGGAGGGGG + Intronic
1178969375 21:37158182-37158204 TGCCATCAGTTTGCTGCTGCTGG + Intronic
1179885906 21:44314216-44314238 TGCCCCCAGTGGGCAGGAGGCGG + Intronic
1180916482 22:19492178-19492200 CGTCATCAGTGCCCTGGAGGAGG - Intronic
1181335424 22:22124894-22124916 TGCCAGCAGTGTGGGGGGGGGGG + Intergenic
1181462321 22:23093143-23093165 TGCCCACTGTGTGCTGGAGTGGG + Intronic
1181464151 22:23101853-23101875 TGCCATCAGGGTGCTGCTGTGGG - Intronic
1182113246 22:27739411-27739433 TGTCCTTAGTGAGCTGGAGGAGG - Intergenic
1182323627 22:29494875-29494897 TGCAATCAGGGTGTTGGATGGGG - Intergenic
1182706218 22:32282220-32282242 GGTCAAGAGTGTGCTGGAGGGGG - Intergenic
1184657681 22:45950025-45950047 TGCCATCATTGTGATTGGGGAGG - Exonic
1184926905 22:47648747-47648769 AGCCATCAGGGTGTTGGTGGAGG + Intergenic
952055311 3:29437072-29437094 TATCAGCAGTGTGCTGGAGCTGG + Intronic
952277039 3:31887014-31887036 TGCCATTAGTGTGTTCGTGGGGG - Intronic
952669836 3:35953381-35953403 TGCCAGCAGTGTGCTGGAGATGG + Intergenic
953464158 3:43105188-43105210 TCCCATCAGTGAGCTGGAGACGG + Intronic
954446854 3:50551478-50551500 TGCTAGCAGGGTGCGGGAGGAGG + Intergenic
957368297 3:79255793-79255815 TGCTGTCAGTGTGGTGGAGGGGG - Intronic
960024306 3:112990843-112990865 TGCCTTCAGTGCGCGGGAGGAGG - Intergenic
960071825 3:113439838-113439860 TCCCAGCAGTGTGCCAGAGGTGG + Intronic
961872462 3:129998739-129998761 CTCCATGAGTTTGCTGGAGGAGG + Intergenic
962783894 3:138748317-138748339 TGGCAGCAGGGAGCTGGAGGTGG - Intronic
965433013 3:168612515-168612537 GGCCATCAAGGTGCTGGAAGAGG + Intergenic
967440595 3:189503332-189503354 TGCCTGCAGTGAGCTGGAGGTGG + Intergenic
969534338 4:7746767-7746789 TGCCACCAGCGTGTTGCAGGAGG - Intergenic
969564091 4:7967495-7967517 TGCCATCCGAGAGCAGGAGGTGG + Intronic
970150154 4:13081120-13081142 GTCCTTCAGTATGCTGGAGGGGG - Intergenic
973924927 4:55727865-55727887 TGCCCTGAGAGGGCTGGAGGCGG + Intergenic
974989238 4:69063876-69063898 AGCCATCAGTGGAGTGGAGGTGG - Intronic
979259499 4:118634256-118634278 TGCCATCAGAGGGCAGGAGCTGG - Intergenic
979690800 4:123556218-123556240 TGCCATCAGTGTTCTGGGAAGGG - Intergenic
980183999 4:129438641-129438663 TTCCATCACTGTTCTGGAGTTGG - Intergenic
982278052 4:153656973-153656995 TGCCCTCAGTGAGCTAGAGATGG + Intergenic
986443853 5:7804143-7804165 TGCCCTCTGAGTGCTTGAGGTGG - Intronic
989677244 5:43986189-43986211 TGCTATCAGTGGGCTGGAGGAGG - Intergenic
992981695 5:82181530-82181552 TGTCCTCAGTGAGATGGAGGGGG + Intronic
993519258 5:88880110-88880132 TTCCATCAGTATGCTGCATGTGG - Intronic
994135124 5:96277899-96277921 GGCCATGAGTGTGGTGGTGGTGG + Intergenic
996280106 5:121720046-121720068 TGCCACCAATGGGCTGGAGGAGG - Intergenic
997230683 5:132240059-132240081 TGAGATCAGTGGGGTGGAGGGGG + Intronic
999204802 5:149840352-149840374 GGCCATGAGTGTGCTGTTGGTGG + Intronic
1001661284 5:173395442-173395464 TGCCAGCAGAGGGCTGGACGAGG + Intergenic
1002857863 6:1054503-1054525 TGCCATGGGTGTGCTGAAGGGGG - Intergenic
1003166866 6:3687110-3687132 AGCCATTAGTCTGCTGGTGGGGG + Intergenic
1003297596 6:4846525-4846547 TTCCGTCAGAGTGCTGGAGAGGG + Intronic
1004860213 6:19796342-19796364 CACCATCAGTGTGGTGGTGGTGG - Intergenic
1006540796 6:34738097-34738119 TGCCCTCAGAGAGCAGGAGGAGG - Intergenic
1009942405 6:70304553-70304575 TTTCATCAGTGAGCTGGGGGAGG - Intergenic
1011551950 6:88538202-88538224 TGCCAGCAGTGTGCTTTAGGAGG + Intergenic
1015584128 6:134758355-134758377 TCCCATCAGTGTCATGGAGAAGG - Intergenic
1016189397 6:141244423-141244445 TTGTAGCAGTGTGCTGGAGGTGG + Intergenic
1018999639 6:168738389-168738411 TGCCATTACTGTGCTAGAAGTGG + Intergenic
1019212992 6:170421592-170421614 TGCGTCCAGTGTGCGGGAGGCGG + Intergenic
1019213006 6:170421654-170421676 TGCGTCCAGTGTGCGGGAGGCGG + Intergenic
1019213021 6:170421716-170421738 TGCGTCCAGTGTGCGGGAGGCGG + Intergenic
1019213036 6:170421778-170421800 TGCGTCCAGTGTGCGGGAGGCGG + Intergenic
1019341149 7:509666-509688 TGCCATCAGTGTGAGGGGCGGGG - Intronic
1019414013 7:919202-919224 TGGCAACACTGTGCTGCAGGTGG - Intronic
1019728672 7:2617512-2617534 AGCCCACAGGGTGCTGGAGGGGG - Intergenic
1022520618 7:31004626-31004648 TCCCATCAGCTTCCTGGAGGTGG - Intergenic
1023025783 7:36048571-36048593 TGCCCTCAGTGGGGTGGGGGTGG + Intergenic
1023236816 7:38098926-38098948 TGCCATCACAGATCTGGAGGAGG + Intergenic
1024269598 7:47632396-47632418 AGCCATCAGAGTGTTTGAGGTGG + Intergenic
1024685956 7:51745246-51745268 TGCCTTCAGTGTGCTTGAAACGG + Intergenic
1025607293 7:63048385-63048407 TGTCTGCAGTGTGATGGAGGAGG - Intergenic
1026841123 7:73670391-73670413 AGCGATCAGTGAGCTGAAGGTGG + Intronic
1032696920 7:134345109-134345131 TGGGATGGGTGTGCTGGAGGTGG + Intergenic
1033114579 7:138613953-138613975 TGCCAGTGGTGTGCTGGAGCTGG - Intronic
1035093267 7:156331696-156331718 TGCCGTCAGTGTGCTGACTGTGG - Intergenic
1035469091 7:159098269-159098291 AGCCCTCAGTCTGCTGGTGGTGG + Intronic
1036063282 8:5350164-5350186 TGGGGTCAGTGTGCTGGGGGCGG - Intergenic
1036791959 8:11726849-11726871 TTCCATCAGTGTTCTGGACCTGG + Intronic
1037292062 8:17361385-17361407 TCCCAAGAGTGTGCTGGGGGTGG - Intronic
1037820040 8:22131039-22131061 TTCCCGCAGGGTGCTGGAGGAGG - Exonic
1038611410 8:29062980-29063002 TGCGAGCAGAGTGCTGGGGGTGG + Intronic
1040662874 8:49596141-49596163 TGTCATCAGTGTTCTGGATTTGG - Intergenic
1043804749 8:84657825-84657847 GTCAATCAGTGGGCTGGAGGAGG + Intronic
1043951009 8:86309268-86309290 AGCCATGGGTGTGCTGGAGCTGG - Intronic
1046335300 8:112778846-112778868 TGCCATCAGTGTCCTGGATCTGG + Intronic
1047229110 8:122980861-122980883 ATCCCTTAGTGTGCTGGAGGAGG - Intergenic
1047576757 8:126164462-126164484 TGCAATCATTTTGCTGGTGGAGG + Intergenic
1049600131 8:143503790-143503812 AGCCAGCTGGGTGCTGGAGGAGG - Intronic
1049606183 8:143530240-143530262 TGTCGCCAGTGTGCTGGTGGAGG - Intronic
1049835964 8:144735741-144735763 TGCCATCACTTAGCAGGAGGTGG - Intronic
1051544442 9:18258619-18258641 TGCCATGAGGGTCCTGGAGAAGG - Intergenic
1052894161 9:33731754-33731776 GGCCATCAGGGAGCTGGGGGTGG - Intergenic
1053426361 9:38012729-38012751 TGCCCTCCGTGTGCCGCAGGTGG - Intronic
1057024260 9:91723842-91723864 TGCCATGGATGTGTTGGAGGGGG + Exonic
1057231356 9:93323545-93323567 AGGCATCACTGTGCTGGTGGTGG + Intronic
1057236739 9:93367078-93367100 AGGCATCACTGTGCTGGTGGTGG - Intergenic
1059875762 9:118632957-118632979 GGCCATTATTGTGTTGGAGGTGG - Intergenic
1060174726 9:121489016-121489038 AGCCAGCAGTGTGATGGAGTTGG + Intergenic
1060689877 9:125648367-125648389 TGACATCAGTGAGATGTAGGGGG - Intronic
1061127266 9:128684745-128684767 TTCCAGCAGAGAGCTGGAGGTGG - Intronic
1185509123 X:649702-649724 TCCTATCAGTGTGCTGGAGCTGG - Intronic
1187573408 X:20529193-20529215 GGCCAGCAGTGTGCTGGGGATGG - Intergenic
1187873276 X:23782126-23782148 TACCATCAATGTGCTGAAAGAGG + Intergenic
1188759649 X:34011254-34011276 GGGCTTCCGTGTGCTGGAGGAGG - Intergenic
1191920297 X:66248968-66248990 GGCCATCAGTGTTGTGGAGGTGG + Intronic
1196018777 X:110967301-110967323 TATCTTCAGTGAGCTGGAGGGGG + Intronic
1196176568 X:112645046-112645068 TGCCAAGTGTGTGTTGGAGGGGG + Intronic
1197005862 X:121496854-121496876 AGCCATCAGTGTGCTGTAACTGG + Intergenic
1197043603 X:121970071-121970093 AGCCATCCTGGTGCTGGAGGTGG - Intergenic
1198931025 X:141860244-141860266 TGTCATCAGTGTGATGGAACTGG - Intronic
1199951425 X:152708968-152708990 TGCCTTCACTGTCCTGGGGGAGG - Intergenic
1199955620 X:152740261-152740283 TGCCTTCACTGTCCTGGGGGAGG + Intergenic
1199958258 X:152759493-152759515 TGCCTTCACTGTCCTGGGGGAGG + Intergenic
1200223722 X:154405047-154405069 TGACATCATGGTGCTGCAGGAGG - Exonic
1201663772 Y:16426276-16426298 TCCTAGCAGTGTGCAGGAGGTGG + Intergenic