ID: 948169164

View in Genome Browser
Species Human (GRCh38)
Location 2:235887418-235887440
Sequence GGTCTACAGAGGCTGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948169164_948169169 17 Left 948169164 2:235887418-235887440 CCCATGTCCAGCCTCTGTAGACC 0: 1
1: 0
2: 1
3: 13
4: 158
Right 948169169 2:235887458-235887480 AGTAGATGTTAACCTGTCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948169164 Original CRISPR GGTCTACAGAGGCTGGACAT GGG (reversed) Intronic
900819078 1:4872413-4872435 GGTCTCCAGAGACTGCAGATGGG - Intergenic
901296379 1:8164193-8164215 GATCTACAGAGGCAGAAAATAGG - Intergenic
901327298 1:8374887-8374909 GGACTACAGGGCCTGGACAGAGG - Intronic
902448735 1:16483896-16483918 GGTCTACAGAGCCAGGACCCTGG - Intergenic
903667549 1:25017194-25017216 GATCTACAGAGGCAGGAGCTGGG - Intergenic
904105585 1:28079415-28079437 GGTTTACAAAGACTGGACTTGGG + Intronic
904996821 1:34637863-34637885 GGTTTACAGAGGCTGTGCACAGG - Intergenic
906658543 1:47566114-47566136 GCTCTACAGAGGATGGTAATTGG - Intergenic
910671173 1:89774367-89774389 GATCTACAGTGGCTGCACAGTGG - Intronic
911098665 1:94076750-94076772 GGCCAACAGAGGCTGGACCCTGG + Intronic
913024761 1:114826418-114826440 GGTTTCCAGAGGCTGGAAATGGG + Intergenic
915039364 1:152955086-152955108 GGTTACCAGAGGCTGGGCATTGG + Intergenic
915317456 1:155037154-155037176 GGTCTACAGAGGCATTACAGAGG + Intronic
917506844 1:175635019-175635041 GTGCTACAGAGGCTGGCCAGGGG + Intronic
917800713 1:178567436-178567458 GGTGCACAGGGGCTGCACATAGG - Intergenic
918204555 1:182297421-182297443 AGTCTCCAGAGGCAGGACAGAGG - Intergenic
918695882 1:187545889-187545911 GGCCTACAGAAAATGGACATGGG + Intergenic
918997387 1:191779946-191779968 GGTTACCAGAGGCTGGATATGGG + Intergenic
920915546 1:210255252-210255274 GGTCTACTGAGGATGGAGACTGG - Intergenic
921358125 1:214305688-214305710 GCTATACAGAGGCTGGACTAGGG - Intronic
922039492 1:221882665-221882687 AGTCTACAGAGGTCAGACATAGG - Intergenic
922703510 1:227776161-227776183 GGACCACAGAGTCTGGCCATGGG + Intronic
923359546 1:233197093-233197115 GGTGGCCAGAGGCTGGAGATAGG + Intronic
1064691451 10:17922879-17922901 GGTGTCAAGAGCCTGGACATTGG + Intergenic
1067441592 10:46311770-46311792 GCTCTACAGGGGCTGGACTTTGG + Intronic
1068900857 10:62268369-62268391 GCTCTAAAGGGCCTGGACATCGG - Intronic
1071242706 10:83725808-83725830 GGGCTACTGAGGCTGAACATGGG + Intergenic
1072541651 10:96402808-96402830 GGTCAGAAGAGGCTGGACAGAGG - Intronic
1076461383 10:130649712-130649734 GGCCTAGAAAGGCAGGACATTGG - Intergenic
1076794182 10:132790769-132790791 GGTCCACAAAGGCTGGGCAGGGG - Intergenic
1077242322 11:1517193-1517215 GGGCCACAGAGGCTGGGCACTGG - Intergenic
1079405871 11:20145303-20145325 GGTCAACAGTCTCTGGACATCGG - Intergenic
1083725853 11:64627609-64627631 AGTCTCCAGGGGCTGGAGATTGG - Intronic
1090766821 11:129883503-129883525 GTTTTACAGAGTCTGGAAATGGG + Intronic
1091218562 11:133918021-133918043 GCTCTAGAGGGGCCGGACATGGG + Intronic
1092009276 12:5096111-5096133 TGTCCACAGAGCATGGACATTGG + Intergenic
1094325474 12:29233218-29233240 GGTGCAGAGAAGCTGGACATTGG - Intronic
1098411409 12:70188323-70188345 GGCCAGCAGAGGCTGGACACAGG + Intergenic
1105452528 13:20512779-20512801 GGTTAACAGAGGCTGGACGGGGG + Intronic
1107948279 13:45439190-45439212 TGTCTGCAGAGCCTGGACACTGG - Intergenic
1108044729 13:46372780-46372802 AACCTACAGAGGCTTGACATTGG + Intronic
1113158437 13:107352146-107352168 GGTTTACAGAGACTGCACACAGG - Intronic
1114238359 14:20842336-20842358 AGTCTACAGGGGCTGGAGAAGGG + Intergenic
1116222129 14:42100978-42101000 GGTTAACAGAGGCTGGAGTTGGG + Intergenic
1117378042 14:55133478-55133500 AGTGTAGATAGGCTGGACATAGG + Intronic
1117803409 14:59466424-59466446 GGTTCACAGAGTATGGACATTGG + Intronic
1119651733 14:76388735-76388757 GGCCTCCAGAGGCTGGGCATGGG - Intronic
1122322355 14:100862666-100862688 GTTCAACAGAGGCTGGAGCTGGG - Intergenic
1122935466 14:104954069-104954091 GGACTGCAGAGCCTGGAAATCGG - Exonic
1127035332 15:54909362-54909384 GTTCTTCAGTGTCTGGACATTGG - Intergenic
1130601729 15:85279989-85280011 GGTCAAGAGAGGTTGGATATTGG + Intergenic
1131216809 15:90543873-90543895 GGTTTCCAGAGGCTGGAGGTGGG - Intronic
1132423800 15:101696886-101696908 GGTTTATAAAGGCTGCACATGGG + Intronic
1132939145 16:2498449-2498471 TGCCCACAGAGGCTGGAAATGGG + Intronic
1133402178 16:5496292-5496314 GGTGTCAAGAGCCTGGACATTGG + Intergenic
1133872943 16:9706465-9706487 GGTTTACAGAGGCTGCACATAGG + Intergenic
1140194550 16:72845693-72845715 GGTCTACACAGGCAGGAGAAAGG - Intronic
1140861988 16:79026088-79026110 GGGCAACAGGGGCTGGGCATGGG - Intronic
1144794413 17:17881390-17881412 GGTCTGCAGGGTCTGGGCATAGG - Intronic
1153371944 18:4327746-4327768 GGTTTTCAGAAGCTGGAAATGGG - Intronic
1153534202 18:6083250-6083272 GGTCTTCAGAGAATGGAGATGGG + Intronic
1154502440 18:15003534-15003556 TGTTTACAGAGGCTGGGCAGGGG - Intergenic
1157478103 18:48036236-48036258 GGTCTAGAGAGGAGGGACAGAGG - Intronic
1158217641 18:55116641-55116663 GGTCCACAGAGCCTTGAAATGGG - Intergenic
1160824579 19:1073770-1073792 GGCCTCCAGAAGCTGGACACAGG - Intronic
1162810626 19:13162764-13162786 GATCTACAGAGGCTGAACTGGGG - Intergenic
1163535596 19:17874485-17874507 TGTCTACAGATGCTGTACACCGG + Exonic
1164608321 19:29615855-29615877 TGTCTACAGAGGCTCGCCTTTGG + Intronic
1166380623 19:42353454-42353476 GGCCTCCACAGACTGGACATGGG + Exonic
1167023743 19:46898994-46899016 GGTTTTCAAAGGCTGGAGATTGG - Intergenic
1167585489 19:50372671-50372693 GGTGTCAAGAGCCTGGACATTGG - Intronic
926922692 2:17954830-17954852 GGTCTGCAGAGAGTGGACAATGG + Intronic
931459375 2:62437091-62437113 GGTTTACAGAGGCTGTGCACAGG - Intergenic
932056816 2:68453988-68454010 GGTTTACAGAAGCTGCACACAGG + Intergenic
932082117 2:68724716-68724738 GCTGGACAGAGGCTGGAGATAGG - Intronic
932928219 2:76001996-76002018 GGTTAACAGAGGCTGGGAATAGG - Intergenic
933814230 2:86052817-86052839 GCTCTACAGAGGCTTCACCTTGG - Exonic
935039890 2:99416110-99416132 GGACTAAAGAGGTTGGAGATGGG + Intronic
937252149 2:120531470-120531492 GGTTTCCAGAGGCTGGAGAAAGG + Intergenic
937332715 2:121042291-121042313 GGTCTGCTGGGGCTGGCCATGGG + Intergenic
937875013 2:126818391-126818413 GGTCTTCAGATGCTTGACATTGG - Intergenic
938501615 2:131833706-131833728 TGTTTACAGAGGCTGGGCAGGGG - Intergenic
939308999 2:140448586-140448608 GGTTACCAGAGGCTGGAGATTGG + Intronic
940147932 2:150567178-150567200 AGTCAAGAGAGGCTGGGCATGGG + Intergenic
940442963 2:153742133-153742155 GATTTACAGAGGCTGGGGATTGG - Intergenic
942111046 2:172683055-172683077 CGTATAAAGAGGCTGGGCATGGG + Intergenic
943165073 2:184311917-184311939 GGTCAACACAGGATGGACAATGG + Intergenic
944682415 2:202089076-202089098 GGCCTGCAGAGGCTGAACAATGG - Intronic
946157398 2:217815988-217816010 GGTCTGCAGAGTCTGGGCATGGG - Intronic
946812786 2:223544038-223544060 GGTTTACAGAGGCTGGGGGTAGG - Intergenic
948105659 2:235411778-235411800 GGTCTTCAGACCCTGGACCTGGG + Intergenic
948169164 2:235887418-235887440 GGTCTACAGAGGCTGGACATGGG - Intronic
948253741 2:236551304-236551326 GGTCTCCTGAGGCTTGACAAGGG - Intergenic
1169205600 20:3738696-3738718 GGCCTGCAGGGGCTGTACATCGG + Exonic
1169402163 20:5291778-5291800 GTTCTACAGAGAATGGAAATTGG - Intergenic
1169912275 20:10656717-10656739 GGTTTAGAGAGGCTGGACGAAGG - Intronic
1171982441 20:31637694-31637716 GGTCTCCAGAGGCAGGACCCCGG + Intergenic
1172779410 20:37426954-37426976 GTTCTCCAGGGGCTGGTCATTGG - Intergenic
1173316871 20:41952497-41952519 GGGCTAAAGAGGCTGGGCTTTGG + Intergenic
1173844075 20:46177113-46177135 GGTCCTCAGAGGGTGGACAGAGG + Intronic
1174828683 20:53792987-53793009 GGTCTCCTGAGGCTGGAGCTTGG - Intergenic
1176012735 20:62908330-62908352 GGTCTCCAGAGGCTTGGCAGGGG - Intronic
1179071469 21:38075385-38075407 GGTTACCAGAGGCTGGGCATGGG + Intronic
1179630980 21:42678572-42678594 GGAAAGCAGAGGCTGGACATTGG + Intronic
1179934593 21:44593984-44594006 GGTTTACAGAGGCTGTGCACTGG + Intronic
1181177174 22:21044519-21044541 GGTCTACTGAGGCTGGGGGTGGG - Intergenic
1181184791 22:21095301-21095323 TGTCTCCAGAGGCTGGAGCTGGG - Intergenic
1181909177 22:26224619-26224641 AGTCTACAGAGGTTTGACATAGG + Intronic
1184531358 22:45057762-45057784 GTGCCACAGAGGCTGGACGTTGG - Intergenic
1185079599 22:48702353-48702375 GTCCTACAGAGGCTTGAGATCGG + Intronic
953217551 3:40934712-40934734 GGTTACCAGAGGCTGGATATTGG - Intergenic
953991323 3:47485687-47485709 GCTCTACAGCCACTGGACATTGG - Intergenic
954118035 3:48478083-48478105 GGCCCACACAGGCTGGGCATAGG + Intronic
954136867 3:48585897-48585919 GGTGAACAGAGGCTGCACCTGGG - Intronic
958908369 3:99966223-99966245 AGGCTGCAGAGGCTGGGCATGGG + Intronic
962316242 3:134361267-134361289 AGTCCCCCGAGGCTGGACATGGG + Intronic
969338478 4:6526050-6526072 CATCTACAGAGGCTGCACAGAGG + Intronic
970025707 4:11622067-11622089 GCTCTGCTGAGGCTGGCCATTGG + Intergenic
976915309 4:90366643-90366665 GGGTTACAGAGGCTGGAGGTGGG - Intronic
977935379 4:102796807-102796829 GTTCTACAGAGAATGGAAATTGG - Intronic
978255066 4:106683068-106683090 TGTCTACAGAGGATGAAAATTGG - Intergenic
983079870 4:163371998-163372020 GGTTTACAGAGGCTGCACACTGG + Intergenic
984489772 4:180418290-180418312 TGTCTACTGAGGCTGGAGGTGGG - Intergenic
986309272 5:6539671-6539693 GGTGAACAGAGACTGGACATGGG + Intergenic
986904352 5:12475885-12475907 GGTCTGGAGAAGCTGCACATGGG + Intergenic
987142079 5:14956876-14956898 GGTCTTCAGAGGCTGGACCAAGG + Intergenic
989007239 5:36828446-36828468 GGCCTAAAGAGGCTGGAAGTAGG + Intergenic
989679248 5:44009737-44009759 GGTTAACAGAGGCTGGGGATGGG - Intergenic
990318291 5:54604994-54605016 GGTAGACACAGGCTGGATATTGG + Intergenic
993110533 5:83651769-83651791 GGTCTCTAGAGGGTGGACATTGG + Intronic
995739497 5:115340129-115340151 AAGCTACAGTGGCTGGACATTGG + Intergenic
997511614 5:134458567-134458589 GGGCTCCAGAGGCAGGACAGGGG - Intergenic
1000005144 5:157176276-157176298 GAACCACAGAGGCTGGGCATGGG - Intronic
1002100207 5:176853837-176853859 GGGCGACAGAGGATGGACAGAGG + Intronic
1004226899 6:13793585-13793607 GGTCACCAGAGGCTGGAAAAGGG + Intronic
1004771164 6:18783968-18783990 GATATACGTAGGCTGGACATTGG + Intergenic
1008425601 6:51352247-51352269 GGTCTAAAGGGGCTGGAGACAGG + Intergenic
1008564560 6:52754616-52754638 GGACTTCAGAGGCTGGACCCCGG - Intronic
1008683280 6:53897074-53897096 GGACTAGAGATGATGGACATAGG + Intronic
1009814207 6:68710137-68710159 GGGCTACAGAGGCTGGCAAGTGG + Intronic
1012194016 6:96317001-96317023 GATCTACAGGGGCTGGCCAGAGG + Intergenic
1014329574 6:120044956-120044978 GTTCTACAGTGGCTGCCCATAGG - Intergenic
1015417299 6:132963942-132963964 GGTCTGCATAGGTTGGAAATGGG - Intergenic
1015613296 6:135049003-135049025 GGTCTGCAGAGGCTAAAAATAGG + Intronic
1017797698 6:157861982-157862004 GGTGTAGAGATGCTGGACAAAGG + Intronic
1019225780 6:170506886-170506908 GGTGTACAGTGGCTGCACACGGG - Intergenic
1024790795 7:52963068-52963090 GGTTTACAGAGGCTGCACACTGG - Intergenic
1025033502 7:55575697-55575719 GGTGTCAAGAGGCTGGACACCGG - Intergenic
1026928550 7:74210291-74210313 AGGCTACACAGGCTGGACAGGGG - Intronic
1027797122 7:82709823-82709845 AGTATACAGAGGCTGAACGTGGG + Intergenic
1029126813 7:98300393-98300415 TGTCTACAGAGGCTGGATGCGGG + Intronic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1034968070 7:155403736-155403758 GGGCTGCGGAGGCTGGACAGAGG + Intergenic
1035001896 7:155619327-155619349 TGTCTTCAGAGACTGGCCATGGG - Intronic
1035353858 7:158265520-158265542 GCTGTGCAGAGGGTGGACATGGG - Intronic
1036580534 8:10070667-10070689 GGTCGCCAGAGGTTGCACATGGG - Intronic
1038172775 8:25152944-25152966 GGCCTACATAGGCTAGTCATGGG - Intergenic
1039017640 8:33170006-33170028 GGTGTTCAGACACTGGACATGGG - Intergenic
1041662773 8:60415155-60415177 GGTCAACAGAGGCCAGGCATTGG + Intergenic
1043231029 8:77800838-77800860 AGCCAAGAGAGGCTGGACATGGG - Intergenic
1045225769 8:100244356-100244378 GATATTAAGAGGCTGGACATGGG - Intronic
1045658106 8:104407867-104407889 GGTCTTAAGATTCTGGACATAGG - Intronic
1047402098 8:124556364-124556386 GTTCACCAGAGGCTGGTCATAGG + Exonic
1049061233 8:140277759-140277781 GGGCTGCAGAGGCTGGGCAAGGG + Intronic
1051513391 9:17904851-17904873 AGACTACAGAGGCTGGAGACAGG - Intergenic
1056013208 9:82354291-82354313 GGTCTGCAGACACTGGACAAGGG - Intergenic
1057318915 9:93994114-93994136 AGTCCACAGAGGCTGTGCATGGG - Intergenic
1058255329 9:102754776-102754798 GGTTTTCAGAGGCTGGATGTTGG - Intergenic
1061705554 9:132450420-132450442 TGTGGACAGAGGCTGGACATGGG + Intronic
1062498057 9:136840843-136840865 TGTTTACAGAGGCTGGGCAGGGG + Exonic
1062543748 9:137052841-137052863 GGTCCACCGAGGCTGGCCGTGGG + Intronic
1185867011 X:3633122-3633144 GGACTACAGAGGCTGTAGCTGGG - Intronic
1187837605 X:23450709-23450731 GGTTACCAGAGGCTGGAGATGGG + Intergenic